{ "num_pairs": 290, "pairs": [ { "index": 1, "nt1": "///E/-1", "nt2": "///F/2", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": false, "chi1": -122.706, "conf1": "anti", "pucker1": "----", "lambda1": 45.451, "chi2": -169.966, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 133.157, "C1C1_dist": 8.701, "N1N9_dist": 8.698, "C6C8_dist": 10.247, "CNNC_torsion": 27.157, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[3.12],N1-O2'(hydroxyl)[2.67]", "interBase_angle": 26.121, "planarity": 0.366, "simple_Shear": -5.083, "simple_Stretch": 3.908, "simple_Buckle": 24.875, "simple_Propeller": 7.971, "bp_simpleParams": [ -5.083, 3.908, -0.799, 24.875, 7.971, 68.564 ], "bp_params": [ -6.412, 0.044, -0.799, 15.097, 21.316, 69.034 ], "frame": { "rmsd": null, "origin": [ 25.453, 37.188, 32.066 ], "x_axis": [ 0.407, -0.022, 0.913 ], "y_axis": [ 0.902, 0.169, -0.398 ], "z_axis": [ -0.145, 0.985, 0.089 ], "quaternion": [ 0.645, -0.536, -0.410, -0.358 ] } }, { "index": 2, "nt1": "///E/-1", "nt2": "///Q/56", "bp": "A+G", "name": "--", "Saenger": "--", "LW": ".H.", "DSSR": ".M+.", "intra_chain": false, "chi1": -122.706, "conf1": "anti", "pucker1": "----", "lambda1": 9.522, "chi2": -166.506, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 93.210, "C1C1_dist": 12.773, "N1N9_dist": 11.478, "C6C8_dist": 11.795, "CNNC_torsion": -76.247, "hbonds_num": 1, "hbonds_desc": "N6(amino)*N2(amino)[3.10]", "interBase_angle": 33.452, "planarity": 0.442, "simple_Shear": 0.132, "simple_Stretch": 6.106, "simple_Buckle": 23.607, "simple_Propeller": -23.702, "bp_simpleParams": [ 0.132, 6.106, -0.748, 23.607, -23.702, 71.749 ], "bp_params": [ -6.106, 0.114, -0.748, 23.637, 23.672, 71.769 ], "frame": { "rmsd": null, "origin": [ 25.331, 37.213, 31.945 ], "x_axis": [ 0.390, -0.008, 0.921 ], "y_axis": [ 0.917, 0.091, -0.387 ], "z_axis": [ -0.080, 0.996, 0.043 ], "quaternion": [ 0.617, -0.560, -0.406, -0.375 ] } }, { "index": 3, "nt1": "///E/0", "nt2": "///P/57", "bp": "a+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": false, "chi1": -126.334, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 63.782, "chi2": 179.783, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 86.474, "C1C1_dist": 8.155, "N1N9_dist": 7.891, "C6C8_dist": 10.204, "CNNC_torsion": 151.887, "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.96],N3-N2(amino)[3.07]", "interBase_angle": 30.755, "planarity": 0.366, "simple_Shear": 7.083, "simple_Stretch": 3.656, "simple_Buckle": 16.570, "simple_Propeller": -25.910, "bp_simpleParams": [ 7.083, 3.656, -0.670, 16.570, -25.910, 157.011 ], "bp_params": [ 2.811, 7.459, -0.670, 29.619, -8.284, 156.300 ], "frame": { "rmsd": null, "origin": [ 16.296, 38.328, 15.056 ], "x_axis": [ -0.963, -0.253, 0.092 ], "y_axis": [ 0.018, 0.279, 0.960 ], "z_axis": [ -0.269, 0.926, -0.264 ], "quaternion": [ -0.114, -0.074, 0.791, 0.596 ] } }, { "index": 4, "nt1": "///E/2", "nt2": "///P/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -169.617, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.548, "chi2": -162.607, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.481, "C1C1_dist": 10.535, "N1N9_dist": 8.953, "C6C8_dist": 9.977, "CNNC_torsion": -9.418, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.70],N3-N1(imino)[3.04]", "interBase_angle": 8.030, "planarity": 0.117, "simple_Shear": 0.654, "simple_Stretch": -0.006, "simple_Buckle": 4.051, "simple_Propeller": -6.933, "bp_simpleParams": [ 0.654, -0.006, 0.265, 4.051, -6.933, 5.428 ], "bp_params": [ 0.652, -0.044, 0.265, 3.640, -7.157, 5.436 ], "frame": { "rmsd": null, "origin": [ 16.532, 34.035, 12.324 ], "x_axis": [ 0.285, 0.051, -0.957 ], "y_axis": [ 0.908, 0.305, 0.287 ], "z_axis": [ 0.306, -0.951, 0.041 ], "quaternion": [ 0.639, 0.485, 0.495, -0.336 ] } }, { "index": 5, "nt1": "///E/2", "nt2": "///F/-1", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": false, "chi1": -169.617, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 133.384, "chi2": 57.708, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 34.436, "C1C1_dist": 9.085, "N1N9_dist": 8.934, "C6C8_dist": 10.254, "CNNC_torsion": 23.023, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.76],O2(carbonyl)-N6(amino)[3.12]", "interBase_angle": 22.521, "planarity": 0.306, "simple_Shear": 5.953, "simple_Stretch": 4.174, "simple_Buckle": -22.425, "simple_Propeller": 2.081, "bp_simpleParams": [ 5.953, 4.174, -0.657, -22.425, 2.081, 60.775 ], "bp_params": [ 7.201, -1.005, -0.657, -15.006, 16.793, 60.889 ], "frame": { "rmsd": null, "origin": [ 17.649, 34.657, 15.442 ], "x_axis": [ -0.128, -0.276, -0.952 ], "y_axis": [ 0.980, 0.113, -0.164 ], "z_axis": [ 0.153, -0.954, 0.256 ], "quaternion": [ 0.557, 0.354, 0.496, -0.564 ] } }, { "index": 6, "nt1": "///E/3", "nt2": "///P/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.691, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.406, "chi2": -165.008, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.879, "C1C1_dist": 10.472, "N1N9_dist": 8.789, "C6C8_dist": 9.768, "CNNC_torsion": -5.225, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.98],N1(imino)-N3[2.83],N2(amino)-O2(carbonyl)[2.60]", "interBase_angle": 11.769, "planarity": 0.183, "simple_Shear": -0.413, "simple_Stretch": -0.205, "simple_Buckle": 6.051, "simple_Propeller": -10.094, "bp_simpleParams": [ -0.413, -0.205, -0.129, 6.051, -10.094, 4.378 ], "bp_params": [ -0.405, -0.220, -0.129, 6.427, -9.859, 4.387 ], "frame": { "rmsd": null, "origin": [ 15.636, 30.513, 12.250 ], "x_axis": [ 0.624, 0.306, -0.719 ], "y_axis": [ 0.678, 0.244, 0.693 ], "z_axis": [ 0.387, -0.920, -0.056 ], "quaternion": [ 0.673, 0.599, 0.411, -0.138 ] } }, { "index": 7, "nt1": "///E/4", "nt2": "///P/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.570, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.674, "chi2": -168.039, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.409, "C1C1_dist": 10.629, "N1N9_dist": 8.927, "C6C8_dist": 9.865, "CNNC_torsion": -10.656, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 18.205, "planarity": 0.205, "simple_Shear": 0.200, "simple_Stretch": -0.122, "simple_Buckle": 9.092, "simple_Propeller": -15.772, "bp_simpleParams": [ 0.200, -0.122, -0.233, 9.092, -15.772, 1.855 ], "bp_params": [ 0.199, -0.124, -0.233, 8.911, -15.875, 1.868 ], "frame": { "rmsd": null, "origin": [ 16.033, 27.222, 10.760 ], "x_axis": [ 0.877, 0.409, -0.250 ], "y_axis": [ 0.250, 0.056, 0.967 ], "z_axis": [ 0.410, -0.911, -0.053 ], "quaternion": [ 0.685, 0.685, 0.241, 0.058 ] } }, { "index": 8, "nt1": "///E/5", "nt2": "///P/53", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -121.421, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.251, "chi2": -165.719, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.909, "C1C1_dist": 10.794, "N1N9_dist": 8.988, "C6C8_dist": 9.848, "CNNC_torsion": 3.098, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.77]", "interBase_angle": 10.692, "planarity": 0.123, "simple_Shear": -0.036, "simple_Stretch": -0.136, "simple_Buckle": 10.508, "simple_Propeller": -1.977, "bp_simpleParams": [ -0.036, -0.136, -0.513, 10.508, -1.977, -2.014 ], "bp_params": [ -0.035, -0.136, -0.513, 10.525, -1.882, -2.006 ], "frame": { "rmsd": null, "origin": [ 17.537, 24.544, 8.677 ], "x_axis": [ 0.746, 0.625, 0.229 ], "y_axis": [ -0.110, -0.224, 0.968 ], "z_axis": [ 0.657, -0.747, -0.099 ], "quaternion": [ 0.596, 0.719, 0.179, 0.308 ] } }, { "index": 9, "nt1": "///E/7", "nt2": "///P/27", "bp": "G-G", "name": "--", "Saenger": "--", "LW": "tH.", "DSSR": "tM-.", "intra_chain": false, "chi1": -177.303, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 11.017, "chi2": -131.787, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 89.273, "C1C1_dist": 11.701, "N1N9_dist": 10.308, "C6C8_dist": 10.701, "CNNC_torsion": -14.961, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N2(amino)[2.73]", "interBase_angle": 6.252, "planarity": 0.101, "simple_Shear": -6.643, "simple_Stretch": 3.424, "simple_Buckle": -0.563, "simple_Propeller": 6.226, "bp_simpleParams": [ -6.643, 3.424, 0.229, -0.563, 6.226, -11.666 ], "bp_params": [ -7.216, -1.943, 0.229, -4.609, 4.224, -11.664 ], "frame": { "rmsd": null, "origin": [ 18.802, 20.586, 9.302 ], "x_axis": [ 0.112, 0.018, 0.994 ], "y_axis": [ -0.871, -0.479, 0.107 ], "z_axis": [ 0.478, -0.877, -0.038 ], "quaternion": [ 0.386, 0.638, -0.334, 0.577 ] } }, { "index": 10, "nt1": "///E/7", "nt2": "///P/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -177.303, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.219, "chi2": -162.139, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.436, "C1C1_dist": 10.541, "N1N9_dist": 8.964, "C6C8_dist": 9.932, "CNNC_torsion": -9.622, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.30],N1(imino)-N3[3.12],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 31.923, "planarity": 0.355, "simple_Shear": -0.478, "simple_Stretch": 0.212, "simple_Buckle": -28.323, "simple_Propeller": -14.727, "bp_simpleParams": [ -0.478, 0.212, -0.379, -28.323, -14.727, 5.081 ], "bp_params": [ -0.483, 0.199, -0.379, -28.026, -15.285, 4.977 ], "frame": { "rmsd": null, "origin": [ 19.535, 20.863, 5.829 ], "x_axis": [ 0.147, 0.224, 0.963 ], "y_axis": [ -0.730, -0.633, 0.259 ], "z_axis": [ 0.668, -0.741, 0.070 ], "quaternion": [ 0.382, 0.654, -0.193, 0.624 ] } }, { "index": 11, "nt1": "///E/8", "nt2": "///P/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.796, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.974, "chi2": -156.781, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.182, "C1C1_dist": 10.788, "N1N9_dist": 8.997, "C6C8_dist": 9.843, "CNNC_torsion": -18.057, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.97]", "interBase_angle": 23.733, "planarity": 0.288, "simple_Shear": 0.110, "simple_Stretch": 0.009, "simple_Buckle": 16.222, "simple_Propeller": -17.324, "bp_simpleParams": [ 0.110, 0.009, 0.423, 16.222, -17.324, -3.431 ], "bp_params": [ 0.110, 0.009, 0.423, 16.140, -17.400, -3.437 ], "frame": { "rmsd": null, "origin": [ 20.521, 18.070, 8.999 ], "x_axis": [ -0.748, -0.212, 0.629 ], "y_axis": [ -0.597, -0.197, -0.777 ], "z_axis": [ 0.289, -0.957, 0.021 ], "quaternion": [ 0.137, 0.327, -0.618, 0.701 ] } }, { "index": 12, "nt1": "///E/8", "nt2": "///P/50", "bp": "A+U", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": false, "chi1": -159.796, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 94.201, "chi2": -150.292, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 20.876, "C1C1_dist": 7.963, "N1N9_dist": 6.955, "C6C8_dist": 8.541, "CNNC_torsion": 160.020, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O4(carbonyl)[2.33],N3-N3(imino)[3.11]", "interBase_angle": 25.112, "planarity": 0.297, "simple_Shear": 3.890, "simple_Stretch": 1.912, "simple_Buckle": -24.125, "simple_Propeller": -6.969, "bp_simpleParams": [ 3.890, 1.912, -0.897, -24.125, -6.969, -102.820 ], "bp_params": [ -0.358, -4.320, -0.897, 6.502, 24.255, -103.987 ], "frame": { "rmsd": null, "origin": [ 21.028, 17.635, 6.887 ], "x_axis": [ -0.737, -0.650, -0.185 ], "y_axis": [ 0.151, 0.108, -0.983 ], "z_axis": [ 0.658, -0.752, 0.018 ], "quaternion": [ 0.312, -0.185, 0.676, -0.642 ] } }, { "index": 13, "nt1": "///E/9", "nt2": "///P/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.464, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.277, "chi2": -162.541, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 62.546, "C1C1_dist": 10.365, "N1N9_dist": 8.807, "C6C8_dist": 9.870, "CNNC_torsion": -20.428, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.51],N1-N3(imino)[3.04]", "interBase_angle": 27.269, "planarity": 0.324, "simple_Shear": -0.595, "simple_Stretch": 0.109, "simple_Buckle": 18.528, "simple_Propeller": -20.008, "bp_simpleParams": [ -0.595, 0.109, 0.618, 18.528, -20.008, 6.631 ], "bp_params": [ -0.601, 0.067, 0.618, 19.863, -18.684, 6.622 ], "frame": { "rmsd": null, "origin": [ 21.061, 15.087, 10.318 ], "x_axis": [ -0.979, -0.138, 0.152 ], "y_axis": [ -0.145, -0.064, -0.987 ], "z_axis": [ 0.146, -0.988, 0.043 ], "quaternion": [ 0.002, 0.103, -0.684, 0.722 ] } }, { "index": 14, "nt1": "///E/10", "nt2": "///P/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -159.743, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.466, "chi2": -163.894, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.043, "C1C1_dist": 10.584, "N1N9_dist": 8.982, "C6C8_dist": 10.013, "CNNC_torsion": -23.597, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.88],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[3.23]", "interBase_angle": 28.448, "planarity": 0.349, "simple_Shear": 0.044, "simple_Stretch": 0.006, "simple_Buckle": 4.480, "simple_Propeller": -28.093, "bp_simpleParams": [ 0.044, 0.006, 0.002, 4.480, -28.093, 5.525 ], "bp_params": [ 0.044, 0.006, 0.002, 4.532, -28.084, 5.691 ], "frame": { "rmsd": null, "origin": [ 21.126, 11.657, 11.922 ], "x_axis": [ -0.868, -0.070, -0.491 ], "y_axis": [ 0.496, -0.080, -0.865 ], "z_axis": [ 0.021, -0.994, 0.104 ], "quaternion": [ -0.197, -0.164, -0.649, 0.716 ] } }, { "index": 15, "nt1": "///E/11", "nt2": "///P/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.615, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.082, "chi2": -166.268, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.675, "C1C1_dist": 10.936, "N1N9_dist": 9.255, "C6C8_dist": 10.239, "CNNC_torsion": -13.050, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.19],O4(carbonyl)-N6(amino)[3.38]", "interBase_angle": 13.663, "planarity": 0.170, "simple_Shear": -0.480, "simple_Stretch": 0.307, "simple_Buckle": -4.567, "simple_Propeller": -12.877, "bp_simpleParams": [ -0.480, 0.307, 0.194, -4.567, -12.877, 1.939 ], "bp_params": [ -0.495, 0.282, 0.194, -3.886, -13.099, 1.951 ], "frame": { "rmsd": null, "origin": [ 19.984, 8.365, 13.332 ], "x_axis": [ -0.515, 0.139, -0.846 ], "y_axis": [ 0.850, -0.048, -0.525 ], "z_axis": [ -0.113, -0.989, -0.093 ], "quaternion": [ 0.293, 0.395, 0.625, -0.606 ] } }, { "index": 16, "nt1": "///E/11", "nt2": "///P/111", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": false, "chi1": -164.615, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 151.720, "chi2": -138.610, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 105.650, "C1C1_dist": 5.398, "N1N9_dist": 7.193, "C6C8_dist": 9.767, "CNNC_torsion": -30.729, "hbonds_num": 4, "hbonds_desc": "O3'-O2'(hydroxyl)[3.10],O2'(hydroxyl)-O2'(hydroxyl)[3.02],O2'(hydroxyl)-N3[2.98],O2(carbonyl)-N2(amino)[3.09]", "interBase_angle": 23.230, "planarity": 0.328, "simple_Shear": 0.389, "simple_Stretch": 7.975, "simple_Buckle": -17.014, "simple_Propeller": -15.817, "bp_simpleParams": [ 0.389, 7.975, -0.146, -17.014, -15.817, 159.771 ], "bp_params": [ 1.734, 7.794, -0.146, -19.455, -12.695, 159.602 ], "frame": { "rmsd": null, "origin": [ 22.412, 8.617, 16.774 ], "x_axis": [ -0.932, 0.129, 0.339 ], "y_axis": [ -0.356, -0.147, -0.923 ], "z_axis": [ -0.069, -0.981, 0.183 ], "quaternion": [ 0.161, 0.090, -0.633, 0.752 ] } }, { "index": 17, "nt1": "///P/12", "nt2": "///P/22", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 176.083, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.332, "chi2": -161.587, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.106, "C1C1_dist": 11.060, "N1N9_dist": 9.316, "C6C8_dist": 10.213, "CNNC_torsion": -12.749, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.29],N1(imino)-N3[3.15],N2(amino)-O2(carbonyl)[3.26]", "interBase_angle": 18.443, "planarity": 0.210, "simple_Shear": -0.236, "simple_Stretch": 0.164, "simple_Buckle": -8.079, "simple_Propeller": -16.579, "bp_simpleParams": [ -0.236, 0.164, -0.094, -8.079, -16.579, -1.565 ], "bp_params": [ -0.239, 0.161, -0.094, -7.786, -16.719, -1.578 ], "frame": { "rmsd": null, "origin": [ 17.883, 5.282, 13.954 ], "x_axis": [ 0.062, 0.138, -0.989 ], "y_axis": [ 0.981, -0.188, 0.035 ], "z_axis": [ -0.181, -0.972, -0.147 ], "quaternion": [ 0.426, 0.591, 0.474, -0.495 ] } }, { "index": 18, "nt1": "///P/13", "nt2": "///P/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.150, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.645, "chi2": -153.573, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.417, "C1C1_dist": 10.656, "N1N9_dist": 9.088, "C6C8_dist": 10.149, "CNNC_torsion": -11.655, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.55],N1(imino)-N3[3.21],N2(amino)-O2(carbonyl)[2.86]", "interBase_angle": 22.551, "planarity": 0.254, "simple_Shear": -0.664, "simple_Stretch": 0.242, "simple_Buckle": -14.378, "simple_Propeller": -17.374, "bp_simpleParams": [ -0.664, 0.242, -0.193, -14.378, -17.374, 8.042 ], "bp_params": [ -0.676, 0.206, -0.193, -13.427, -18.119, 8.089 ], "frame": { "rmsd": null, "origin": [ 15.756, 2.407, 12.686 ], "x_axis": [ 0.568, 0.132, -0.812 ], "y_axis": [ 0.814, -0.238, 0.530 ], "z_axis": [ -0.124, -0.962, -0.242 ], "quaternion": [ 0.521, 0.716, 0.330, -0.327 ] } }, { "index": 19, "nt1": "///P/14", "nt2": "///P/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -151.799, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.415, "chi2": -162.185, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.735, "C1C1_dist": 10.646, "N1N9_dist": 9.076, "C6C8_dist": 10.196, "CNNC_torsion": -16.524, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.67],N3-N1(imino)[3.17],N4(amino)-O6(carbonyl)[3.68]", "interBase_angle": 17.795, "planarity": 0.230, "simple_Shear": 0.435, "simple_Stretch": 0.244, "simple_Buckle": 1.171, "simple_Propeller": -17.756, "bp_simpleParams": [ 0.435, 0.244, 0.209, 1.171, -17.756, 10.411 ], "bp_params": [ 0.444, 0.228, 0.209, 0.497, -17.788, 10.537 ], "frame": { "rmsd": null, "origin": [ 14.649, -0.084, 11.213 ], "x_axis": [ 0.954, -0.007, -0.300 ], "y_axis": [ 0.287, -0.270, 0.919 ], "z_axis": [ -0.088, -0.963, -0.256 ], "quaternion": [ 0.598, 0.787, 0.089, -0.123 ] } }, { "index": 20, "nt1": "///P/15", "nt2": "///P/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.212, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.191, "chi2": -161.428, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.250, "C1C1_dist": 10.833, "N1N9_dist": 9.064, "C6C8_dist": 9.936, "CNNC_torsion": -15.224, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.13],N1-N3(imino)[3.13]", "interBase_angle": 17.278, "planarity": 0.213, "simple_Shear": -0.670, "simple_Stretch": 0.023, "simple_Buckle": 4.329, "simple_Propeller": -16.726, "bp_simpleParams": [ -0.670, 0.023, 0.277, 4.329, -16.726, -3.215 ], "bp_params": [ -0.670, -0.022, 0.277, 5.416, -16.407, -3.245 ], "frame": { "rmsd": null, "origin": [ 13.757, -2.520, 9.345 ], "x_axis": [ 0.973, 0.092, 0.213 ], "y_axis": [ -0.180, -0.275, 0.944 ], "z_axis": [ 0.145, -0.957, -0.251 ], "quaternion": [ 0.601, 0.790, -0.028, 0.113 ] } }, { "index": 21, "nt1": "///P/16", "nt2": "///P/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.414, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.345, "chi2": -173.092, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.451, "C1C1_dist": 10.983, "N1N9_dist": 9.084, "C6C8_dist": 9.801, "CNNC_torsion": -7.369, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.14],N3-N1(imino)[2.99],N4(amino)-O6(carbonyl)[2.66]", "interBase_angle": 16.803, "planarity": 0.197, "simple_Shear": 0.187, "simple_Stretch": -0.128, "simple_Buckle": 12.775, "simple_Propeller": -10.916, "bp_simpleParams": [ 0.187, -0.128, -0.028, 12.775, -10.916, -8.707 ], "bp_params": [ 0.186, -0.130, -0.028, 12.677, -11.029, -8.695 ], "frame": { "rmsd": null, "origin": [ 15.012, -4.982, 7.184 ], "x_axis": [ 0.698, -0.005, 0.716 ], "y_axis": [ -0.683, -0.306, 0.663 ], "z_axis": [ 0.216, -0.952, -0.217 ], "quaternion": [ 0.542, 0.745, -0.231, 0.313 ] } }, { "index": 22, "nt1": "///P/17", "nt2": "///P/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.800, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.504, "chi2": -167.002, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.074, "C1C1_dist": 10.917, "N1N9_dist": 9.102, "C6C8_dist": 9.912, "CNNC_torsion": -0.573, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.22],N3-N1(imino)[3.20],N4(amino)-O6(carbonyl)[3.01]", "interBase_angle": 13.308, "planarity": 0.170, "simple_Shear": 0.865, "simple_Stretch": -0.064, "simple_Buckle": 9.602, "simple_Propeller": -9.215, "bp_simpleParams": [ 0.865, -0.064, -0.724, 9.602, -9.215, -3.015 ], "bp_params": [ 0.858, -0.132, -0.724, 8.850, -9.939, -3.017 ], "frame": { "rmsd": null, "origin": [ 17.572, -7.616, 6.199 ], "x_axis": [ 0.166, -0.054, 0.985 ], "y_axis": [ -0.919, -0.370, 0.135 ], "z_axis": [ 0.357, -0.927, -0.111 ], "quaternion": [ 0.414, 0.642, -0.379, 0.523 ] } }, { "index": 23, "nt1": "///P/17", "nt2": "///P/17", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": true, "chi1": -155.451, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 116.841, "chi2": -97.553, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 94.829, "C1C1_dist": 7.161, "N1N9_dist": 7.973, "C6C8_dist": 10.106, "CNNC_torsion": 11.376, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78]", "interBase_angle": 67.917, "planarity": 0.649, "simple_Shear": 0.583, "simple_Stretch": 4.795, "simple_Buckle": 60.849, "simple_Propeller": 30.169, "bp_simpleParams": [ 0.583, 4.795, -3.298, 60.849, 30.169, 113.655 ], "bp_params": [ 1.289, 4.655, -3.298, 65.295, 18.689, 105.007 ], "frame": { "rmsd": null, "origin": [ 21.718, -15.274, 11.932 ], "x_axis": [ -0.446, -0.054, 0.893 ], "y_axis": [ -0.885, 0.171, -0.432 ], "z_axis": [ -0.129, -0.984, -0.124 ], "quaternion": [ -0.388, -0.356, 0.660, -0.537 ] } }, { "index": 24, "nt1": "///P/24", "nt2": "///P/112", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -163.894, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 91.032, "chi2": -128.930, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.120, "C1C1_dist": 8.241, "N1N9_dist": 7.984, "C6C8_dist": 10.274, "CNNC_torsion": 162.875, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.57],N2(amino)-N3[3.02]", "interBase_angle": 18.748, "planarity": 0.221, "simple_Shear": 7.005, "simple_Stretch": 3.802, "simple_Buckle": 15.016, "simple_Propeller": -11.225, "bp_simpleParams": [ 7.005, 3.802, 0.198, 15.016, -11.225, -151.385 ], "bp_params": [ -2.570, -7.544, 0.198, -18.645, -1.957, -151.022 ], "frame": { "rmsd": null, "origin": [ 23.114, 11.634, 15.400 ], "x_axis": [ -0.662, 0.058, 0.748 ], "y_axis": [ 0.749, -0.000, 0.663 ], "z_axis": [ 0.038, 0.998, -0.043 ], "quaternion": [ -0.272, 0.309, 0.653, 0.636 ] } }, { "index": 25, "nt1": "///P/27", "nt2": "///P/52", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -131.787, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 149.425, "chi2": -162.139, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 16.597, "C1C1_dist": 8.617, "N1N9_dist": 8.433, "C6C8_dist": 8.832, "CNNC_torsion": 22.290, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N4(amino)[3.10],N3-N4(amino)[3.84]", "interBase_angle": 29.536, "planarity": 0.343, "simple_Shear": 0.366, "simple_Stretch": 7.098, "simple_Buckle": -8.114, "simple_Propeller": -28.400, "bp_simpleParams": [ 0.366, 7.098, 0.432, -8.114, -28.400, -18.454 ], "bp_params": [ 6.652, -2.502, 0.432, -24.682, 16.222, -18.222 ], "frame": { "rmsd": null, "origin": [ 19.037, 20.563, 9.522 ], "x_axis": [ 0.092, 0.128, 0.987 ], "y_axis": [ 0.712, 0.685, -0.155 ], "z_axis": [ -0.696, 0.717, -0.028 ], "quaternion": [ 0.661, -0.330, -0.636, -0.221 ] } }, { "index": 26, "nt1": "///P/28", "nt2": "///P/29", "bp": "A+C", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -76.648, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 141.169, "chi2": -168.053, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 39.428, "C1C1_dist": 6.773, "N1N9_dist": 6.784, "C6C8_dist": 6.809, "CNNC_torsion": 34.012, "hbonds_num": 1, "hbonds_desc": "N3-N4(amino)[2.93]", "interBase_angle": 34.981, "planarity": 0.412, "simple_Shear": -0.145, "simple_Stretch": 7.140, "simple_Buckle": 0.203, "simple_Propeller": 34.980, "bp_simpleParams": [ -0.145, 7.140, -2.043, 0.203, 34.980, 5.401 ], "bp_params": [ 7.122, 0.522, -2.043, 34.942, 1.649, 5.152 ], "frame": { "rmsd": null, "origin": [ 27.312, 35.040, 6.543 ], "x_axis": [ -0.903, -0.327, -0.280 ], "y_axis": [ -0.004, -0.644, 0.765 ], "z_axis": [ -0.430, 0.692, 0.580 ], "quaternion": [ -0.091, -0.201, 0.412, 0.884 ] } }, { "index": 27, "nt1": "///P/29", "nt2": "///P/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.053, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.830, "chi2": 174.868, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.417, "C1C1_dist": 10.742, "N1N9_dist": 9.066, "C6C8_dist": 10.020, "CNNC_torsion": -2.434, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[3.08],N4(amino)-O6(carbonyl)[3.10]", "interBase_angle": 10.237, "planarity": 0.112, "simple_Shear": 0.303, "simple_Stretch": 0.034, "simple_Buckle": -9.870, "simple_Propeller": 2.718, "bp_simpleParams": [ 0.303, 0.034, 0.431, -9.870, 2.718, 2.151 ], "bp_params": [ 0.304, 0.027, 0.431, -9.804, 2.946, 2.144 ], "frame": { "rmsd": null, "origin": [ 30.310, 37.010, 7.805 ], "x_axis": [ -0.925, -0.252, -0.285 ], "y_axis": [ 0.032, -0.797, 0.603 ], "z_axis": [ -0.379, 0.548, 0.745 ], "quaternion": [ -0.076, -0.178, 0.309, 0.931 ] } }, { "index": 28, "nt1": "///P/30", "nt2": "///P/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 175.175, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.188, "chi2": -170.344, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.133, "C1C1_dist": 10.622, "N1N9_dist": 8.838, "C6C8_dist": 9.693, "CNNC_torsion": -8.104, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.72],N1(imino)-N3[2.83],N2(amino)-O2(carbonyl)[2.67]", "interBase_angle": 8.212, "planarity": 0.112, "simple_Shear": -0.335, "simple_Stretch": -0.291, "simple_Buckle": 6.047, "simple_Propeller": -5.556, "bp_simpleParams": [ -0.335, -0.291, 0.344, 6.047, -5.556, -2.027 ], "bp_params": [ -0.327, -0.301, 0.344, 6.209, -5.375, -2.026 ], "frame": { "rmsd": null, "origin": [ 29.326, 39.780, 9.265 ], "x_axis": [ -0.853, -0.510, -0.111 ], "y_axis": [ 0.308, -0.663, 0.682 ], "z_axis": [ -0.421, 0.548, 0.723 ], "quaternion": [ -0.227, -0.148, 0.342, 0.900 ] } }, { "index": 29, "nt1": "///P/30", "nt2": "///P/123", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": 175.175, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 98.162, "chi2": -165.471, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.395, "C1C1_dist": 10.017, "N1N9_dist": 9.415, "C6C8_dist": 11.039, "CNNC_torsion": 119.028, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N1[2.90]", "interBase_angle": 64.494, "planarity": 0.874, "simple_Shear": 3.176, "simple_Stretch": 4.645, "simple_Buckle": -41.892, "simple_Propeller": -49.036, "bp_simpleParams": [ 3.176, 4.645, -0.507, -41.892, -49.036, -104.763 ], "bp_params": [ 2.422, -5.079, -0.507, -21.954, 60.642, -111.656 ], "frame": { "rmsd": null, "origin": [ 31.870, 41.207, 9.846 ], "x_axis": [ -0.475, -0.384, 0.792 ], "y_axis": [ 0.803, 0.179, 0.568 ], "z_axis": [ -0.360, 0.906, 0.223 ], "quaternion": [ -0.482, 0.175, 0.598, 0.616 ] } }, { "index": 30, "nt1": "///P/31", "nt2": "///P/43", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.170, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.910, "chi2": -171.717, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.802, "C1C1_dist": 10.765, "N1N9_dist": 8.931, "C6C8_dist": 9.753, "CNNC_torsion": -7.384, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.73],N1-N3(imino)[2.91]", "interBase_angle": 12.027, "planarity": 0.151, "simple_Shear": -0.109, "simple_Stretch": -0.165, "simple_Buckle": 0.041, "simple_Propeller": -12.026, "bp_simpleParams": [ -0.109, -0.165, -0.295, 0.041, -12.026, -4.311 ], "bp_params": [ -0.108, -0.166, -0.295, 0.134, -12.026, -4.335 ], "frame": { "rmsd": null, "origin": [ 27.038, 42.929, 10.135 ], "x_axis": [ -0.451, -0.844, 0.290 ], "y_axis": [ 0.752, -0.184, 0.633 ], "z_axis": [ -0.481, 0.504, 0.718 ], "quaternion": [ 0.520, 0.062, -0.370, -0.767 ] } }, { "index": 31, "nt1": "///P/35", "nt2": "///P/65", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -178.196, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.715, "chi2": -170.908, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.084, "C1C1_dist": 11.142, "N1N9_dist": 9.224, "C6C8_dist": 9.927, "CNNC_torsion": -8.374, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.83],N1(imino)-N3[3.15],N2(amino)-O2(carbonyl)[3.38]", "interBase_angle": 12.119, "planarity": 0.141, "simple_Shear": -0.553, "simple_Stretch": -0.047, "simple_Buckle": -3.663, "simple_Propeller": -11.552, "bp_simpleParams": [ -0.553, -0.047, -0.075, -3.663, -11.552, -8.780 ], "bp_params": [ -0.550, -0.075, -0.075, -3.066, -11.725, -8.823 ], "frame": { "rmsd": null, "origin": [ 9.753, 59.611, 12.029 ], "x_axis": [ 0.692, 0.053, -0.720 ], "y_axis": [ 0.694, -0.324, 0.643 ], "z_axis": [ -0.200, -0.945, -0.261 ], "quaternion": [ 0.526, 0.754, 0.247, -0.305 ] } }, { "index": 32, "nt1": "///P/36", "nt2": "///P/64", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.692, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.447, "chi2": -166.642, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.483, "C1C1_dist": 10.533, "N1N9_dist": 8.860, "C6C8_dist": 9.825, "CNNC_torsion": -13.502, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.11],N1(imino)-N3[2.96],N2(amino)-O2(carbonyl)[2.68]", "interBase_angle": 14.659, "planarity": 0.203, "simple_Shear": -0.649, "simple_Stretch": -0.158, "simple_Buckle": -5.779, "simple_Propeller": -13.472, "bp_simpleParams": [ -0.649, -0.158, 0.397, -5.779, -13.472, 2.166 ], "bp_params": [ -0.639, -0.196, 0.397, -4.971, -13.791, 2.180 ], "frame": { "rmsd": null, "origin": [ 8.519, 57.184, 9.783 ], "x_axis": [ 0.975, -0.044, -0.217 ], "y_axis": [ 0.198, -0.259, 0.945 ], "z_axis": [ -0.097, -0.965, -0.244 ], "quaternion": [ 0.607, 0.787, 0.049, -0.100 ] } }, { "index": 33, "nt1": "///P/37", "nt2": "///P/63", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.166, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.388, "chi2": -160.197, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 63.940, "C1C1_dist": 10.814, "N1N9_dist": 9.099, "C6C8_dist": 9.925, "CNNC_torsion": -15.445, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.14],N1(imino)-O2(carbonyl)[3.15]", "interBase_angle": 17.112, "planarity": 0.221, "simple_Shear": -1.896, "simple_Stretch": 0.117, "simple_Buckle": -1.569, "simple_Propeller": -17.040, "bp_simpleParams": [ -1.896, 0.117, 0.216, -1.569, -17.040, -4.138 ], "bp_params": [ -1.884, -0.238, 0.216, 1.643, -17.033, -4.183 ], "frame": { "rmsd": null, "origin": [ 8.086, 54.961, 7.444 ], "x_axis": [ 0.947, -0.043, 0.317 ], "y_axis": [ -0.319, -0.220, 0.922 ], "z_axis": [ 0.030, -0.975, -0.222 ], "quaternion": [ 0.614, 0.773, -0.117, 0.112 ] } }, { "index": 34, "nt1": "///P/38", "nt2": "///P/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.144, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.671, "chi2": -158.736, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.635, "C1C1_dist": 10.603, "N1N9_dist": 8.906, "C6C8_dist": 9.862, "CNNC_torsion": -19.448, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.06],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.62]", "interBase_angle": 21.131, "planarity": 0.281, "simple_Shear": 0.282, "simple_Stretch": -0.129, "simple_Buckle": -7.544, "simple_Propeller": -19.738, "bp_simpleParams": [ 0.282, -0.129, 0.432, -7.544, -19.738, 1.756 ], "bp_params": [ 0.277, -0.140, 0.432, -8.261, -19.449, 1.777 ], "frame": { "rmsd": null, "origin": [ 9.407, 51.772, 6.156 ], "x_axis": [ 0.511, -0.006, 0.859 ], "y_axis": [ -0.849, -0.161, 0.504 ], "z_axis": [ 0.135, -0.987, -0.087 ], "quaternion": [ 0.562, 0.663, -0.322, 0.375 ] } }, { "index": 35, "nt1": "///P/39", "nt2": "///P/61", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.153, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.773, "chi2": -153.136, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.913, "C1C1_dist": 10.335, "N1N9_dist": 8.768, "C6C8_dist": 9.847, "CNNC_torsion": -19.819, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.93],O4(carbonyl)-N6(amino)[3.33]", "interBase_angle": 25.335, "planarity": 0.309, "simple_Shear": 0.217, "simple_Stretch": 0.003, "simple_Buckle": -12.333, "simple_Propeller": -22.131, "bp_simpleParams": [ 0.217, 0.003, 0.201, -12.333, -22.131, 6.923 ], "bp_params": [ 0.217, -0.002, 0.201, -12.858, -21.830, 7.008 ], "frame": { "rmsd": null, "origin": [ 11.055, 48.719, 6.064 ], "x_axis": [ -0.065, 0.075, 0.995 ], "y_axis": [ -0.975, -0.216, -0.047 ], "z_axis": [ 0.212, -0.973, 0.087 ], "quaternion": [ 0.449, 0.516, -0.436, 0.585 ] } }, { "index": 36, "nt1": "///P/40", "nt2": "///P/60", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -146.806, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 67.738, "chi2": -176.775, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 43.271, "C1C1_dist": 10.843, "N1N9_dist": 9.226, "C6C8_dist": 10.217, "CNNC_torsion": -10.929, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.12],N3(imino)-O6(carbonyl)[3.43]", "interBase_angle": 10.757, "planarity": 0.143, "simple_Shear": 2.342, "simple_Stretch": 0.504, "simple_Buckle": 4.561, "simple_Propeller": -9.742, "bp_simpleParams": [ 2.342, 0.504, 0.215, 4.561, -9.742, 4.037 ], "bp_params": [ 2.395, -0.045, 0.215, 2.205, -10.529, 4.053 ], "frame": { "rmsd": null, "origin": [ 12.090, 46.109, 6.750 ], "x_axis": [ -0.724, -0.025, 0.689 ], "y_axis": [ -0.661, -0.259, -0.704 ], "z_axis": [ 0.196, -0.966, 0.171 ], "quaternion": [ 0.217, 0.302, -0.569, 0.734 ] } }, { "index": 37, "nt1": "///P/45", "nt2": "///P/98", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": 174.868, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 101.428, "chi2": -151.010, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.165, "C1C1_dist": 10.321, "N1N9_dist": 9.836, "C6C8_dist": 11.582, "CNNC_torsion": 115.525, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N1[3.23]", "interBase_angle": 65.822, "planarity": 0.868, "simple_Shear": 3.370, "simple_Stretch": 4.942, "simple_Buckle": -33.650, "simple_Propeller": -56.570, "bp_simpleParams": [ 3.370, 4.942, 0.111, -33.650, -56.570, -112.075 ], "bp_params": [ 2.442, -5.460, 0.111, -32.087, 57.471, -116.614 ], "frame": { "rmsd": null, "origin": [ 33.343, 37.830, 8.184 ], "x_axis": [ -0.304, 0.124, -0.945 ], "y_axis": [ 0.900, 0.362, -0.242 ], "z_axis": [ 0.312, -0.924, -0.222 ], "quaternion": [ 0.457, 0.373, 0.687, -0.424 ] } }, { "index": 38, "nt1": "///P/46", "nt2": "///P/51", "bp": "A+U", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -163.126, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 32.697, "chi2": -139.541, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 39.829, "C1C1_dist": 11.097, "N1N9_dist": 8.893, "C6C8_dist": 9.819, "CNNC_torsion": -162.816, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.98],N1-N3(imino)[2.93]", "interBase_angle": 18.102, "planarity": 0.224, "simple_Shear": 1.257, "simple_Stretch": 0.137, "simple_Buckle": 15.858, "simple_Propeller": 8.728, "bp_simpleParams": [ 1.257, 0.137, 0.298, 15.858, 8.728, 168.468 ], "bp_params": [ 0.026, 1.264, 0.298, -6.583, 16.862, 168.573 ], "frame": { "rmsd": null, "origin": [ 31.537, 33.056, 7.236 ], "x_axis": [ -0.589, -0.784, 0.196 ], "y_axis": [ -0.690, 0.362, -0.627 ], "z_axis": [ 0.420, -0.504, -0.754 ], "quaternion": [ 0.068, -0.448, 0.822, -0.344 ] } }, { "index": 39, "nt1": "///P/56", "nt2": "///F/-1", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "c.H", "DSSR": "c.+M", "intra_chain": false, "chi1": -162.607, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 98.461, "chi2": 57.708, "conf2": "syn", "pucker2": "~C2'-endo", "lambda2": 22.466, "C1C1_dist": 12.246, "N1N9_dist": 11.161, "C6C8_dist": 11.300, "CNNC_torsion": -29.472, "hbonds_num": 1, "hbonds_desc": "N2(amino)*N6(amino)[3.28]", "interBase_angle": 30.398, "planarity": 0.410, "simple_Shear": -0.325, "simple_Stretch": 6.709, "simple_Buckle": 18.235, "simple_Propeller": -24.322, "bp_simpleParams": [ -0.325, 6.709, 0.562, 18.235, -24.322, -55.967 ], "bp_params": [ 6.647, 0.963, 0.562, -22.538, -20.398, -55.815 ], "frame": { "rmsd": null, "origin": [ 17.535, 34.773, 15.755 ], "x_axis": [ -0.180, -0.245, -0.953 ], "y_axis": [ -0.962, -0.157, 0.222 ], "z_axis": [ -0.204, 0.957, -0.208 ], "quaternion": [ 0.337, -0.544, 0.555, 0.531 ] } }, { "index": 40, "nt1": "///P/66", "nt2": "///P/84", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.017, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.639, "chi2": -129.679, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.579, "C1C1_dist": 10.897, "N1N9_dist": 9.213, "C6C8_dist": 10.184, "CNNC_torsion": -12.678, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.92],N3-N1(imino)[3.16],N4(amino)-O6(carbonyl)[3.29]", "interBase_angle": 13.313, "planarity": 0.180, "simple_Shear": -0.325, "simple_Stretch": 0.189, "simple_Buckle": -9.283, "simple_Propeller": -9.543, "bp_simpleParams": [ -0.325, 0.189, 0.518, -9.283, -9.543, 1.611 ], "bp_params": [ -0.331, 0.178, 0.518, -8.953, -9.853, 1.612 ], "frame": { "rmsd": null, "origin": [ 12.220, 62.625, 12.381 ], "x_axis": [ 0.165, -0.009, -0.986 ], "y_axis": [ -0.943, 0.290, -0.161 ], "z_axis": [ 0.287, 0.957, 0.039 ], "quaternion": [ 0.611, -0.457, 0.521, 0.382 ] } }, { "index": 41, "nt1": "///P/67", "nt2": "///P/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.455, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.944, "chi2": -179.979, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.700, "C1C1_dist": 10.642, "N1N9_dist": 9.068, "C6C8_dist": 10.133, "CNNC_torsion": -12.568, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.48],N1(imino)-N3[3.17],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 10.265, "planarity": 0.165, "simple_Shear": -0.556, "simple_Stretch": 0.138, "simple_Buckle": 4.344, "simple_Propeller": -9.301, "bp_simpleParams": [ -0.556, 0.138, 0.663, 4.344, -9.301, 6.462 ], "bp_params": [ -0.563, 0.109, 0.663, 4.819, -9.064, 6.477 ], "frame": { "rmsd": null, "origin": [ 14.124, 65.021, 11.488 ], "x_axis": [ -0.430, 0.032, -0.902 ], "y_axis": [ -0.874, 0.235, 0.425 ], "z_axis": [ 0.226, 0.971, -0.073 ], "quaternion": [ 0.428, -0.319, 0.659, 0.530 ] } }, { "index": 42, "nt1": "///P/68", "nt2": "///P/82", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.254, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.829, "chi2": -179.338, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.410, "C1C1_dist": 11.000, "N1N9_dist": 9.335, "C6C8_dist": 10.389, "CNNC_torsion": -14.199, "hbonds_num": 3, "hbonds_desc": "N1(imino)-N3[3.32],N2(amino)-O2(carbonyl)[2.89],N2(amino)-N3[3.08]", "interBase_angle": 14.020, "planarity": 0.188, "simple_Shear": 0.752, "simple_Stretch": 0.402, "simple_Buckle": 0.702, "simple_Propeller": -14.003, "bp_simpleParams": [ 0.752, 0.402, 0.401, 0.702, -14.003, 6.390 ], "bp_params": [ 0.782, 0.339, 0.401, -0.438, -14.013, 6.438 ], "frame": { "rmsd": null, "origin": [ 16.037, 67.827, 9.429 ], "x_axis": [ -0.841, 0.199, -0.503 ], "y_axis": [ -0.450, 0.259, 0.855 ], "z_axis": [ 0.301, 0.945, -0.128 ], "quaternion": [ 0.269, -0.084, 0.746, 0.603 ] } }, { "index": 43, "nt1": "///P/68", "nt2": "///P/87", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -174.254, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 91.995, "chi2": -124.324, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.541, "C1C1_dist": 8.323, "N1N9_dist": 8.056, "C6C8_dist": 10.278, "CNNC_torsion": 154.579, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.76],N2(amino)-N3[3.65]", "interBase_angle": 35.883, "planarity": 0.403, "simple_Shear": 7.110, "simple_Stretch": 4.068, "simple_Buckle": 28.631, "simple_Propeller": -21.631, "bp_simpleParams": [ 7.110, 4.068, 1.227, 28.631, -21.631, -148.048 ], "bp_params": [ -2.675, -7.742, 1.227, -35.780, -2.724, -146.522 ], "frame": { "rmsd": null, "origin": [ 17.684, 68.143, 12.983 ], "x_axis": [ -0.632, 0.299, 0.715 ], "y_axis": [ 0.758, 0.049, 0.650 ], "z_axis": [ 0.159, 0.953, -0.258 ], "quaternion": [ -0.200, 0.380, 0.696, 0.576 ] } }, { "index": 44, "nt1": "///P/69", "nt2": "///P/81", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.011, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.507, "chi2": -166.286, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.156, "C1C1_dist": 11.740, "N1N9_dist": 9.663, "C6C8_dist": 10.200, "CNNC_torsion": -11.463, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.41],O4(carbonyl)-N6(amino)[2.80]", "interBase_angle": 16.080, "planarity": 0.202, "simple_Shear": -0.483, "simple_Stretch": 0.394, "simple_Buckle": -8.632, "simple_Propeller": -13.566, "bp_simpleParams": [ -0.483, 0.394, -0.062, -8.632, -13.566, -17.282 ], "bp_params": [ -0.501, 0.371, -0.062, -7.970, -13.965, -17.369 ], "frame": { "rmsd": null, "origin": [ 19.192, 70.041, 6.759 ], "x_axis": [ -0.983, 0.177, -0.055 ], "y_axis": [ -0.023, 0.178, 0.984 ], "z_axis": [ 0.184, 0.968, -0.170 ], "quaternion": [ 0.078, 0.050, 0.763, 0.639 ] } }, { "index": 45, "nt1": "///P/70", "nt2": "///P/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.222, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.243, "chi2": -166.990, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.632, "C1C1_dist": 11.122, "N1N9_dist": 9.374, "C6C8_dist": 10.312, "CNNC_torsion": -10.001, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.40],O4(carbonyl)-N6(amino)[3.54]", "interBase_angle": 9.071, "planarity": 0.129, "simple_Shear": 0.495, "simple_Stretch": 0.377, "simple_Buckle": -0.244, "simple_Propeller": -9.068, "bp_simpleParams": [ 0.495, 0.377, 0.320, -0.244, -9.068, 0.584 ], "bp_params": [ 0.512, 0.355, 0.320, -0.652, -9.048, 0.585 ], "frame": { "rmsd": null, "origin": [ 18.778, 73.117, 5.160 ], "x_axis": [ -0.845, 0.108, 0.524 ], "y_axis": [ 0.526, -0.013, 0.851 ], "z_axis": [ 0.099, 0.994, -0.045 ], "quaternion": [ -0.155, 0.231, 0.685, 0.673 ] } }, { "index": 46, "nt1": "///P/70", "nt2": "///P/135", "bp": "U+G", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -164.222, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 100.381, "chi2": -157.790, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.710, "C1C1_dist": 9.951, "N1N9_dist": 9.460, "C6C8_dist": 11.250, "CNNC_torsion": 156.606, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O6(carbonyl)[3.38],O2(carbonyl)-N2(amino)[3.20]", "interBase_angle": 33.570, "planarity": 0.454, "simple_Shear": 5.580, "simple_Stretch": 4.956, "simple_Buckle": 31.113, "simple_Propeller": -12.608, "bp_simpleParams": [ 5.580, 4.956, 0.082, 31.113, -12.608, -116.809 ], "bp_params": [ 0.134, -7.462, 0.082, -29.701, -15.646, -115.528 ], "frame": { "rmsd": null, "origin": [ 22.390, 73.601, 5.392 ], "x_axis": [ -0.001, -0.054, 0.999 ], "y_axis": [ 0.996, 0.090, 0.006 ], "z_axis": [ -0.090, 0.994, 0.053 ], "quaternion": [ 0.534, -0.462, -0.509, -0.491 ] } }, { "index": 47, "nt1": "///P/71", "nt2": "///P/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.411, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.513, "chi2": -162.093, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.441, "C1C1_dist": 10.686, "N1N9_dist": 9.117, "C6C8_dist": 10.229, "CNNC_torsion": -17.147, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.57],N1(imino)-N3[3.14],N2(amino)-O2(carbonyl)[2.73],N2(amino)-N3[3.14]", "interBase_angle": 21.780, "planarity": 0.266, "simple_Shear": 0.378, "simple_Stretch": 0.256, "simple_Buckle": -4.421, "simple_Propeller": -21.327, "bp_simpleParams": [ 0.378, 0.256, 0.108, -4.421, -21.327, 8.875 ], "bp_params": [ 0.389, 0.237, 0.108, -5.385, -21.104, 9.017 ], "frame": { "rmsd": null, "origin": [ 17.095, 76.099, 4.617 ], "x_axis": [ -0.413, -0.237, 0.880 ], "y_axis": [ 0.892, 0.089, 0.443 ], "z_axis": [ -0.183, 0.967, 0.175 ], "quaternion": [ -0.461, 0.284, 0.576, 0.612 ] } }, { "index": 48, "nt1": "///P/73", "nt2": "///P/141", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 147.013, "conf1": "--", "pucker1": "----", "lambda1": 56.383, "chi2": -155.073, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.216, "C1C1_dist": 10.637, "N1N9_dist": 8.854, "C6C8_dist": 9.709, "CNNC_torsion": -6.207, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.14],O4(carbonyl)-N6(amino)[3.15]", "interBase_angle": 27.542, "planarity": 0.306, "simple_Shear": 0.844, "simple_Stretch": 0.038, "simple_Buckle": -27.468, "simple_Propeller": 2.020, "bp_simpleParams": [ 0.844, 0.038, 1.011, -27.468, 2.020, -1.023 ], "bp_params": [ 0.844, -0.029, 1.011, -27.229, 4.145, -0.995 ], "frame": { "rmsd": null, "origin": [ 20.001, 89.756, 11.841 ], "x_axis": [ 0.096, 0.134, -0.986 ], "y_axis": [ 0.793, -0.609, -0.006 ], "z_axis": [ -0.601, -0.782, -0.165 ], "quaternion": [ 0.284, 0.684, 0.339, -0.581 ] } }, { "index": 49, "nt1": "///P/74", "nt2": "///P/140", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.636, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.872, "chi2": -167.489, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.864, "C1C1_dist": 10.496, "N1N9_dist": 9.087, "C6C8_dist": 10.283, "CNNC_torsion": -16.900, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.71],N3-N1(imino)[3.34],N3-N2(amino)[2.84]", "interBase_angle": 24.319, "planarity": 0.354, "simple_Shear": -0.867, "simple_Stretch": 0.438, "simple_Buckle": 15.142, "simple_Propeller": -19.030, "bp_simpleParams": [ -0.867, 0.438, 0.645, 15.142, -19.030, 11.901 ], "bp_params": [ -0.908, 0.345, 0.645, 17.016, -17.375, 11.910 ], "frame": { "rmsd": null, "origin": [ 17.671, 89.128, 10.201 ], "x_axis": [ 0.348, -0.219, -0.912 ], "y_axis": [ 0.664, -0.629, 0.405 ], "z_axis": [ -0.662, -0.746, -0.074 ], "quaternion": [ 0.402, 0.716, 0.155, -0.549 ] } }, { "index": 50, "nt1": "///P/75", "nt2": "///P/139", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 177.737, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 41.527, "chi2": -163.184, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.411, "C1C1_dist": 11.402, "N1N9_dist": 9.456, "C6C8_dist": 10.134, "CNNC_torsion": -12.726, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.36]", "interBase_angle": 17.920, "planarity": 0.221, "simple_Shear": -1.274, "simple_Stretch": 0.327, "simple_Buckle": 3.910, "simple_Propeller": -17.488, "bp_simpleParams": [ -1.274, 0.327, -0.110, 3.910, -17.488, -10.389 ], "bp_params": [ -1.306, 0.159, -0.110, 6.116, -16.844, -10.487 ], "frame": { "rmsd": null, "origin": [ 14.377, 87.445, 9.401 ], "x_axis": [ 0.852, -0.207, -0.482 ], "y_axis": [ 0.341, -0.479, 0.809 ], "z_axis": [ -0.398, -0.853, -0.337 ], "quaternion": [ 0.509, 0.817, 0.041, -0.269 ] } }, { "index": 51, "nt1": "///P/76", "nt2": "///P/138", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.022, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 68.189, "chi2": -154.386, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.763, "C1C1_dist": 10.372, "N1N9_dist": 8.995, "C6C8_dist": 10.242, "CNNC_torsion": -15.755, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)*N1[3.16],N3(imino)-N1[3.40]", "unusual_base2base_hbonds": 1, "interBase_angle": 17.557, "planarity": 0.231, "simple_Shear": 1.098, "simple_Stretch": 0.444, "simple_Buckle": -10.020, "simple_Propeller": -14.417, "bp_simpleParams": [ 1.098, 0.444, 0.919, -10.020, -14.417, 13.856 ], "bp_params": [ 1.141, 0.319, 0.919, -11.550, -13.223, 13.878 ], "frame": { "rmsd": null, "origin": [ 13.777, 84.294, 7.035 ], "x_axis": [ 0.925, -0.180, 0.335 ], "y_axis": [ -0.369, -0.205, 0.907 ], "z_axis": [ -0.094, -0.962, -0.256 ], "quaternion": [ 0.605, 0.772, -0.178, 0.078 ] } }, { "index": 52, "nt1": "///P/77", "nt2": "///P/137", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -152.730, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.059, "chi2": -171.472, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.568, "C1C1_dist": 11.389, "N1N9_dist": 9.611, "C6C8_dist": 10.508, "CNNC_torsion": -17.817, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.54],N3-N1(imino)[3.63],N4(amino)-O6(carbonyl)[3.74]", "interBase_angle": 20.726, "planarity": 0.255, "simple_Shear": 0.844, "simple_Stretch": 0.529, "simple_Buckle": 7.074, "simple_Propeller": -19.482, "bp_simpleParams": [ 0.844, 0.529, 0.187, 7.074, -19.482, -0.066 ], "bp_params": [ 0.881, 0.464, 0.187, 5.535, -19.974, -0.066 ], "frame": { "rmsd": null, "origin": [ 14.061, 82.170, 4.687 ], "x_axis": [ 0.585, -0.217, 0.782 ], "y_axis": [ -0.811, -0.177, 0.557 ], "z_axis": [ 0.017, -0.960, -0.280 ], "quaternion": [ 0.531, 0.714, -0.360, 0.280 ] } }, { "index": 53, "nt1": "///P/78", "nt2": "///P/136", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.250, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.661, "chi2": -156.184, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.657, "C1C1_dist": 11.464, "N1N9_dist": 9.481, "C6C8_dist": 10.097, "CNNC_torsion": -4.283, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.77],N1-N3(imino)[3.29]", "interBase_angle": 14.389, "planarity": 0.208, "simple_Shear": 1.020, "simple_Stretch": 0.286, "simple_Buckle": 9.173, "simple_Propeller": -11.086, "bp_simpleParams": [ 1.020, 0.286, -0.429, 9.173, -11.086, -13.517 ], "bp_params": [ 1.043, 0.181, -0.429, 7.992, -11.965, -13.558 ], "frame": { "rmsd": null, "origin": [ 15.188, 79.356, 2.892 ], "x_axis": [ 0.138, -0.097, 0.986 ], "y_axis": [ -0.980, -0.160, 0.122 ], "z_axis": [ 0.146, -0.982, -0.117 ], "quaternion": [ 0.464, 0.595, -0.452, 0.476 ] } }, { "index": 54, "nt1": "///P/89", "nt2": "///P/133", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.961, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.436, "chi2": 171.642, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.089, "C1C1_dist": 11.046, "N1N9_dist": 9.232, "C6C8_dist": 10.092, "CNNC_torsion": -20.827, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.25],N3-N1(imino)[3.39],N4(amino)-O6(carbonyl)[3.51]", "interBase_angle": 23.943, "planarity": 0.353, "simple_Shear": 0.950, "simple_Stretch": 0.166, "simple_Buckle": 16.249, "simple_Propeller": -17.585, "bp_simpleParams": [ 0.950, 0.166, 0.666, 16.249, -17.585, -2.324 ], "bp_params": [ 0.960, 0.090, 0.666, 14.778, -18.838, -2.336 ], "frame": { "rmsd": null, "origin": [ 33.151, 71.196, 2.407 ], "x_axis": [ -0.063, -0.057, 0.996 ], "y_axis": [ -0.898, -0.432, -0.082 ], "z_axis": [ 0.436, -0.900, -0.024 ], "quaternion": [ 0.347, 0.590, -0.405, 0.606 ] } }, { "index": 55, "nt1": "///P/90", "nt2": "///P/132", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -150.462, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.517, "chi2": -159.316, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.524, "C1C1_dist": 11.037, "N1N9_dist": 9.118, "C6C8_dist": 9.826, "CNNC_torsion": -9.367, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.27],O4(carbonyl)-N6(amino)[2.90]", "interBase_angle": 28.051, "planarity": 0.338, "simple_Shear": 0.809, "simple_Stretch": -0.088, "simple_Buckle": 11.694, "simple_Propeller": -25.497, "bp_simpleParams": [ 0.809, -0.088, -1.090, 11.694, -25.497, -6.233 ], "bp_params": [ 0.801, -0.144, -1.090, 9.779, -26.291, -6.378 ], "frame": { "rmsd": null, "origin": [ 36.974, 69.084, 2.364 ], "x_axis": [ -0.484, -0.273, 0.832 ], "y_axis": [ -0.654, -0.519, -0.551 ], "z_axis": [ 0.582, -0.810, 0.072 ], "quaternion": [ 0.132, 0.491, -0.472, 0.720 ] } }, { "index": 56, "nt1": "///P/92", "nt2": "///P/130", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.178, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.680, "chi2": 174.264, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 35.650, "C1C1_dist": 12.029, "N1N9_dist": 9.880, "C6C8_dist": 10.235, "CNNC_torsion": 0.462, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N6(amino)[3.45]", "interBase_angle": 25.018, "planarity": 0.375, "simple_Shear": 1.539, "simple_Stretch": 0.464, "simple_Buckle": 10.163, "simple_Propeller": -22.860, "bp_simpleParams": [ 1.539, 0.464, -1.868, 10.163, -22.860, -19.294 ], "bp_params": [ 1.591, 0.228, -1.868, 6.527, -24.151, -19.692 ], "frame": { "rmsd": null, "origin": [ 40.286, 64.275, 7.681 ], "x_axis": [ -0.945, -0.295, -0.142 ], "y_axis": [ 0.247, -0.357, -0.901 ], "z_axis": [ 0.215, -0.886, 0.410 ], "quaternion": [ -0.165, 0.022, -0.543, 0.823 ] } }, { "index": 57, "nt1": "///P/93", "nt2": "///P/129", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 171.245, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 71.133, "chi2": -161.592, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.464, "C1C1_dist": 10.315, "N1N9_dist": 8.804, "C6C8_dist": 9.742, "CNNC_torsion": -9.104, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.01],N3(imino)-O6(carbonyl)[3.32]", "interBase_angle": 31.400, "planarity": 0.357, "simple_Shear": 2.167, "simple_Stretch": 0.213, "simple_Buckle": -31.102, "simple_Propeller": -4.315, "bp_simpleParams": [ 2.167, 0.213, 1.709, -31.102, -4.315, 5.373 ], "bp_params": [ 2.162, -0.261, 1.709, -31.291, 2.618, 5.175 ], "frame": { "rmsd": null, "origin": [ 39.266, 60.192, 10.183 ], "x_axis": [ -0.689, -0.157, -0.708 ], "y_axis": [ 0.699, 0.114, -0.706 ], "z_axis": [ 0.191, -0.981, 0.031 ], "quaternion": [ 0.338, 0.204, 0.665, -0.634 ] } }, { "index": 58, "nt1": "///P/94", "nt2": "///P/128", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.259, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.369, "chi2": -167.694, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.114, "C1C1_dist": 10.740, "N1N9_dist": 8.899, "C6C8_dist": 9.697, "CNNC_torsion": -19.964, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.86],N1-N3(imino)[2.94]", "interBase_angle": 23.298, "planarity": 0.287, "simple_Shear": -0.481, "simple_Stretch": -0.179, "simple_Buckle": 10.881, "simple_Propeller": -20.601, "bp_simpleParams": [ -0.481, -0.179, 0.425, 10.881, -20.601, -6.878 ], "bp_params": [ -0.470, -0.205, 0.425, 11.924, -20.015, -6.948 ], "frame": { "rmsd": null, "origin": [ 38.409, 58.547, 11.765 ], "x_axis": [ -0.354, -0.110, -0.929 ], "y_axis": [ 0.935, -0.076, -0.348 ], "z_axis": [ -0.033, -0.991, 0.129 ], "quaternion": [ -0.418, -0.385, -0.536, 0.625 ] } }, { "index": 59, "nt1": "///P/95", "nt2": "///P/127", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.714, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.305, "chi2": -176.048, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.263, "C1C1_dist": 10.605, "N1N9_dist": 8.894, "C6C8_dist": 9.812, "CNNC_torsion": -15.932, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.90],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 23.546, "planarity": 0.271, "simple_Shear": 0.544, "simple_Stretch": -0.166, "simple_Buckle": 10.004, "simple_Propeller": -21.315, "bp_simpleParams": [ 0.544, -0.166, -0.151, 10.004, -21.315, 0.652 ], "bp_params": [ 0.537, -0.189, -0.151, 9.005, -21.756, 0.662 ], "frame": { "rmsd": null, "origin": [ 36.858, 55.274, 11.429 ], "x_axis": [ 0.325, -0.123, -0.938 ], "y_axis": [ 0.940, -0.064, 0.334 ], "z_axis": [ -0.102, -0.990, 0.095 ], "quaternion": [ 0.582, 0.569, 0.359, -0.457 ] } }, { "index": 60, "nt1": "///P/96", "nt2": "///P/126", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.813, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 75.863, "chi2": -161.076, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 40.681, "C1C1_dist": 10.328, "N1N9_dist": 8.866, "C6C8_dist": 9.880, "CNNC_torsion": -9.165, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.75],N3(imino)-O6(carbonyl)[3.11]", "interBase_angle": 13.879, "planarity": 0.191, "simple_Shear": 3.330, "simple_Stretch": 0.498, "simple_Buckle": -3.431, "simple_Propeller": -13.448, "bp_simpleParams": [ 3.330, 0.498, 0.149, -3.431, -13.448, 7.217 ], "bp_params": [ 3.306, -0.640, 0.149, -7.705, -11.544, 7.237 ], "frame": { "rmsd": null, "origin": [ 35.853, 51.538, 10.791 ], "x_axis": [ 0.866, 0.037, -0.499 ], "y_axis": [ 0.500, -0.056, 0.864 ], "z_axis": [ 0.005, -0.998, -0.067 ], "quaternion": [ 0.660, 0.705, 0.191, -0.175 ] } }, { "index": 61, "nt1": "///P/99", "nt2": "///P/122", "bp": "A-C", "name": "~rHoogsteen", "Saenger": "25-XXV", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -144.965, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 8.588, "chi2": -155.400, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 23.895, "C1C1_dist": 11.137, "N1N9_dist": 8.359, "C6C8_dist": 7.247, "CNNC_torsion": 173.908, "hbonds_num": 3, "hbonds_desc": "N7-N4(amino)[2.96],N6(amino)-O2(carbonyl)[3.30],N6(amino)-N3[2.97]", "interBase_angle": 16.146, "planarity": 0.175, "simple_Shear": -2.919, "simple_Stretch": 1.054, "simple_Buckle": -5.813, "simple_Propeller": -15.063, "bp_simpleParams": [ -2.919, 1.054, -0.836, -5.813, -15.063, -92.730 ], "bp_params": [ -3.085, -0.339, -0.836, 1.443, -16.081, -93.291 ], "frame": { "rmsd": null, "origin": [ 38.673, 36.272, 9.969 ], "x_axis": [ 0.774, 0.367, 0.516 ], "y_axis": [ -0.509, -0.126, 0.852 ], "z_axis": [ 0.377, -0.922, 0.089 ], "quaternion": [ 0.659, 0.673, -0.053, 0.332 ] } }, { "index": 62, "nt1": "///P/100", "nt2": "///P/121", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -157.849, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 18.492, "chi2": -171.933, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 23.998, "C1C1_dist": 12.344, "N1N9_dist": 9.653, "C6C8_dist": 8.274, "CNNC_torsion": 131.713, "hbonds_num": 2, "hbonds_desc": "N7-N6(amino)[3.14],N6(amino)-N1[2.88]", "interBase_angle": 25.019, "planarity": 0.321, "simple_Shear": -2.895, "simple_Stretch": 3.105, "simple_Buckle": 9.567, "simple_Propeller": -23.118, "bp_simpleParams": [ -2.895, 3.105, -0.771, 9.567, -23.118, -104.200 ], "bp_params": [ -4.059, 1.245, -0.771, 19.772, -15.330, -103.864 ], "frame": { "rmsd": null, "origin": [ 40.316, 33.707, 9.205 ], "x_axis": [ 0.455, 0.207, 0.866 ], "y_axis": [ -0.821, -0.280, 0.498 ], "z_axis": [ 0.345, -0.938, 0.042 ], "quaternion": [ 0.552, 0.650, -0.236, 0.466 ] } }, { "index": 63, "nt1": "///P/101", "nt2": "///P/120", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -175.036, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 8.078, "chi2": -156.886, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.801, "C1C1_dist": 13.019, "N1N9_dist": 10.667, "C6C8_dist": 10.170, "CNNC_torsion": 124.393, "hbonds_num": 2, "hbonds_desc": "O4(carbonyl)-N1(imino)[3.14],O4(carbonyl)-N2(amino)[2.60]", "interBase_angle": 19.971, "planarity": 0.243, "simple_Shear": -4.585, "simple_Stretch": 3.200, "simple_Buckle": 12.341, "simple_Propeller": -15.702, "bp_simpleParams": [ -4.585, 3.200, -0.099, 12.341, -15.702, -65.152 ], "bp_params": [ -5.590, 0.135, -0.099, 18.953, -6.295, -64.519 ], "frame": { "rmsd": null, "origin": [ 43.884, 31.547, 10.435 ], "x_axis": [ 0.022, 0.105, 0.994 ], "y_axis": [ -0.961, -0.270, 0.050 ], "z_axis": [ 0.274, -0.957, 0.095 ], "quaternion": [ 0.460, 0.547, -0.391, 0.579 ] } }, { "index": 64, "nt1": "///P/102", "nt2": "///P/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.686, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.520, "chi2": -158.094, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.935, "C1C1_dist": 10.906, "N1N9_dist": 9.094, "C6C8_dist": 9.918, "CNNC_torsion": -15.530, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.07],N3-N1(imino)[3.04],N4(amino)-O6(carbonyl)[3.02]", "interBase_angle": 24.722, "planarity": 0.284, "simple_Shear": 0.146, "simple_Stretch": 0.005, "simple_Buckle": 15.466, "simple_Propeller": -19.287, "bp_simpleParams": [ 0.146, 0.005, -0.028, 15.466, -19.287, -3.222 ], "bp_params": [ 0.146, 0.005, -0.028, 15.461, -19.291, -3.239 ], "frame": { "rmsd": null, "origin": [ 44.822, 28.925, 14.537 ], "x_axis": [ -0.843, 0.015, 0.538 ], "y_axis": [ -0.524, -0.252, -0.814 ], "z_axis": [ 0.123, -0.968, 0.220 ], "quaternion": [ 0.177, 0.217, -0.586, 0.761 ] } }, { "index": 65, "nt1": "///P/103", "nt2": "///P/118", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.506, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.075, "chi2": -170.686, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.231, "C1C1_dist": 10.505, "N1N9_dist": 8.862, "C6C8_dist": 9.877, "CNNC_torsion": -21.078, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.23],N1-N3(imino)[2.91]", "interBase_angle": 22.729, "planarity": 0.287, "simple_Shear": -0.141, "simple_Stretch": -0.054, "simple_Buckle": 6.160, "simple_Propeller": -21.879, "bp_simpleParams": [ -0.141, -0.054, 0.506, 6.160, -21.879, 2.672 ], "bp_params": [ -0.140, -0.057, 0.506, 6.430, -21.801, 2.717 ], "frame": { "rmsd": null, "origin": [ 44.810, 26.219, 17.084 ], "x_axis": [ -0.995, 0.093, -0.031 ], "y_axis": [ 0.008, -0.244, -0.970 ], "z_axis": [ -0.098, -0.965, 0.242 ], "quaternion": [ 0.027, -0.041, -0.614, 0.788 ] } }, { "index": 66, "nt1": "///P/104", "nt2": "///P/117", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.074, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 72.219, "chi2": -168.444, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.648, "C1C1_dist": 10.405, "N1N9_dist": 8.976, "C6C8_dist": 10.091, "CNNC_torsion": -15.877, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.93],N3(imino)-O6(carbonyl)[3.34]", "interBase_angle": 20.698, "planarity": 0.286, "simple_Shear": 2.248, "simple_Stretch": 0.381, "simple_Buckle": 0.642, "simple_Propeller": -20.688, "bp_simpleParams": [ 2.248, 0.381, -0.074, 0.642, -20.688, 9.876 ], "bp_params": [ 2.276, -0.130, -0.074, -3.998, -20.308, 10.027 ], "frame": { "rmsd": null, "origin": [ 43.195, 23.578, 19.255 ], "x_axis": [ -0.726, -0.011, -0.688 ], "y_axis": [ 0.628, -0.420, -0.656 ], "z_axis": [ -0.282, -0.908, 0.311 ], "quaternion": [ -0.204, -0.309, -0.499, 0.784 ] } }, { "index": 67, "nt1": "///P/105", "nt2": "///P/116", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -106.225, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.669, "chi2": -169.501, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.640, "C1C1_dist": 10.663, "N1N9_dist": 8.993, "C6C8_dist": 9.966, "CNNC_torsion": 8.458, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.99],O4(carbonyl)-N6(amino)[3.11]", "interBase_angle": 9.837, "planarity": 0.119, "simple_Shear": -0.068, "simple_Stretch": 0.045, "simple_Buckle": 9.067, "simple_Propeller": 3.814, "bp_simpleParams": [ -0.068, 0.045, -0.379, 9.067, 3.814, 1.134 ], "bp_params": [ -0.068, 0.044, -0.379, 9.033, 3.895, 1.132 ], "frame": { "rmsd": null, "origin": [ 41.098, 21.855, 21.513 ], "x_axis": [ -0.411, 0.020, -0.912 ], "y_axis": [ 0.793, -0.486, -0.368 ], "z_axis": [ -0.451, -0.874, 0.184 ], "quaternion": [ -0.268, -0.472, -0.430, 0.721 ] } }, { "index": 68, "nt1": "///P/106", "nt2": "///P/115", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.419, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.037, "chi2": -164.108, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.967, "C1C1_dist": 10.861, "N1N9_dist": 9.040, "C6C8_dist": 9.861, "CNNC_torsion": -6.151, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.93],N1-N3(imino)[3.05]", "interBase_angle": 8.132, "planarity": 0.098, "simple_Shear": -0.357, "simple_Stretch": -0.031, "simple_Buckle": 5.608, "simple_Propeller": -5.889, "bp_simpleParams": [ -0.357, -0.031, 0.130, 5.608, -5.889, -4.427 ], "bp_params": [ -0.356, -0.043, 0.130, 5.804, -5.696, -4.426 ], "frame": { "rmsd": null, "origin": [ 38.438, 19.619, 23.030 ], "x_axis": [ 0.031, -0.170, -0.985 ], "y_axis": [ 0.930, -0.357, 0.091 ], "z_axis": [ -0.367, -0.919, 0.147 ], "quaternion": [ -0.453, -0.557, -0.341, 0.607 ] } }, { "index": 69, "nt1": "///P/107", "nt2": "///P/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.798, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.548, "chi2": -165.073, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.787, "C1C1_dist": 10.415, "N1N9_dist": 8.812, "C6C8_dist": 9.862, "CNNC_torsion": -13.180, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.11],N1-N3(imino)[2.88]", "interBase_angle": 15.412, "planarity": 0.190, "simple_Shear": 0.145, "simple_Stretch": -0.038, "simple_Buckle": 6.800, "simple_Propeller": -13.830, "bp_simpleParams": [ 0.145, -0.038, 0.071, 6.800, -13.830, 4.836 ], "bp_params": [ 0.144, -0.040, 0.071, 6.560, -13.946, 4.865 ], "frame": { "rmsd": null, "origin": [ 36.260, 16.846, 22.433 ], "x_axis": [ 0.598, -0.286, -0.749 ], "y_axis": [ 0.711, -0.243, 0.660 ], "z_axis": [ -0.371, -0.927, 0.058 ], "quaternion": [ 0.594, 0.668, 0.159, -0.419 ] } }, { "index": 70, "nt1": "///P/108", "nt2": "///P/113", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.199, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.056, "chi2": -177.471, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.520, "C1C1_dist": 10.831, "N1N9_dist": 9.064, "C6C8_dist": 9.985, "CNNC_torsion": -1.274, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.11],N1(imino)-N3[3.09],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 4.309, "planarity": 0.057, "simple_Shear": -0.514, "simple_Stretch": -0.008, "simple_Buckle": 3.450, "simple_Propeller": -2.581, "bp_simpleParams": [ -0.514, -0.008, 0.059, 3.450, -2.581, 0.468 ], "bp_params": [ -0.513, -0.032, 0.059, 3.566, -2.419, 0.468 ], "frame": { "rmsd": null, "origin": [ 34.153, 13.964, 20.847 ], "x_axis": [ 0.887, -0.294, -0.356 ], "y_axis": [ 0.347, -0.084, 0.934 ], "z_axis": [ -0.305, -0.952, 0.028 ], "quaternion": [ 0.677, 0.697, 0.019, -0.237 ] } }, { "index": 71, "nt1": "///P/109", "nt2": "///P/112", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -158.453, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 87.031, "chi2": -128.930, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 18.973, "C1C1_dist": 9.889, "N1N9_dist": 8.647, "C6C8_dist": 8.668, "CNNC_torsion": -159.437, "hbonds_num": 3, "hbonds_desc": "N1(imino)-OP2[3.20],N2(amino)-OP2[2.56],N2(amino)-N7[3.14]", "interBase_angle": 19.375, "planarity": 0.241, "simple_Shear": 8.377, "simple_Stretch": 4.502, "simple_Buckle": 18.703, "simple_Propeller": -5.061, "bp_simpleParams": [ 8.377, 4.502, 0.657, 18.703, -5.061, -36.925 ], "bp_params": [ 7.716, -5.560, 0.657, 3.680, -19.023, -37.386 ], "frame": { "rmsd": null, "origin": [ 29.832, 11.197, 18.982 ], "x_axis": [ 0.797, -0.007, 0.604 ], "y_axis": [ -0.604, 0.021, 0.797 ], "z_axis": [ -0.018, -1.000, 0.012 ], "quaternion": [ 0.676, 0.664, -0.230, 0.221 ] } }, { "index": 72, "nt1": "///F/0", "nt2": "///Q/57", "bp": "a+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": false, "chi1": -122.276, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 63.509, "chi2": -177.655, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 86.758, "C1C1_dist": 8.269, "N1N9_dist": 8.002, "C6C8_dist": 10.313, "CNNC_torsion": 155.575, "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.77],N3-N2(amino)[3.22]", "interBase_angle": 29.921, "planarity": 0.343, "simple_Shear": 7.179, "simple_Stretch": 3.817, "simple_Buckle": 20.669, "simple_Propeller": -21.636, "bp_simpleParams": [ 7.179, 3.817, -0.852, 20.669, -21.636, 157.974 ], "bp_params": [ 2.811, 7.629, -0.852, 29.826, -2.384, 157.231 ], "frame": { "rmsd": null, "origin": [ 25.017, 40.814, 31.943 ], "x_axis": [ 0.988, 0.091, -0.128 ], "y_axis": [ -0.138, 0.109, -0.984 ], "z_axis": [ -0.075, 0.990, 0.120 ], "quaternion": [ 0.744, -0.663, 0.018, 0.077 ] } }, { "index": 73, "nt1": "///F/1", "nt2": "///Q/44", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "tH.", "DSSR": "tM+.", "intra_chain": false, "chi1": -62.918, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 59.707, "chi2": -167.619, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 13.313, "C1C1_dist": 11.145, "N1N9_dist": 9.017, "C6C8_dist": 7.245, "CNNC_torsion": 12.762, "hbonds_num": 1, "hbonds_desc": "N7-N4(amino)[3.71]", "interBase_angle": 34.731, "planarity": 0.450, "simple_Shear": -7.868, "simple_Stretch": 4.667, "simple_Buckle": -26.573, "simple_Propeller": 22.364, "bp_simpleParams": [ -7.868, 4.667, 0.989, -26.573, 22.364, 116.033 ], "bp_params": [ 6.124, -6.796, 0.989, 18.798, -29.204, 117.002 ], "frame": { "rmsd": null, "origin": [ 16.851, 38.037, 39.873 ], "x_axis": [ 0.555, 0.422, 0.717 ], "y_axis": [ -0.802, 0.501, 0.326 ], "z_axis": [ -0.222, -0.756, 0.616 ], "quaternion": [ 0.817, 0.331, -0.287, 0.374 ] } }, { "index": 74, "nt1": "///F/2", "nt2": "///Q/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -169.966, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.922, "chi2": -166.506, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.504, "C1C1_dist": 10.508, "N1N9_dist": 8.819, "C6C8_dist": 9.711, "CNNC_torsion": -8.417, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.71],N3-N1(imino)[2.78],N4(amino)-O6(carbonyl)[2.76]", "interBase_angle": 9.122, "planarity": 0.119, "simple_Shear": 0.175, "simple_Stretch": -0.282, "simple_Buckle": 6.155, "simple_Propeller": -6.733, "bp_simpleParams": [ 0.175, -0.282, 0.101, 6.155, -6.733, -1.306 ], "bp_params": [ 0.172, -0.284, 0.101, 6.077, -6.803, -1.306 ], "frame": { "rmsd": null, "origin": [ 26.559, 37.531, 34.916 ], "x_axis": [ -0.218, 0.168, 0.961 ], "y_axis": [ -0.975, -0.072, -0.209 ], "z_axis": [ 0.035, -0.983, 0.180 ], "quaternion": [ 0.472, 0.411, -0.491, 0.606 ] } }, { "index": 75, "nt1": "///F/3", "nt2": "///Q/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -162.777, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.747, "chi2": -164.085, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.930, "C1C1_dist": 10.547, "N1N9_dist": 8.800, "C6C8_dist": 9.685, "CNNC_torsion": -6.066, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.65],N1(imino)-N3[2.76],N2(amino)-O2(carbonyl)[2.64]", "interBase_angle": 10.442, "planarity": 0.141, "simple_Shear": -0.224, "simple_Stretch": -0.319, "simple_Buckle": 2.119, "simple_Propeller": -10.225, "bp_simpleParams": [ -0.224, -0.319, -0.082, 2.119, -10.225, -0.475 ], "bp_params": [ -0.219, -0.323, -0.082, 2.295, -10.187, -0.476 ], "frame": { "rmsd": null, "origin": [ 28.503, 34.270, 35.753 ], "x_axis": [ -0.698, 0.217, 0.682 ], "y_axis": [ -0.713, -0.134, -0.688 ], "z_axis": [ -0.057, -0.967, 0.249 ], "quaternion": [ 0.322, 0.216, -0.573, 0.721 ] } }, { "index": 76, "nt1": "///F/4", "nt2": "///Q/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.357, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.788, "chi2": -163.799, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.601, "C1C1_dist": 10.719, "N1N9_dist": 8.892, "C6C8_dist": 9.712, "CNNC_torsion": -12.766, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.89],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.71]", "interBase_angle": 17.645, "planarity": 0.208, "simple_Shear": 0.303, "simple_Stretch": -0.281, "simple_Buckle": 5.618, "simple_Propeller": -16.727, "bp_simpleParams": [ 0.303, -0.281, -0.233, 5.618, -16.727, -2.774 ], "bp_params": [ 0.296, -0.287, -0.233, 5.222, -16.854, -2.801 ], "frame": { "rmsd": null, "origin": [ 29.443, 31.409, 37.722 ], "x_axis": [ -0.954, 0.199, 0.223 ], "y_axis": [ -0.266, -0.228, -0.937 ], "z_axis": [ -0.136, -0.953, 0.270 ], "quaternion": [ 0.149, 0.028, -0.603, 0.783 ] } }, { "index": 77, "nt1": "///F/5", "nt2": "///Q/53", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -126.873, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.008, "chi2": -161.256, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.211, "C1C1_dist": 10.760, "N1N9_dist": 8.958, "C6C8_dist": 9.842, "CNNC_torsion": -1.064, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.76],N3-N1(imino)[2.99],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 9.654, "planarity": 0.104, "simple_Shear": 0.500, "simple_Stretch": -0.129, "simple_Buckle": 6.828, "simple_Propeller": -6.825, "bp_simpleParams": [ 0.500, -0.129, -0.253, 6.828, -6.825, -0.200 ], "bp_params": [ 0.493, -0.151, -0.253, 6.526, -7.115, -0.200 ], "frame": { "rmsd": null, "origin": [ 28.651, 28.734, 40.370 ], "x_axis": [ -0.911, 0.265, -0.316 ], "y_axis": [ 0.212, -0.356, -0.910 ], "z_axis": [ -0.353, -0.896, 0.269 ], "quaternion": [ 0.016, -0.210, -0.567, 0.796 ] } }, { "index": 78, "nt1": "///F/7", "nt2": "///Q/27", "bp": "G-G", "name": "--", "Saenger": "--", "LW": "tH.", "DSSR": "tM-.", "intra_chain": false, "chi1": -179.475, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 7.172, "chi2": -140.968, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 87.108, "C1C1_dist": 11.492, "N1N9_dist": 10.027, "C6C8_dist": 10.278, "CNNC_torsion": -101.395, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N2(amino)[2.98]", "interBase_angle": 2.158, "planarity": 0.074, "simple_Shear": -6.945, "simple_Stretch": 3.371, "simple_Buckle": 0.080, "simple_Propeller": 2.156, "bp_simpleParams": [ -6.945, 3.371, 0.370, 0.080, 2.156, -18.394 ], "bp_params": [ -7.289, -2.543, 0.370, -1.471, 1.578, -18.394 ], "frame": { "rmsd": null, "origin": [ 28.684, 24.728, 40.852 ], "x_axis": [ -0.164, -0.210, -0.964 ], "y_axis": [ 0.977, -0.167, -0.130 ], "z_axis": [ -0.133, -0.963, 0.233 ], "quaternion": [ -0.475, -0.439, -0.437, 0.625 ] } }, { "index": 79, "nt1": "///F/7", "nt2": "///Q/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -179.475, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.609, "chi2": -171.136, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.085, "C1C1_dist": 10.492, "N1N9_dist": 8.798, "C6C8_dist": 9.689, "CNNC_torsion": -10.809, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.01],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 25.591, "planarity": 0.326, "simple_Shear": -0.666, "simple_Stretch": -0.117, "simple_Buckle": -22.260, "simple_Propeller": -12.626, "bp_simpleParams": [ -0.666, -0.117, 0.087, -22.260, -12.626, 1.102 ], "bp_params": [ -0.659, -0.151, 0.087, -21.642, -13.658, 1.090 ], "frame": { "rmsd": null, "origin": [ 27.999, 25.522, 44.233 ], "x_axis": [ -0.299, -0.054, -0.953 ], "y_axis": [ 0.894, -0.365, -0.259 ], "z_axis": [ -0.334, -0.929, 0.158 ], "quaternion": [ -0.351, -0.477, -0.440, 0.675 ] } }, { "index": 80, "nt1": "///F/8", "nt2": "///Q/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -158.055, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.688, "chi2": -156.022, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.261, "C1C1_dist": 10.903, "N1N9_dist": 9.161, "C6C8_dist": 10.079, "CNNC_torsion": -12.214, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.32],N1-N3(imino)[3.21]", "interBase_angle": 19.245, "planarity": 0.237, "simple_Shear": -0.300, "simple_Stretch": 0.248, "simple_Buckle": 16.107, "simple_Propeller": -10.533, "bp_simpleParams": [ -0.300, 0.248, 0.181, 16.107, -10.533, 0.067 ], "bp_params": [ -0.308, 0.238, 0.181, 16.461, -9.971, 0.066 ], "frame": { "rmsd": null, "origin": [ 27.970, 21.900, 41.402 ], "x_axis": [ 0.758, -0.078, -0.647 ], "y_axis": [ 0.651, 0.141, 0.746 ], "z_axis": [ 0.033, -0.987, 0.158 ], "quaternion": [ 0.717, 0.604, 0.237, -0.254 ] } }, { "index": 81, "nt1": "///F/8", "nt2": "///Q/50", "bp": "A+U", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": false, "chi1": -158.055, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 91.378, "chi2": -128.814, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 20.577, "C1C1_dist": 8.169, "N1N9_dist": 7.090, "C6C8_dist": 8.710, "CNNC_torsion": 165.725, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O4(carbonyl)[2.68],N3-N3(imino)[3.15]", "interBase_angle": 18.703, "planarity": 0.256, "simple_Shear": 4.010, "simple_Stretch": 1.792, "simple_Buckle": -15.134, "simple_Propeller": -10.990, "bp_simpleParams": [ 4.010, 1.792, 0.289, -15.134, -10.990, -107.976 ], "bp_params": [ -0.517, -4.362, 0.289, -1.652, 18.630, -108.692 ], "frame": { "rmsd": null, "origin": [ 27.689, 22.171, 43.767 ], "x_axis": [ 0.930, -0.255, 0.264 ], "y_axis": [ -0.241, 0.119, 0.963 ], "z_axis": [ -0.277, -0.960, 0.049 ], "quaternion": [ 0.724, 0.664, -0.187, -0.005 ] } }, { "index": 82, "nt1": "///F/9", "nt2": "///Q/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -149.851, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.065, "chi2": -162.661, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.856, "C1C1_dist": 10.404, "N1N9_dist": 8.826, "C6C8_dist": 9.851, "CNNC_torsion": -26.124, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.28],N1-N3(imino)[3.00]", "interBase_angle": 31.644, "planarity": 0.387, "simple_Shear": -0.252, "simple_Stretch": 0.058, "simple_Buckle": 17.387, "simple_Propeller": -26.440, "bp_simpleParams": [ -0.252, 0.058, 0.207, 17.387, -26.440, 5.051 ], "bp_params": [ -0.254, 0.048, 0.207, 18.286, -25.826, 5.119 ], "frame": { "rmsd": null, "origin": [ 28.099, 18.558, 41.022 ], "x_axis": [ 0.985, 0.117, -0.126 ], "y_axis": [ 0.111, 0.130, 0.985 ], "z_axis": [ 0.132, -0.985, 0.115 ], "quaternion": [ 0.747, 0.660, 0.086, 0.002 ] } }, { "index": 83, "nt1": "///F/10", "nt2": "///Q/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -153.068, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.988, "chi2": -162.998, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.110, "C1C1_dist": 10.618, "N1N9_dist": 8.969, "C6C8_dist": 9.918, "CNNC_torsion": -19.577, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.01],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[2.99]", "interBase_angle": 28.938, "planarity": 0.341, "simple_Shear": -0.007, "simple_Stretch": -0.066, "simple_Buckle": 9.900, "simple_Propeller": -27.191, "bp_simpleParams": [ -0.007, -0.066, -0.400, 9.900, -27.191, 2.816 ], "bp_params": [ -0.006, -0.066, -0.400, 10.167, -27.093, 2.886 ], "frame": { "rmsd": null, "origin": [ 28.850, 15.245, 40.179 ], "x_axis": [ 0.839, 0.279, 0.468 ], "y_axis": [ -0.478, -0.035, 0.878 ], "z_axis": [ 0.261, -0.960, 0.104 ], "quaternion": [ 0.691, 0.665, -0.075, 0.274 ] } }, { "index": 84, "nt1": "///F/11", "nt2": "///Q/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.715, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.231, "chi2": -166.686, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.370, "C1C1_dist": 10.686, "N1N9_dist": 8.909, "C6C8_dist": 9.767, "CNNC_torsion": -16.988, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.84],O4(carbonyl)-N6(amino)[2.83]", "interBase_angle": 10.765, "planarity": 0.165, "simple_Shear": -0.217, "simple_Stretch": -0.164, "simple_Buckle": -5.079, "simple_Propeller": -9.492, "bp_simpleParams": [ -0.217, -0.164, 0.491, -5.079, -9.492, -4.371 ], "bp_params": [ -0.213, -0.169, 0.491, -4.846, -9.612, -4.382 ], "frame": { "rmsd": null, "origin": [ 30.785, 11.765, 39.596 ], "x_axis": [ 0.400, 0.402, 0.824 ], "y_axis": [ -0.863, -0.137, 0.486 ], "z_axis": [ 0.308, -0.905, 0.292 ], "quaternion": [ 0.624, 0.558, -0.207, 0.507 ] } }, { "index": 85, "nt1": "///F/11", "nt2": "///Q/111", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": false, "chi1": -161.715, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 150.861, "chi2": -144.459, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 100.098, "C1C1_dist": 5.508, "N1N9_dist": 7.183, "C6C8_dist": 9.706, "CNNC_torsion": -44.872, "hbonds_num": 4, "hbonds_desc": "O3'-O2'(hydroxyl)[2.75],O2'(hydroxyl)-O2'(hydroxyl)[3.01],O2'(hydroxyl)-N3[2.62],O2(carbonyl)-N2(amino)[2.72]", "interBase_angle": 23.170, "planarity": 0.327, "simple_Shear": 0.482, "simple_Stretch": 7.847, "simple_Buckle": -10.387, "simple_Propeller": -20.711, "bp_simpleParams": [ 0.482, 7.847, 0.093, -10.387, -20.711, 158.935 ], "bp_params": [ 2.250, 7.533, 0.093, -14.754, -17.865, 159.011 ], "frame": { "rmsd": null, "origin": [ 28.643, 10.530, 36.466 ], "x_axis": [ 0.882, 0.291, -0.372 ], "y_axis": [ 0.329, 0.185, 0.926 ], "z_axis": [ 0.338, -0.939, 0.068 ], "quaternion": [ 0.731, 0.638, 0.243, -0.013 ] } }, { "index": 86, "nt1": "///Q/12", "nt2": "///Q/22", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 176.968, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.229, "chi2": -161.145, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.384, "C1C1_dist": 10.912, "N1N9_dist": 9.111, "C6C8_dist": 9.986, "CNNC_torsion": -13.576, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.10],N1(imino)-N3[2.99],N2(amino)-O2(carbonyl)[3.09]", "interBase_angle": 13.643, "planarity": 0.176, "simple_Shear": -0.404, "simple_Stretch": -0.070, "simple_Buckle": 1.284, "simple_Propeller": -13.582, "bp_simpleParams": [ -0.404, -0.070, 0.126, 1.284, -13.582, -3.194 ], "bp_params": [ -0.401, -0.085, 0.126, 1.794, -13.525, -3.216 ], "frame": { "rmsd": null, "origin": [ 33.528, 9.597, 40.038 ], "x_axis": [ -0.034, 0.336, 0.941 ], "y_axis": [ -0.936, -0.340, 0.088 ], "z_axis": [ 0.349, -0.878, 0.326 ], "quaternion": [ 0.488, 0.495, -0.303, 0.652 ] } }, { "index": 87, "nt1": "///Q/13", "nt2": "///Q/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.270, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.635, "chi2": -162.916, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.350, "C1C1_dist": 10.817, "N1N9_dist": 9.047, "C6C8_dist": 9.940, "CNNC_torsion": -15.146, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.05],N1(imino)-N3[2.98],N2(amino)-O2(carbonyl)[2.84]", "interBase_angle": 16.154, "planarity": 0.204, "simple_Shear": -0.070, "simple_Stretch": -0.070, "simple_Buckle": -2.698, "simple_Propeller": -15.927, "bp_simpleParams": [ -0.070, -0.070, 0.248, -2.698, -15.927, -1.110 ], "bp_params": [ -0.070, -0.070, 0.248, -2.679, -15.930, -1.120 ], "frame": { "rmsd": null, "origin": [ 36.365, 7.403, 41.311 ], "x_axis": [ -0.607, 0.148, 0.781 ], "y_axis": [ -0.738, -0.470, -0.485 ], "z_axis": [ 0.295, -0.870, 0.395 ], "quaternion": [ 0.282, 0.342, -0.431, 0.786 ] } }, { "index": 88, "nt1": "///Q/14", "nt2": "///Q/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.958, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.841, "chi2": -164.013, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.183, "C1C1_dist": 10.702, "N1N9_dist": 9.018, "C6C8_dist": 9.993, "CNNC_torsion": -12.137, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.98],N4(amino)-O6(carbonyl)[3.09]", "interBase_angle": 12.341, "planarity": 0.161, "simple_Shear": 0.185, "simple_Stretch": -0.023, "simple_Buckle": 2.581, "simple_Propeller": -12.068, "bp_simpleParams": [ 0.185, -0.023, 0.227, 2.581, -12.068, 2.458 ], "bp_params": [ 0.185, -0.025, 0.227, 2.422, -12.101, 2.472 ], "frame": { "rmsd": null, "origin": [ 37.730, 5.432, 43.758 ], "x_axis": [ -0.937, -0.049, 0.347 ], "y_axis": [ -0.280, -0.492, -0.824 ], "z_axis": [ 0.211, -0.869, 0.447 ], "quaternion": [ 0.068, 0.165, -0.499, 0.848 ] } }, { "index": 89, "nt1": "///Q/15", "nt2": "///Q/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.082, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.091, "chi2": -162.877, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.893, "C1C1_dist": 10.513, "N1N9_dist": 8.920, "C6C8_dist": 9.963, "CNNC_torsion": -7.341, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.15],N1-N3(imino)[2.99]", "interBase_angle": 13.263, "planarity": 0.153, "simple_Shear": 0.110, "simple_Stretch": 0.075, "simple_Buckle": 13.092, "simple_Propeller": -2.125, "bp_simpleParams": [ 0.110, 0.075, 0.574, 13.092, -2.125, 4.523 ], "bp_params": [ 0.111, 0.074, 0.574, 13.065, -2.286, 4.495 ], "frame": { "rmsd": null, "origin": [ 38.246, 3.653, 46.255 ], "x_axis": [ -0.979, -0.110, -0.170 ], "y_axis": [ 0.201, -0.408, -0.891 ], "z_axis": [ 0.029, -0.906, 0.422 ], "quaternion": [ -0.093, -0.042, -0.536, 0.838 ] } }, { "index": 90, "nt1": "///Q/16", "nt2": "///Q/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.900, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.895, "chi2": -164.816, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.589, "C1C1_dist": 10.664, "N1N9_dist": 8.970, "C6C8_dist": 9.908, "CNNC_torsion": -11.442, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[3.00]", "interBase_angle": 20.274, "planarity": 0.227, "simple_Shear": 0.237, "simple_Stretch": -0.059, "simple_Buckle": 10.685, "simple_Propeller": -17.230, "bp_simpleParams": [ 0.237, -0.059, -0.154, 10.685, -17.230, 1.974 ], "bp_params": [ 0.236, -0.062, -0.154, 10.440, -17.380, 1.989 ], "frame": { "rmsd": null, "origin": [ 37.231, 1.203, 48.643 ], "x_axis": [ -0.693, -0.185, -0.696 ], "y_axis": [ 0.696, -0.421, -0.581 ], "z_axis": [ -0.186, -0.888, 0.421 ], "quaternion": [ -0.277, -0.277, -0.461, 0.796 ] } }, { "index": 91, "nt1": "///Q/17", "nt2": "///Q/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.287, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.470, "chi2": -174.268, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.073, "C1C1_dist": 10.673, "N1N9_dist": 8.979, "C6C8_dist": 9.907, "CNNC_torsion": -5.573, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 6.603, "planarity": 0.088, "simple_Shear": 0.365, "simple_Stretch": -0.097, "simple_Buckle": -2.451, "simple_Propeller": -6.132, "bp_simpleParams": [ 0.365, -0.097, 0.163, -2.451, -6.132, 0.557 ], "bp_params": [ 0.362, -0.109, 0.163, -2.648, -6.049, 0.558 ], "frame": { "rmsd": null, "origin": [ 34.667, -1.356, 50.522 ], "x_axis": [ -0.176, -0.213, -0.961 ], "y_axis": [ 0.958, -0.261, -0.118 ], "z_axis": [ -0.226, -0.941, 0.251 ], "quaternion": [ -0.451, -0.457, -0.408, 0.650 ] } }, { "index": 92, "nt1": "///Q/17", "nt2": "///Q/17", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.376, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 112.376, "chi2": -93.500, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 93.452, "C1C1_dist": 7.465, "N1N9_dist": 8.126, "C6C8_dist": 10.253, "CNNC_torsion": 11.910, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.90]", "interBase_angle": 66.063, "planarity": 0.625, "simple_Shear": 0.318, "simple_Stretch": 4.394, "simple_Buckle": 60.372, "simple_Propeller": 26.823, "bp_simpleParams": [ 0.318, 4.394, -3.322, 60.372, 26.823, 105.332 ], "bp_params": [ 0.716, 4.347, -3.322, 63.184, 19.290, 97.075 ], "frame": { "rmsd": null, "origin": [ 30.659, -9.991, 47.346 ], "x_axis": [ 0.372, -0.326, -0.869 ], "y_axis": [ 0.918, 0.265, 0.294 ], "z_axis": [ 0.134, -0.907, 0.398 ], "quaternion": [ 0.713, 0.421, 0.352, -0.436 ] } }, { "index": 93, "nt1": "///Q/24", "nt2": "///Q/112", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -162.998, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 92.080, "chi2": -127.159, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.567, "C1C1_dist": 8.334, "N1N9_dist": 8.159, "C6C8_dist": 10.476, "CNNC_torsion": 163.452, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.75],N2(amino)-N3[3.13]", "interBase_angle": 17.231, "planarity": 0.202, "simple_Shear": 7.061, "simple_Stretch": 4.004, "simple_Buckle": 12.847, "simple_Propeller": -11.482, "bp_simpleParams": [ 7.061, 4.004, 0.249, 12.847, -11.482, -153.523 ], "bp_params": [ -2.512, -7.718, 0.249, -17.230, -0.195, -153.231 ], "frame": { "rmsd": null, "origin": [ 27.081, 13.621, 36.889 ], "x_axis": [ 0.655, 0.056, -0.754 ], "y_axis": [ -0.692, -0.359, -0.627 ], "z_axis": [ -0.306, 0.932, -0.197 ], "quaternion": [ 0.524, -0.743, 0.214, 0.356 ] } }, { "index": 94, "nt1": "///Q/27", "nt2": "///Q/52", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -140.968, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 147.161, "chi2": -171.136, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 16.957, "C1C1_dist": 8.740, "N1N9_dist": 8.536, "C6C8_dist": 8.943, "CNNC_torsion": 11.238, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N4(amino)[2.96],N3-N4(amino)[3.92]", "interBase_angle": 24.913, "planarity": 0.316, "simple_Shear": 0.440, "simple_Stretch": 7.064, "simple_Buckle": -4.534, "simple_Propeller": -24.497, "bp_simpleParams": [ 0.440, 7.064, 0.174, -4.534, -24.497, -20.206 ], "bp_params": [ 6.614, -2.520, 0.174, -22.072, 11.554, -19.942 ], "frame": { "rmsd": null, "origin": [ 28.668, 24.722, 40.512 ], "x_axis": [ -0.155, -0.126, -0.980 ], "y_axis": [ -0.926, 0.364, 0.100 ], "z_axis": [ 0.344, 0.923, -0.173 ], "quaternion": [ 0.509, -0.404, 0.650, 0.393 ] } }, { "index": 95, "nt1": "///Q/28", "nt2": "///Q/29", "bp": "A+C", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -74.099, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 139.537, "chi2": -171.991, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.634, "C1C1_dist": 6.811, "N1N9_dist": 6.860, "C6C8_dist": 6.907, "CNNC_torsion": 31.235, "hbonds_num": 1, "hbonds_desc": "N3-N4(amino)[2.92]", "interBase_angle": 35.243, "planarity": 0.410, "simple_Shear": -0.135, "simple_Stretch": 7.008, "simple_Buckle": 0.667, "simple_Propeller": 35.237, "bp_simpleParams": [ -0.135, 7.008, -1.970, 0.667, 35.237, 2.453 ], "bp_params": [ 6.976, 0.679, -1.970, 35.181, 2.091, 2.339 ], "frame": { "rmsd": null, "origin": [ 15.839, 35.735, 41.527 ], "x_axis": [ 0.959, 0.063, 0.276 ], "y_axis": [ 0.231, -0.737, -0.635 ], "z_axis": [ 0.163, 0.673, -0.722 ], "quaternion": [ -0.354, 0.924, 0.080, 0.119 ] } }, { "index": 96, "nt1": "///Q/28", "nt2": "///R/49", "bp": "A+U", "name": "rWC", "Saenger": "21-XXI", "LW": "cWW", "DSSR": "cW+W", "intra_chain": false, "chi1": -74.099, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 39.149, "chi2": -95.338, "conf2": "anti", "pucker2": "----", "lambda2": 33.654, "C1C1_dist": 12.336, "N1N9_dist": 9.971, "C6C8_dist": 10.204, "CNNC_torsion": 69.832, "hbonds_num": 1, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.17]", "interBase_angle": 69.462, "planarity": 0.840, "simple_Shear": -2.213, "simple_Stretch": 0.514, "simple_Buckle": -21.188, "simple_Propeller": -66.152, "bp_simpleParams": [ -2.213, 0.514, -0.290, -21.188, -66.152, -167.441 ], "bp_params": [ 0.037, 2.271, -0.290, -69.308, 4.620, -164.770 ], "frame": { "rmsd": null, "origin": [ 19.980, 34.699, 43.634 ], "x_axis": [ 0.392, -0.456, -0.799 ], "y_axis": [ -0.703, 0.411, -0.580 ], "z_axis": [ 0.593, 0.789, -0.159 ], "quaternion": [ 0.641, -0.534, 0.543, 0.096 ] } }, { "index": 97, "nt1": "///Q/29", "nt2": "///Q/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.991, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.965, "chi2": 174.615, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.568, "C1C1_dist": 10.692, "N1N9_dist": 8.961, "C6C8_dist": 9.877, "CNNC_torsion": -1.128, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.85],N3-N1(imino)[3.03],N4(amino)-O6(carbonyl)[3.01]", "interBase_angle": 14.894, "planarity": 0.157, "simple_Shear": 0.471, "simple_Stretch": -0.062, "simple_Buckle": -13.920, "simple_Propeller": 5.299, "bp_simpleParams": [ 0.471, -0.062, 0.540, -13.920, 5.299, 0.771 ], "bp_params": [ 0.468, -0.081, 0.540, -13.706, 5.829, 0.767 ], "frame": { "rmsd": null, "origin": [ 12.322, 36.224, 40.226 ], "x_axis": [ 0.966, 0.122, 0.227 ], "y_axis": [ 0.220, -0.847, -0.483 ], "z_axis": [ 0.134, 0.517, -0.846 ], "quaternion": [ -0.261, 0.956, 0.089, 0.094 ] } }, { "index": 98, "nt1": "///Q/30", "nt2": "///Q/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 175.578, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.250, "chi2": -167.619, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.471, "C1C1_dist": 10.794, "N1N9_dist": 9.049, "C6C8_dist": 9.927, "CNNC_torsion": -10.007, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.90],N1(imino)-N3[3.04],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 8.226, "planarity": 0.113, "simple_Shear": -0.277, "simple_Stretch": -0.062, "simple_Buckle": 3.817, "simple_Propeller": -7.286, "bp_simpleParams": [ -0.277, -0.062, 0.214, 3.817, -7.286, -1.181 ], "bp_params": [ -0.275, -0.069, 0.214, 3.982, -7.197, -1.183 ], "frame": { "rmsd": null, "origin": [ 12.420, 38.932, 38.407 ], "x_axis": [ 0.984, -0.168, 0.056 ], "y_axis": [ -0.103, -0.801, -0.590 ], "z_axis": [ 0.144, 0.575, -0.806 ], "quaternion": [ -0.307, 0.948, -0.071, 0.053 ] } }, { "index": 99, "nt1": "///Q/30", "nt2": "///Q/123", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": 175.578, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 99.766, "chi2": -156.130, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.883, "C1C1_dist": 9.911, "N1N9_dist": 9.380, "C6C8_dist": 11.032, "CNNC_torsion": 118.103, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N1[3.02]", "interBase_angle": 60.914, "planarity": 0.839, "simple_Shear": 3.341, "simple_Stretch": 4.673, "simple_Buckle": -38.178, "simple_Propeller": -47.466, "bp_simpleParams": [ 3.341, 4.673, -0.709, -38.178, -47.466, -102.832 ], "bp_params": [ 2.252, -5.285, -0.709, -21.332, 57.057, -108.927 ], "frame": { "rmsd": null, "origin": [ 9.458, 39.177, 37.823 ], "x_axis": [ 0.523, -0.315, -0.792 ], "y_axis": [ -0.852, -0.208, -0.480 ], "z_axis": [ -0.014, 0.926, -0.378 ], "quaternion": [ -0.484, 0.726, -0.402, -0.277 ] } }, { "index": 100, "nt1": "///Q/31", "nt2": "///Q/43", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.226, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.269, "chi2": -174.253, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.935, "C1C1_dist": 10.650, "N1N9_dist": 8.903, "C6C8_dist": 9.781, "CNNC_torsion": -3.591, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.81],N1-N3(imino)[2.87]", "interBase_angle": 9.013, "planarity": 0.101, "simple_Shear": 0.014, "simple_Stretch": -0.148, "simple_Buckle": -4.446, "simple_Propeller": -7.840, "bp_simpleParams": [ 0.014, -0.148, -0.234, -4.446, -7.840, -2.948 ], "bp_params": [ 0.013, -0.148, -0.234, -4.512, -7.802, -2.953 ], "frame": { "rmsd": null, "origin": [ 13.351, 42.600, 36.895 ], "x_axis": [ 0.698, -0.677, -0.234 ], "y_axis": [ -0.677, -0.517, -0.524 ], "z_axis": [ 0.234, 0.524, -0.819 ], "quaternion": [ -0.301, 0.871, -0.389, -0.000 ] } }, { "index": 101, "nt1": "///Q/35", "nt2": "///Q/65", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.050, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.069, "chi2": -167.340, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.513, "C1C1_dist": 10.687, "N1N9_dist": 9.008, "C6C8_dist": 9.932, "CNNC_torsion": -14.356, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.14],N1(imino)-N3[3.06],N2(amino)-O2(carbonyl)[2.89]", "interBase_angle": 14.824, "planarity": 0.207, "simple_Shear": -0.484, "simple_Stretch": -0.057, "simple_Buckle": 9.153, "simple_Propeller": -11.661, "bp_simpleParams": [ -0.484, -0.057, 0.677, 9.153, -11.661, -0.143 ], "bp_params": [ -0.481, -0.080, 0.677, 9.699, -11.211, -0.143 ], "frame": { "rmsd": null, "origin": [ 23.014, 63.699, 30.398 ], "x_axis": [ -0.581, -0.077, 0.810 ], "y_axis": [ -0.611, -0.616, -0.497 ], "z_axis": [ 0.537, -0.784, 0.311 ], "quaternion": [ 0.169, 0.425, -0.404, 0.792 ] } }, { "index": 102, "nt1": "///Q/36", "nt2": "///Q/64", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.459, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.746, "chi2": -168.925, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.256, "C1C1_dist": 10.497, "N1N9_dist": 8.798, "C6C8_dist": 9.721, "CNNC_torsion": -9.997, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.80],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.64]", "interBase_angle": 12.109, "planarity": 0.152, "simple_Shear": -0.415, "simple_Stretch": -0.270, "simple_Buckle": -1.351, "simple_Propeller": -12.034, "bp_simpleParams": [ -0.415, -0.270, 0.151, -1.351, -12.034, 0.035 ], "bp_params": [ -0.405, -0.285, 0.151, -0.901, -12.076, 0.035 ], "frame": { "rmsd": null, "origin": [ 25.638, 62.074, 32.611 ], "x_axis": [ -0.881, -0.351, 0.317 ], "y_axis": [ -0.121, -0.481, -0.868 ], "z_axis": [ 0.458, -0.803, 0.382 ], "quaternion": [ -0.069, 0.234, -0.504, 0.828 ] } }, { "index": 103, "nt1": "///Q/37", "nt2": "///Q/63", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.026, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 42.506, "chi2": -156.708, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 63.649, "C1C1_dist": 10.551, "N1N9_dist": 8.830, "C6C8_dist": 9.682, "CNNC_torsion": -14.930, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.99],N1(imino)-O2(carbonyl)[2.87]", "interBase_angle": 15.737, "planarity": 0.203, "simple_Shear": -2.081, "simple_Stretch": -0.082, "simple_Buckle": -3.144, "simple_Propeller": -15.420, "bp_simpleParams": [ -2.081, -0.082, 0.206, -3.144, -15.420, -3.114 ], "bp_params": [ -2.021, -0.501, 0.206, 0.062, -15.737, -3.144 ], "frame": { "rmsd": null, "origin": [ 26.850, 60.431, 35.371 ], "x_axis": [ -0.900, -0.398, -0.175 ], "y_axis": [ 0.292, -0.254, -0.922 ], "z_axis": [ 0.322, -0.881, 0.345 ], "quaternion": [ -0.218, 0.046, -0.570, 0.791 ] } }, { "index": 104, "nt1": "///Q/38", "nt2": "///Q/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.904, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.679, "chi2": -152.463, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.055, "C1C1_dist": 10.498, "N1N9_dist": 8.749, "C6C8_dist": 9.597, "CNNC_torsion": -14.275, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.80],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 20.952, "planarity": 0.237, "simple_Shear": -0.785, "simple_Stretch": -0.323, "simple_Buckle": -11.832, "simple_Propeller": -17.291, "bp_simpleParams": [ -0.785, -0.323, -0.079, -11.832, -17.291, -2.214 ], "bp_params": [ -0.762, -0.376, -0.079, -10.607, -18.069, -2.232 ], "frame": { "rmsd": null, "origin": [ 26.783, 57.386, 37.833 ], "x_axis": [ -0.589, -0.320, -0.742 ], "y_axis": [ 0.783, 0.002, -0.622 ], "z_axis": [ 0.200, -0.947, 0.250 ], "quaternion": [ -0.407, -0.200, -0.579, 0.678 ] } }, { "index": 105, "nt1": "///Q/39", "nt2": "///Q/61", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.487, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.054, "chi2": -151.519, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.829, "C1C1_dist": 10.452, "N1N9_dist": 8.820, "C6C8_dist": 9.763, "CNNC_torsion": -20.444, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.89],O4(carbonyl)-N6(amino)[2.98]", "interBase_angle": 22.517, "planarity": 0.274, "simple_Shear": -0.198, "simple_Stretch": -0.065, "simple_Buckle": -15.771, "simple_Propeller": -16.071, "bp_simpleParams": [ -0.198, -0.065, 0.346, -15.771, -16.071, 0.246 ], "bp_params": [ -0.197, -0.067, 0.346, -15.543, -16.292, 0.246 ], "frame": { "rmsd": null, "origin": [ 26.478, 53.921, 38.692 ], "x_axis": [ -0.017, -0.116, -0.993 ], "y_axis": [ 0.981, 0.192, -0.040 ], "z_axis": [ 0.195, -0.974, 0.111 ], "quaternion": [ 0.567, 0.412, 0.524, -0.484 ] } }, { "index": 106, "nt1": "///Q/40", "nt2": "///Q/60", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -147.244, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 66.800, "chi2": -177.926, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 36.341, "C1C1_dist": 10.539, "N1N9_dist": 8.791, "C6C8_dist": 9.519, "CNNC_torsion": -11.865, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.87],N3(imino)-O6(carbonyl)[2.73]", "interBase_angle": 8.209, "planarity": 0.110, "simple_Shear": 3.227, "simple_Stretch": 0.081, "simple_Buckle": 2.066, "simple_Propeller": -7.945, "bp_simpleParams": [ 3.227, 0.081, 0.096, 2.066, -7.945, -7.562 ], "bp_params": [ 3.084, -0.955, 0.096, -0.586, -8.188, -7.581 ], "frame": { "rmsd": null, "origin": [ 26.100, 50.993, 38.574 ], "x_axis": [ 0.720, 0.077, -0.690 ], "y_axis": [ 0.679, 0.128, 0.723 ], "z_axis": [ 0.144, -0.989, 0.040 ], "quaternion": [ 0.687, 0.623, 0.303, -0.219 ] } }, { "index": 107, "nt1": "///Q/45", "nt2": "///Q/98", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": 174.615, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 99.846, "chi2": -155.036, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.247, "C1C1_dist": 10.316, "N1N9_dist": 9.742, "C6C8_dist": 11.388, "CNNC_torsion": 117.036, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N1[2.94]", "interBase_angle": 61.259, "planarity": 0.811, "simple_Shear": 3.207, "simple_Stretch": 4.636, "simple_Buckle": -32.991, "simple_Propeller": -51.616, "bp_simpleParams": [ 3.207, 4.636, 0.199, -32.991, -51.616, -110.383 ], "bp_params": [ 2.463, -5.071, 0.199, -29.879, 53.478, -114.382 ], "frame": { "rmsd": null, "origin": [ 9.270, 35.874, 40.063 ], "x_axis": [ 0.321, 0.373, 0.870 ], "y_axis": [ -0.946, 0.087, 0.312 ], "z_axis": [ 0.041, -0.924, 0.381 ], "quaternion": [ 0.669, 0.462, -0.310, 0.493 ] } }, { "index": 108, "nt1": "///Q/46", "nt2": "///Q/51", "bp": "A+U", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -168.199, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 33.632, "chi2": -141.991, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 37.757, "C1C1_dist": 11.084, "N1N9_dist": 8.846, "C6C8_dist": 9.761, "CNNC_torsion": -171.354, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.89],N1-N3(imino)[2.82]", "interBase_angle": 13.473, "planarity": 0.159, "simple_Shear": 1.183, "simple_Stretch": -0.001, "simple_Buckle": 13.330, "simple_Propeller": 1.958, "bp_simpleParams": [ 1.183, -0.001, 0.203, 13.330, 1.958, 170.340 ], "bp_params": [ 0.140, 1.175, 0.203, -0.377, 13.468, 170.407 ], "frame": { "rmsd": null, "origin": [ 12.543, 32.464, 41.909 ], "x_axis": [ 0.824, -0.547, -0.148 ], "y_axis": [ 0.538, 0.673, 0.509 ], "z_axis": [ -0.178, -0.499, 0.848 ], "quaternion": [ 0.914, 0.275, -0.008, -0.296 ] } }, { "index": 109, "nt1": "///Q/66", "nt2": "///Q/84", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.569, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.936, "chi2": -122.246, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.669, "C1C1_dist": 10.652, "N1N9_dist": 8.944, "C6C8_dist": 9.862, "CNNC_torsion": -11.842, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.87],N3-N1(imino)[3.01],N4(amino)-O6(carbonyl)[3.06]", "interBase_angle": 13.659, "planarity": 0.182, "simple_Shear": 0.560, "simple_Stretch": -0.096, "simple_Buckle": -9.623, "simple_Propeller": -9.693, "bp_simpleParams": [ 0.560, -0.096, 0.443, -9.623, -9.693, -0.105 ], "bp_params": [ 0.554, -0.126, 0.443, -10.144, -9.147, -0.105 ], "frame": { "rmsd": null, "origin": [ 20.033, 65.189, 29.223 ], "x_axis": [ -0.097, 0.179, 0.979 ], "y_axis": [ 0.786, 0.617, -0.035 ], "z_axis": [ -0.610, 0.766, -0.200 ], "quaternion": [ 0.574, -0.349, -0.692, -0.264 ] } }, { "index": 110, "nt1": "///Q/67", "nt2": "///Q/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -153.373, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.004, "chi2": -166.941, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.124, "C1C1_dist": 10.562, "N1N9_dist": 8.871, "C6C8_dist": 9.794, "CNNC_torsion": -16.073, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.88]", "interBase_angle": 16.029, "planarity": 0.218, "simple_Shear": -0.525, "simple_Stretch": -0.205, "simple_Buckle": 3.996, "simple_Propeller": -15.523, "bp_simpleParams": [ -0.525, -0.205, 0.257, 3.996, -15.523, -0.608 ], "bp_params": [ -0.514, -0.231, 0.257, 4.760, -15.306, -0.613 ], "frame": { "rmsd": null, "origin": [ 17.755, 67.089, 29.677 ], "x_axis": [ 0.411, 0.297, 0.862 ], "y_axis": [ 0.693, 0.514, -0.506 ], "z_axis": [ -0.593, 0.805, 0.005 ], "quaternion": [ 0.695, -0.472, -0.524, -0.143 ] } }, { "index": 111, "nt1": "///Q/67", "nt2": "///Q/86", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "t.W", "DSSR": "t.+W", "intra_chain": true, "chi1": -153.373, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 78.119, "chi2": -139.204, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.601, "C1C1_dist": 12.625, "N1N9_dist": 11.551, "C6C8_dist": 13.197, "CNNC_torsion": 151.240, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N1[3.71]", "interBase_angle": 36.704, "planarity": 0.415, "simple_Shear": 4.455, "simple_Stretch": 4.832, "simple_Buckle": 21.694, "simple_Propeller": -29.607, "bp_simpleParams": [ 4.455, 4.832, 0.539, 21.694, -29.607, -150.167 ], "bp_params": [ 2.200, -6.193, 0.539, -36.331, -5.217, -148.705 ], "frame": { "rmsd": null, "origin": [ 15.796, 66.217, 26.816 ], "x_axis": [ 0.759, 0.599, -0.256 ], "y_axis": [ -0.328, 0.011, -0.945 ], "z_axis": [ -0.563, 0.800, 0.205 ], "quaternion": [ 0.703, -0.621, -0.109, 0.330 ] } }, { "index": 112, "nt1": "///Q/68", "nt2": "///Q/82", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.653, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.856, "chi2": -168.683, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.860, "C1C1_dist": 10.623, "N1N9_dist": 8.970, "C6C8_dist": 9.985, "CNNC_torsion": -19.937, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.24],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.65]", "interBase_angle": 20.918, "planarity": 0.266, "simple_Shear": -0.152, "simple_Stretch": -0.028, "simple_Buckle": -3.541, "simple_Propeller": -20.616, "bp_simpleParams": [ -0.152, -0.028, 0.364, -3.541, -20.616, 4.453 ], "bp_params": [ -0.152, -0.029, 0.364, -3.350, -20.648, 4.524 ], "frame": { "rmsd": null, "origin": [ 15.315, 69.368, 31.759 ], "x_axis": [ 0.770, 0.441, 0.461 ], "y_axis": [ 0.332, 0.340, -0.880 ], "z_axis": [ -0.544, 0.831, 0.115 ], "quaternion": [ 0.746, -0.573, -0.337, 0.036 ] } }, { "index": 113, "nt1": "///Q/68", "nt2": "///Q/87", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -173.653, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 86.746, "chi2": -116.133, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.174, "C1C1_dist": 8.060, "N1N9_dist": 7.704, "C6C8_dist": 9.945, "CNNC_torsion": 159.502, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.73],N2(amino)-N3[3.09]", "interBase_angle": 32.708, "planarity": 0.374, "simple_Shear": 7.151, "simple_Stretch": 3.565, "simple_Buckle": 29.022, "simple_Propeller": -15.083, "bp_simpleParams": [ 7.151, 3.565, 1.135, 29.022, -15.083, -154.437 ], "bp_params": [ -2.917, -7.438, 1.135, -31.593, -8.468, -153.534 ], "frame": { "rmsd": null, "origin": [ 13.412, 68.441, 28.269 ], "x_axis": [ 0.511, 0.361, -0.780 ], "y_axis": [ -0.736, -0.286, -0.614 ], "z_axis": [ -0.444, 0.888, 0.120 ], "quaternion": [ 0.580, -0.647, 0.145, 0.473 ] } }, { "index": 114, "nt1": "///Q/69", "nt2": "///Q/81", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.142, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.363, "chi2": -152.240, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.369, "C1C1_dist": 10.794, "N1N9_dist": 9.022, "C6C8_dist": 9.913, "CNNC_torsion": -10.790, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.06],O4(carbonyl)-N6(amino)[3.02]", "interBase_angle": 20.061, "planarity": 0.284, "simple_Shear": -0.194, "simple_Stretch": 0.005, "simple_Buckle": -9.215, "simple_Propeller": -17.820, "bp_simpleParams": [ -0.194, 0.005, -0.524, -9.215, -17.820, -0.133 ], "bp_params": [ -0.194, 0.002, -0.524, -8.865, -17.996, -0.135 ], "frame": { "rmsd": null, "origin": [ 12.440, 71.126, 33.813 ], "x_axis": [ 0.845, 0.528, -0.088 ], "y_axis": [ -0.189, 0.141, -0.972 ], "z_axis": [ -0.500, 0.838, 0.219 ], "quaternion": [ 0.742, -0.609, -0.139, 0.241 ] } }, { "index": 115, "nt1": "///Q/70", "nt2": "///Q/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.482, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.574, "chi2": -156.227, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.252, "C1C1_dist": 10.610, "N1N9_dist": 8.993, "C6C8_dist": 10.016, "CNNC_torsion": -10.812, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.02],O4(carbonyl)-N6(amino)[3.25]", "interBase_angle": 10.754, "planarity": 0.136, "simple_Shear": 0.058, "simple_Stretch": 0.084, "simple_Buckle": -2.738, "simple_Propeller": -10.399, "bp_simpleParams": [ 0.058, 0.084, 0.195, -2.738, -10.399, 3.490 ], "bp_params": [ 0.058, 0.084, 0.195, -2.760, -10.394, 3.503 ], "frame": { "rmsd": null, "origin": [ 11.719, 74.281, 34.805 ], "x_axis": [ 0.658, 0.411, -0.631 ], "y_axis": [ -0.605, -0.210, -0.768 ], "z_axis": [ -0.448, 0.887, 0.110 ], "quaternion": [ 0.624, -0.663, 0.073, 0.407 ] } }, { "index": 116, "nt1": "///Q/71", "nt2": "///Q/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.460, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.071, "chi2": -168.087, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.608, "C1C1_dist": 10.602, "N1N9_dist": 9.007, "C6C8_dist": 10.038, "CNNC_torsion": -13.078, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.29],N1(imino)-N3[3.05],N2(amino)-O2(carbonyl)[2.67]", "interBase_angle": 14.414, "planarity": 0.198, "simple_Shear": 0.100, "simple_Stretch": 0.055, "simple_Buckle": 11.928, "simple_Propeller": -8.093, "bp_simpleParams": [ 0.100, 0.055, 0.788, 11.928, -8.093, 4.199 ], "bp_params": [ 0.100, 0.054, 0.788, 11.847, -8.211, 4.188 ], "frame": { "rmsd": null, "origin": [ 11.792, 77.282, 35.341 ], "x_axis": [ 0.365, 0.110, -0.925 ], "y_axis": [ -0.852, -0.362, -0.379 ], "z_axis": [ -0.377, 0.926, -0.038 ], "quaternion": [ -0.491, 0.664, -0.279, -0.490 ] } }, { "index": 117, "nt1": "///Q/73", "nt2": "///Q/141", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.415, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.298, "chi2": -127.971, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.957, "C1C1_dist": 11.223, "N1N9_dist": 9.418, "C6C8_dist": 10.268, "CNNC_torsion": 5.889, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.32],O4(carbonyl)-N6(amino)[3.24]", "interBase_angle": 6.188, "planarity": 0.147, "simple_Shear": -0.650, "simple_Stretch": 0.353, "simple_Buckle": -5.818, "simple_Propeller": 2.106, "bp_simpleParams": [ -0.650, 0.353, -0.455, -5.818, 2.106, -4.083 ], "bp_params": [ -0.673, 0.308, -0.455, -5.951, 1.697, -4.078 ], "frame": { "rmsd": null, "origin": [ 2.074, 90.133, 29.552 ], "x_axis": [ 0.232, 0.145, 0.962 ], "y_axis": [ -0.480, -0.843, 0.243 ], "z_axis": [ 0.846, -0.518, -0.126 ], "quaternion": [ 0.256, 0.742, -0.113, 0.609 ] } }, { "index": 118, "nt1": "///Q/74", "nt2": "///Q/140", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.521, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.450, "chi2": -165.263, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.573, "C1C1_dist": 10.798, "N1N9_dist": 9.212, "C6C8_dist": 10.294, "CNNC_torsion": -11.065, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[3.28],N3-N2(amino)[2.83]", "interBase_angle": 14.200, "planarity": 0.178, "simple_Shear": -1.027, "simple_Stretch": 0.362, "simple_Buckle": 2.323, "simple_Propeller": -14.009, "bp_simpleParams": [ -1.027, 0.362, 0.211, 2.323, -14.009, 7.703 ], "bp_params": [ -1.061, 0.246, 0.211, 3.844, -13.670, 7.754 ], "frame": { "rmsd": null, "origin": [ 5.529, 89.698, 30.414 ], "x_axis": [ -0.201, -0.194, 0.960 ], "y_axis": [ -0.586, -0.761, -0.277 ], "z_axis": [ 0.785, -0.619, 0.039 ], "quaternion": [ 0.139, 0.617, -0.316, 0.707 ] } }, { "index": 119, "nt1": "///Q/75", "nt2": "///Q/139", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.445, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.012, "chi2": -150.220, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.796, "C1C1_dist": 11.240, "N1N9_dist": 9.503, "C6C8_dist": 10.421, "CNNC_torsion": -10.326, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.61],N1-N3(imino)[3.54]", "interBase_angle": 20.748, "planarity": 0.234, "simple_Shear": -0.500, "simple_Stretch": 0.527, "simple_Buckle": -11.775, "simple_Propeller": -17.082, "bp_simpleParams": [ -0.500, 0.527, -0.426, -11.775, -17.082, 0.829 ], "bp_params": [ -0.520, 0.507, -0.426, -11.070, -17.548, 0.835 ], "frame": { "rmsd": null, "origin": [ 8.814, 88.339, 31.324 ], "x_axis": [ -0.731, -0.355, 0.582 ], "y_axis": [ -0.293, -0.607, -0.739 ], "z_axis": [ 0.616, -0.711, 0.340 ], "quaternion": [ -0.019, 0.366, -0.443, 0.818 ] } }, { "index": 120, "nt1": "///Q/76", "nt2": "///Q/138", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.817, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.474, "chi2": -152.526, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.906, "C1C1_dist": 10.674, "N1N9_dist": 9.106, "C6C8_dist": 10.228, "CNNC_torsion": -7.726, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.19],O4(carbonyl)-N6(amino)[3.61]", "interBase_angle": 13.865, "planarity": 0.183, "simple_Shear": -0.120, "simple_Stretch": 0.315, "simple_Buckle": -1.913, "simple_Propeller": -13.732, "bp_simpleParams": [ -0.120, 0.315, -0.319, -1.913, -13.732, 9.746 ], "bp_params": [ -0.125, 0.313, -0.319, -1.666, -13.764, 9.816 ], "frame": { "rmsd": null, "origin": [ 10.804, 86.736, 33.117 ], "x_axis": [ -0.818, -0.575, 0.002 ], "y_axis": [ 0.182, -0.263, -0.947 ], "z_axis": [ 0.545, -0.775, 0.320 ], "quaternion": [ -0.244, 0.177, -0.556, 0.775 ] } }, { "index": 121, "nt1": "///Q/77", "nt2": "///Q/137", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.783, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 62.132, "chi2": -177.767, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.290, "C1C1_dist": 10.602, "N1N9_dist": 9.043, "C6C8_dist": 10.125, "CNNC_torsion": -4.815, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.71],N3-N1(imino)[3.18],N4(amino)-O6(carbonyl)[3.49]", "interBase_angle": 5.651, "planarity": 0.078, "simple_Shear": 0.848, "simple_Stretch": 0.159, "simple_Buckle": -1.178, "simple_Propeller": -5.527, "bp_simpleParams": [ 0.848, 0.159, 0.205, -1.178, -5.527, 7.781 ], "bp_params": [ 0.858, 0.091, 0.205, -1.614, -5.416, 7.789 ], "frame": { "rmsd": null, "origin": [ 11.507, 83.953, 35.142 ], "x_axis": [ -0.596, -0.541, -0.593 ], "y_axis": [ 0.615, 0.167, -0.771 ], "z_axis": [ 0.516, -0.824, 0.233 ], "quaternion": [ -0.448, -0.030, -0.619, 0.645 ] } }, { "index": 122, "nt1": "///Q/78", "nt2": "///Q/136", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 171.607, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.874, "chi2": -161.272, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.544, "C1C1_dist": 11.281, "N1N9_dist": 9.231, "C6C8_dist": 9.818, "CNNC_torsion": -8.040, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.59],N1-N3(imino)[3.05]", "interBase_angle": 19.194, "planarity": 0.211, "simple_Shear": 0.183, "simple_Stretch": -0.023, "simple_Buckle": -8.017, "simple_Propeller": -17.440, "bp_simpleParams": [ 0.183, -0.023, -0.521, -8.017, -17.440, -13.075 ], "bp_params": [ 0.183, -0.028, -0.521, -8.442, -17.238, -13.188 ], "frame": { "rmsd": null, "origin": [ 12.001, 80.872, 37.253 ], "x_axis": [ -0.349, -0.194, -0.917 ], "y_axis": [ 0.889, 0.241, -0.389 ], "z_axis": [ 0.296, -0.951, 0.088 ], "quaternion": [ 0.495, 0.284, 0.613, -0.547 ] } }, { "index": 123, "nt1": "///Q/83", "nt2": "///Q/86", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": true, "chi1": -166.941, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 154.243, "chi2": -139.204, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 96.755, "C1C1_dist": 5.432, "N1N9_dist": 7.039, "C6C8_dist": 9.498, "CNNC_torsion": -27.566, "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-N3[2.47]", "interBase_angle": 23.064, "planarity": 0.362, "simple_Shear": 0.788, "simple_Stretch": 6.980, "simple_Buckle": -21.209, "simple_Propeller": -9.062, "bp_simpleParams": [ 0.788, 6.980, -1.340, -21.209, -9.062, 150.817 ], "bp_params": [ 2.513, 6.559, -1.340, -22.816, -3.376, 150.267 ], "frame": { "rmsd": null, "origin": [ 16.058, 66.249, 26.978 ], "x_axis": [ 0.800, 0.535, -0.271 ], "y_axis": [ 0.385, -0.110, 0.916 ], "z_axis": [ 0.461, -0.837, -0.294 ], "quaternion": [ 0.591, 0.742, 0.310, 0.064 ] } }, { "index": 124, "nt1": "///Q/88", "nt2": "///Q/134", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 171.973, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.428, "chi2": -166.727, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 66.808, "C1C1_dist": 10.721, "N1N9_dist": 9.070, "C6C8_dist": 9.982, "CNNC_torsion": -8.210, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.21],N1(imino)-O2(carbonyl)[3.06]", "interBase_angle": 13.316, "planarity": 0.154, "simple_Shear": -2.038, "simple_Stretch": 0.216, "simple_Buckle": -11.527, "simple_Propeller": -6.666, "bp_simpleParams": [ -2.038, 0.216, -0.070, -11.527, -6.666, 0.086 ], "bp_params": [ -2.041, -0.186, -0.070, -10.014, -8.777, 0.086 ], "frame": { "rmsd": null, "origin": [ 0.229, 70.008, 38.216 ], "x_axis": [ -0.652, 0.018, -0.758 ], "y_axis": [ 0.737, -0.221, -0.639 ], "z_axis": [ -0.179, -0.975, 0.131 ], "quaternion": [ -0.254, -0.331, -0.570, 0.708 ] } }, { "index": 125, "nt1": "///Q/89", "nt2": "///Q/133", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.454, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.366, "chi2": -165.138, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.674, "C1C1_dist": 10.779, "N1N9_dist": 9.086, "C6C8_dist": 10.019, "CNNC_torsion": -7.173, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.13],N3-N1(imino)[3.22],N4(amino)-O6(carbonyl)[3.23]", "interBase_angle": 11.277, "planarity": 0.156, "simple_Shear": 1.041, "simple_Stretch": 0.040, "simple_Buckle": -2.089, "simple_Propeller": -11.082, "bp_simpleParams": [ 1.041, 0.040, -0.037, -2.089, -11.082, 0.232 ], "bp_params": [ 1.039, -0.066, -0.037, -3.192, -10.816, 0.233 ], "frame": { "rmsd": null, "origin": [ -1.528, 67.279, 40.057 ], "x_axis": [ 0.000, -0.133, -0.991 ], "y_axis": [ 0.987, -0.161, 0.022 ], "z_axis": [ -0.163, -0.978, 0.131 ], "quaternion": [ -0.493, -0.508, -0.420, 0.568 ] } }, { "index": 126, "nt1": "///Q/90", "nt2": "///Q/132", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.690, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.426, "chi2": -164.149, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.236, "C1C1_dist": 10.543, "N1N9_dist": 8.948, "C6C8_dist": 10.004, "CNNC_torsion": -10.614, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.02],O4(carbonyl)-N6(amino)[3.36]", "interBase_angle": 14.227, "planarity": 0.188, "simple_Shear": -0.591, "simple_Stretch": 0.137, "simple_Buckle": 8.185, "simple_Propeller": -11.636, "bp_simpleParams": [ -0.591, 0.137, 0.171, 8.185, -11.636, 5.530 ], "bp_params": [ -0.599, 0.097, 0.171, 8.951, -11.058, 5.539 ], "frame": { "rmsd": null, "origin": [ -3.658, 64.597, 39.963 ], "x_axis": [ 0.371, -0.098, -0.923 ], "y_axis": [ 0.921, -0.084, 0.379 ], "z_axis": [ -0.115, -0.992, 0.059 ], "quaternion": [ 0.580, 0.591, 0.348, -0.439 ] } }, { "index": 127, "nt1": "///Q/91", "nt2": "///Q/131", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.238, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.221, "chi2": -158.440, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.414, "C1C1_dist": 10.679, "N1N9_dist": 8.989, "C6C8_dist": 10.006, "CNNC_torsion": -12.882, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.00],O4(carbonyl)-N6(amino)[3.22]", "interBase_angle": 17.720, "planarity": 0.217, "simple_Shear": -0.182, "simple_Stretch": 0.075, "simple_Buckle": 0.732, "simple_Propeller": -17.705, "bp_simpleParams": [ -0.182, 0.075, -0.264, 0.732, -17.705, 4.513 ], "bp_params": [ -0.184, 0.070, -0.264, 1.137, -17.683, 4.567 ], "frame": { "rmsd": null, "origin": [ -4.992, 61.292, 38.964 ], "x_axis": [ 0.838, 0.027, -0.545 ], "y_axis": [ 0.545, -0.114, 0.831 ], "z_axis": [ -0.040, -0.993, -0.110 ], "quaternion": [ 0.635, 0.718, 0.199, -0.204 ] } }, { "index": 128, "nt1": "///Q/92", "nt2": "///Q/130", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.699, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.919, "chi2": -165.607, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.723, "C1C1_dist": 10.539, "N1N9_dist": 8.922, "C6C8_dist": 9.928, "CNNC_torsion": -13.159, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[3.10]", "interBase_angle": 14.591, "planarity": 0.180, "simple_Shear": -0.348, "simple_Stretch": 0.005, "simple_Buckle": -5.427, "simple_Propeller": -13.544, "bp_simpleParams": [ -0.348, 0.005, 0.187, -5.427, -13.544, 2.411 ], "bp_params": [ -0.348, -0.008, 0.187, -4.902, -13.743, 2.426 ], "frame": { "rmsd": null, "origin": [ -4.951, 58.142, 37.196 ], "x_axis": [ 0.992, 0.126, 0.003 ], "y_axis": [ 0.008, -0.085, 0.996 ], "z_axis": [ 0.125, -0.988, -0.085 ], "quaternion": [ 0.675, 0.735, 0.045, 0.043 ] } }, { "index": 129, "nt1": "///Q/93", "nt2": "///Q/129", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.220, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 67.894, "chi2": -172.669, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.041, "C1C1_dist": 10.442, "N1N9_dist": 8.803, "C6C8_dist": 9.654, "CNNC_torsion": -14.408, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.82],N3(imino)-O6(carbonyl)[2.84]", "interBase_angle": 10.437, "planarity": 0.172, "simple_Shear": 2.513, "simple_Stretch": -0.027, "simple_Buckle": -4.291, "simple_Propeller": -9.514, "bp_simpleParams": [ 2.513, -0.027, 0.722, -4.291, -9.514, -3.558 ], "bp_params": [ 2.426, -0.655, 0.722, -6.529, -8.143, -3.562 ], "frame": { "rmsd": null, "origin": [ -4.118, 55.053, 35.558 ], "x_axis": [ 0.734, 0.110, 0.670 ], "y_axis": [ -0.660, -0.118, 0.742 ], "z_axis": [ 0.160, -0.987, -0.014 ], "quaternion": [ 0.633, 0.683, -0.202, 0.304 ] } }, { "index": 130, "nt1": "///Q/94", "nt2": "///Q/128", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -145.117, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.624, "chi2": -156.524, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.476, "C1C1_dist": 10.457, "N1N9_dist": 8.792, "C6C8_dist": 9.781, "CNNC_torsion": -12.293, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.99],N1-N3(imino)[2.83]", "interBase_angle": 17.667, "planarity": 0.213, "simple_Shear": -0.100, "simple_Stretch": -0.150, "simple_Buckle": -1.933, "simple_Propeller": -17.561, "bp_simpleParams": [ -0.100, -0.150, -0.199, -1.933, -17.561, 2.502 ], "bp_params": [ -0.100, -0.151, -0.199, -1.838, -17.572, 2.531 ], "frame": { "rmsd": null, "origin": [ -2.231, 52.605, 34.356 ], "x_axis": [ 0.344, 0.123, 0.931 ], "y_axis": [ -0.864, -0.346, 0.365 ], "z_axis": [ 0.367, -0.930, -0.013 ], "quaternion": [ 0.496, 0.652, -0.284, 0.497 ] } }, { "index": 131, "nt1": "///Q/95", "nt2": "///Q/127", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.365, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.355, "chi2": -168.826, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.660, "C1C1_dist": 10.591, "N1N9_dist": 8.847, "C6C8_dist": 9.787, "CNNC_torsion": -14.203, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[3.00]", "interBase_angle": 13.803, "planarity": 0.175, "simple_Shear": 0.603, "simple_Stretch": -0.210, "simple_Buckle": 1.142, "simple_Propeller": -13.755, "bp_simpleParams": [ 0.603, -0.210, 0.165, 1.142, -13.755, 1.057 ], "bp_params": [ 0.591, -0.243, 0.165, 0.373, -13.798, 1.064 ], "frame": { "rmsd": null, "origin": [ 0.204, 50.140, 34.890 ], "x_axis": [ -0.219, -0.017, 0.976 ], "y_axis": [ -0.907, -0.366, -0.210 ], "z_axis": [ 0.361, -0.930, 0.065 ], "quaternion": [ 0.346, 0.520, -0.444, 0.642 ] } }, { "index": 132, "nt1": "///Q/96", "nt2": "///Q/126", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.066, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 62.619, "chi2": -168.859, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.730, "C1C1_dist": 10.582, "N1N9_dist": 8.808, "C6C8_dist": 9.555, "CNNC_torsion": -9.450, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.89],N3(imino)-O6(carbonyl)[2.71]", "interBase_angle": 9.966, "planarity": 0.124, "simple_Shear": 2.096, "simple_Stretch": -0.194, "simple_Buckle": 3.729, "simple_Propeller": -9.242, "bp_simpleParams": [ 2.096, -0.194, 0.068, 3.729, -9.242, -8.456 ], "bp_params": [ 2.012, -0.621, 0.068, 1.741, -9.813, -8.486 ], "frame": { "rmsd": null, "origin": [ 2.942, 47.766, 35.584 ], "x_axis": [ -0.732, -0.126, 0.670 ], "y_axis": [ -0.598, -0.354, -0.719 ], "z_axis": [ 0.328, -0.927, 0.184 ], "quaternion": [ 0.157, 0.331, -0.546, 0.753 ] } }, { "index": 133, "nt1": "///Q/99", "nt2": "///Q/122", "bp": "A-C", "name": "~rHoogsteen", "Saenger": "25-XXV", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -149.989, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 9.623, "chi2": -155.288, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 23.789, "C1C1_dist": 11.197, "N1N9_dist": 8.438, "C6C8_dist": 7.297, "CNNC_torsion": 173.806, "hbonds_num": 2, "hbonds_desc": "N7-N4(amino)[3.04],N6(amino)-N3[3.09]", "interBase_angle": 12.596, "planarity": 0.137, "simple_Shear": -2.912, "simple_Stretch": 1.270, "simple_Buckle": -4.447, "simple_Propeller": -11.785, "bp_simpleParams": [ -2.912, 1.270, -0.509, -4.447, -11.785, -95.331 ], "bp_params": [ -3.173, -0.175, -0.509, 1.340, -12.524, -95.669 ], "frame": { "rmsd": null, "origin": [ 4.893, 32.283, 39.063 ], "x_axis": [ -0.876, -0.028, -0.481 ], "y_axis": [ 0.481, -0.037, -0.876 ], "z_axis": [ 0.006, -0.999, 0.046 ], "quaternion": [ -0.182, -0.169, -0.670, 0.700 ] } }, { "index": 134, "nt1": "///Q/100", "nt2": "///Q/121", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -168.070, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 19.669, "chi2": -161.882, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 25.757, "C1C1_dist": 12.147, "N1N9_dist": 9.521, "C6C8_dist": 8.159, "CNNC_torsion": 141.503, "hbonds_num": 2, "hbonds_desc": "N7-N6(amino)[3.13],N6(amino)-N1[2.97]", "interBase_angle": 19.736, "planarity": 0.254, "simple_Shear": -3.123, "simple_Stretch": 3.234, "simple_Buckle": 6.696, "simple_Propeller": -18.566, "bp_simpleParams": [ -3.123, 3.234, -0.407, 6.696, -18.566, -106.148 ], "bp_params": [ -4.377, 1.025, -0.407, 15.662, -12.009, -105.933 ], "frame": { "rmsd": null, "origin": [ 4.284, 29.481, 40.255 ], "x_axis": [ -0.565, -0.155, -0.810 ], "y_axis": [ 0.823, -0.042, -0.566 ], "z_axis": [ 0.054, -0.987, 0.152 ], "quaternion": [ -0.369, -0.285, -0.586, 0.663 ] } }, { "index": 135, "nt1": "///Q/101", "nt2": "///Q/120", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "t.W", "DSSR": "t.-W", "intra_chain": true, "chi1": -176.915, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 7.548, "chi2": -149.491, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.876, "C1C1_dist": 13.140, "N1N9_dist": 10.782, "C6C8_dist": 10.350, "CNNC_torsion": 113.445, "hbonds_num": 2, "hbonds_desc": "O4(carbonyl)-N1(imino)[3.05],O4(carbonyl)-N2(amino)[2.73]", "interBase_angle": 20.409, "planarity": 0.226, "simple_Shear": -4.380, "simple_Stretch": 2.994, "simple_Buckle": 8.972, "simple_Propeller": -18.332, "bp_simpleParams": [ -4.380, 2.994, -0.379, 8.972, -18.332, -60.648 ], "bp_params": [ -5.297, 0.295, -0.379, 17.136, -11.086, -60.325 ], "frame": { "rmsd": null, "origin": [ 1.592, 25.994, 39.722 ], "x_axis": [ -0.079, -0.059, -0.995 ], "y_axis": [ 0.992, 0.090, -0.084 ], "z_axis": [ 0.095, -0.994, 0.052 ], "quaternion": [ 0.515, 0.441, 0.528, -0.510 ] } }, { "index": 136, "nt1": "///Q/102", "nt2": "///Q/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.131, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.121, "chi2": -149.108, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.818, "C1C1_dist": 10.696, "N1N9_dist": 8.948, "C6C8_dist": 9.854, "CNNC_torsion": -11.357, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.83],N3-N1(imino)[2.95],N4(amino)-O6(carbonyl)[3.04]", "interBase_angle": 20.849, "planarity": 0.250, "simple_Shear": 0.115, "simple_Stretch": -0.058, "simple_Buckle": 15.265, "simple_Propeller": -14.201, "bp_simpleParams": [ 0.115, -0.058, 0.034, 15.265, -14.201, 0.351 ], "bp_params": [ 0.116, -0.058, 0.034, 15.293, -14.171, 0.351 ], "frame": { "rmsd": null, "origin": [ 1.664, 22.457, 36.467 ], "x_axis": [ 0.716, 0.240, -0.655 ], "y_axis": [ 0.650, 0.113, 0.752 ], "z_axis": [ 0.255, -0.964, -0.075 ], "quaternion": [ 0.662, 0.648, 0.344, -0.155 ] } }, { "index": 137, "nt1": "///Q/103", "nt2": "///Q/118", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.796, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.817, "chi2": -168.543, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.040, "C1C1_dist": 10.383, "N1N9_dist": 8.818, "C6C8_dist": 9.870, "CNNC_torsion": -21.280, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.24],N1-N3(imino)[2.91]", "interBase_angle": 24.930, "planarity": 0.306, "simple_Shear": -0.145, "simple_Stretch": -0.048, "simple_Buckle": 3.748, "simple_Propeller": -24.646, "bp_simpleParams": [ -0.145, -0.048, 0.271, 3.748, -24.646, 4.360 ], "bp_params": [ -0.145, -0.050, 0.271, 4.032, -24.601, 4.460 ], "frame": { "rmsd": null, "origin": [ 2.718, 19.655, 34.295 ], "x_axis": [ 0.845, 0.531, -0.071 ], "y_axis": [ 0.141, -0.094, 0.986 ], "z_axis": [ 0.516, -0.842, -0.154 ], "quaternion": [ 0.632, 0.723, 0.232, 0.154 ] } }, { "index": 138, "nt1": "///Q/104", "nt2": "///Q/117", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.851, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 68.610, "chi2": 178.884, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.241, "C1C1_dist": 10.562, "N1N9_dist": 8.996, "C6C8_dist": 10.002, "CNNC_torsion": -12.755, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.94],N3(imino)-O6(carbonyl)[3.29]", "interBase_angle": 15.773, "planarity": 0.207, "simple_Shear": 2.135, "simple_Stretch": 0.246, "simple_Buckle": 0.910, "simple_Propeller": -15.747, "bp_simpleParams": [ 2.135, 0.246, 0.161, 0.910, -15.747, 4.666 ], "bp_params": [ 2.139, -0.206, 0.161, -2.411, -15.587, 4.708 ], "frame": { "rmsd": null, "origin": [ 5.130, 17.453, 32.369 ], "x_axis": [ 0.712, 0.355, 0.606 ], "y_axis": [ -0.425, -0.469, 0.774 ], "z_axis": [ 0.560, -0.808, -0.183 ], "quaternion": [ 0.515, 0.769, -0.023, 0.379 ] } }, { "index": 139, "nt1": "///Q/105", "nt2": "///Q/116", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.232, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.820, "chi2": -157.138, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.909, "C1C1_dist": 10.849, "N1N9_dist": 9.093, "C6C8_dist": 9.964, "CNNC_torsion": -10.366, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.04],O4(carbonyl)-N6(amino)[2.95]", "interBase_angle": 12.825, "planarity": 0.159, "simple_Shear": -0.038, "simple_Stretch": 0.052, "simple_Buckle": -9.393, "simple_Propeller": -8.733, "bp_simpleParams": [ -0.038, 0.052, 0.398, -9.393, -8.733, -3.421 ], "bp_params": [ -0.038, 0.052, 0.398, -9.365, -8.763, -3.419 ], "frame": { "rmsd": null, "origin": [ 7.734, 15.816, 29.096 ], "x_axis": [ 0.450, 0.306, 0.839 ], "y_axis": [ -0.629, -0.558, 0.541 ], "z_axis": [ 0.634, -0.771, -0.059 ], "quaternion": [ 0.457, 0.719, -0.112, 0.512 ] } }, { "index": 140, "nt1": "///Q/106", "nt2": "///Q/115", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.114, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.894, "chi2": -149.257, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.174, "C1C1_dist": 10.598, "N1N9_dist": 9.042, "C6C8_dist": 10.155, "CNNC_torsion": -8.090, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.52],N1-N3(imino)[3.14]", "interBase_angle": 12.760, "planarity": 0.165, "simple_Shear": 0.427, "simple_Stretch": 0.264, "simple_Buckle": -3.255, "simple_Propeller": -12.337, "bp_simpleParams": [ 0.427, 0.264, -0.424, -3.255, -12.337, 9.446 ], "bp_params": [ 0.440, 0.242, -0.424, -3.861, -12.161, 9.494 ], "frame": { "rmsd": null, "origin": [ 10.699, 14.310, 29.231 ], "x_axis": [ -0.061, 0.021, 0.998 ], "y_axis": [ -0.676, -0.736, -0.026 ], "z_axis": [ 0.734, -0.676, 0.059 ], "quaternion": [ 0.256, 0.636, -0.258, 0.681 ] } }, { "index": 141, "nt1": "///Q/107", "nt2": "///Q/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.307, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.232, "chi2": -163.041, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.426, "C1C1_dist": 10.558, "N1N9_dist": 8.898, "C6C8_dist": 9.894, "CNNC_torsion": -13.774, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.21],N1-N3(imino)[2.95]", "interBase_angle": 13.747, "planarity": 0.173, "simple_Shear": -0.081, "simple_Stretch": -0.005, "simple_Buckle": 6.423, "simple_Propeller": -12.154, "bp_simpleParams": [ -0.081, -0.005, 0.185, 6.423, -12.154, 2.789 ], "bp_params": [ -0.081, -0.006, 0.185, 6.492, -12.118, 2.800 ], "frame": { "rmsd": null, "origin": [ 13.560, 12.963, 29.467 ], "x_axis": [ -0.425, -0.316, 0.848 ], "y_axis": [ -0.603, -0.600, -0.525 ], "z_axis": [ 0.675, -0.735, 0.065 ], "quaternion": [ 0.099, 0.527, -0.436, 0.723 ] } }, { "index": 142, "nt1": "///Q/108", "nt2": "///Q/113", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.570, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.907, "chi2": -179.220, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.825, "C1C1_dist": 10.768, "N1N9_dist": 9.013, "C6C8_dist": 9.918, "CNNC_torsion": 0.711, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.98],N1(imino)-N3[2.99],N2(amino)-O2(carbonyl)[2.87]", "interBase_angle": 8.348, "planarity": 0.113, "simple_Shear": -0.335, "simple_Stretch": -0.070, "simple_Buckle": 8.328, "simple_Propeller": -0.579, "bp_simpleParams": [ -0.335, -0.070, 0.055, 8.328, -0.579, -0.741 ], "bp_params": [ -0.333, -0.080, 0.055, 8.341, -0.335, -0.739 ], "frame": { "rmsd": null, "origin": [ 16.296, 11.397, 31.582 ], "x_axis": [ -0.776, -0.444, 0.448 ], "y_axis": [ -0.261, -0.421, -0.869 ], "z_axis": [ 0.574, -0.791, 0.210 ], "quaternion": [ -0.059, 0.330, -0.535, 0.776 ] } }, { "index": 143, "nt1": "///Q/109", "nt2": "///Q/112", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -160.308, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 84.127, "chi2": -127.159, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 19.916, "C1C1_dist": 9.877, "N1N9_dist": 8.564, "C6C8_dist": 8.567, "CNNC_torsion": -151.975, "hbonds_num": 3, "hbonds_desc": "N1(imino)-OP2[3.21],N2(amino)-OP2[2.99],N2(amino)-N7[2.84]", "interBase_angle": 19.812, "planarity": 0.273, "simple_Shear": 8.156, "simple_Stretch": 4.151, "simple_Buckle": 19.398, "simple_Propeller": -4.028, "bp_simpleParams": [ 8.156, 4.151, 0.986, 19.398, -4.028, -40.317 ], "bp_params": [ 7.465, -5.294, 0.986, 5.481, -19.039, -40.792 ], "frame": { "rmsd": null, "origin": [ 21.058, 10.368, 33.872 ], "x_axis": [ -0.762, -0.379, -0.525 ], "y_axis": [ 0.573, -0.018, -0.819 ], "z_axis": [ 0.301, -0.925, 0.231 ], "quaternion": [ -0.335, -0.079, -0.615, 0.709 ] } }, { "index": 144, "nt1": "///G/-1", "nt2": "///H/2", "bp": "A-C", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": false, "chi1": -111.963, "conf1": "anti", "pucker1": "----", "lambda1": 44.798, "chi2": -169.812, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 130.211, "C1C1_dist": 8.646, "N1N9_dist": 8.590, "C6C8_dist": 10.134, "CNNC_torsion": 15.675, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.88],N1-O2'(hydroxyl)[2.85]", "interBase_angle": 16.518, "planarity": 0.224, "simple_Shear": -5.179, "simple_Stretch": 3.559, "simple_Buckle": 15.833, "simple_Propeller": 4.709, "bp_simpleParams": [ -5.179, 3.559, -0.415, 15.833, 4.709, 64.743 ], "bp_params": [ -6.278, -0.283, -0.415, 9.814, 13.287, 64.903 ], "frame": { "rmsd": null, "origin": [ 17.007, 26.211, 85.977 ], "x_axis": [ -0.298, 0.248, 0.922 ], "y_axis": [ -0.941, 0.086, -0.328 ], "z_axis": [ -0.161, -0.965, 0.208 ], "quaternion": [ 0.499, 0.319, -0.542, 0.596 ] } }, { "index": 145, "nt1": "///G/-1", "nt2": "///S/56", "bp": "A+G", "name": "--", "Saenger": "--", "LW": "cH.", "DSSR": "cM+.", "intra_chain": false, "chi1": -111.963, "conf1": "anti", "pucker1": "----", "lambda1": 13.137, "chi2": -155.682, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 98.185, "C1C1_dist": 12.371, "N1N9_dist": 11.230, "C6C8_dist": 11.518, "CNNC_torsion": -18.262, "hbonds_num": 1, "hbonds_desc": "N6(amino)*N2(amino)[3.15]", "interBase_angle": 27.563, "planarity": 0.378, "simple_Shear": 0.031, "simple_Stretch": 6.312, "simple_Buckle": 18.396, "simple_Propeller": -20.526, "bp_simpleParams": [ 0.031, 6.312, -0.078, 18.396, -20.526, 63.608 ], "bp_params": [ -6.312, -0.066, -0.078, 20.262, 18.686, 63.496 ], "frame": { "rmsd": null, "origin": [ 17.054, 26.229, 85.999 ], "x_axis": [ -0.322, 0.203, 0.925 ], "y_axis": [ -0.919, 0.169, -0.357 ], "z_axis": [ -0.229, -0.965, 0.132 ], "quaternion": [ -0.495, -0.307, 0.583, -0.567 ] } }, { "index": 146, "nt1": "///G/0", "nt2": "///R/57", "bp": "a+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": false, "chi1": -123.764, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 64.896, "chi2": -178.451, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 87.430, "C1C1_dist": 8.196, "N1N9_dist": 7.987, "C6C8_dist": 10.317, "CNNC_torsion": 156.250, "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.72],N3-N2(amino)[3.22]", "interBase_angle": 27.105, "planarity": 0.313, "simple_Shear": 7.266, "simple_Stretch": 3.875, "simple_Buckle": 17.621, "simple_Propeller": -20.595, "bp_simpleParams": [ 7.266, 3.875, -0.566, 17.621, -20.595, 158.342 ], "bp_params": [ 2.916, 7.701, -0.566, 26.818, -3.932, 157.762 ], "frame": { "rmsd": null, "origin": [ 24.863, 19.963, 69.580 ], "x_axis": [ 0.985, -0.106, 0.136 ], "y_axis": [ -0.144, -0.076, 0.987 ], "z_axis": [ -0.094, -0.991, -0.090 ], "quaternion": [ 0.674, 0.733, -0.085, 0.014 ] } }, { "index": 147, "nt1": "///G/1", "nt2": "///R/44", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "tH.", "DSSR": "tM+.", "intra_chain": false, "chi1": -66.612, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 62.950, "chi2": -166.920, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 11.931, "C1C1_dist": 11.102, "N1N9_dist": 9.059, "C6C8_dist": 7.215, "CNNC_torsion": 0.073, "hbonds_num": 1, "hbonds_desc": "N7-N4(amino)[3.83]", "interBase_angle": 34.392, "planarity": 0.431, "simple_Shear": -8.037, "simple_Stretch": 5.132, "simple_Buckle": -26.020, "simple_Propeller": 22.489, "bp_simpleParams": [ -8.037, 5.132, 0.801, -26.020, 22.489, 116.676 ], "bp_params": [ 6.551, -6.930, 0.801, 19.847, -28.088, 117.433 ], "frame": { "rmsd": null, "origin": [ 16.671, 22.913, 61.824 ], "x_axis": [ 0.575, -0.402, -0.712 ], "y_axis": [ -0.784, -0.518, -0.341 ], "z_axis": [ -0.232, 0.755, -0.613 ], "quaternion": [ -0.333, 0.823, -0.360, -0.287 ] } }, { "index": 148, "nt1": "///G/2", "nt2": "///R/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -172.112, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.659, "chi2": -161.574, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.528, "C1C1_dist": 10.542, "N1N9_dist": 8.841, "C6C8_dist": 9.749, "CNNC_torsion": -4.492, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.74],N3-N1(imino)[2.79],N4(amino)-O6(carbonyl)[2.68]", "interBase_angle": 5.354, "planarity": 0.067, "simple_Shear": 0.024, "simple_Stretch": -0.258, "simple_Buckle": 4.813, "simple_Propeller": -2.346, "bp_simpleParams": [ 0.024, -0.258, -0.016, 4.813, -2.346, -1.785 ], "bp_params": [ 0.025, -0.258, -0.016, 4.816, -2.339, -1.784 ], "frame": { "rmsd": null, "origin": [ 26.356, 23.332, 66.705 ], "x_axis": [ -0.204, -0.160, -0.966 ], "y_axis": [ -0.978, 0.082, 0.193 ], "z_axis": [ 0.049, 0.984, -0.174 ], "quaternion": [ 0.420, -0.471, 0.604, 0.487 ] } }, { "index": 149, "nt1": "///G/2", "nt2": "///H/-1", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": false, "chi1": -172.112, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 128.484, "chi2": -105.357, "conf2": "anti", "pucker2": "----", "lambda2": 46.460, "C1C1_dist": 8.701, "N1N9_dist": 8.659, "C6C8_dist": 10.217, "CNNC_torsion": 19.571, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.90],O2(carbonyl)-N6(amino)[2.99]", "interBase_angle": 25.928, "planarity": 0.344, "simple_Shear": 5.096, "simple_Stretch": 3.578, "simple_Buckle": -25.074, "simple_Propeller": 6.598, "bp_simpleParams": [ 5.096, 3.578, -0.617, -25.074, 6.598, 63.723 ], "bp_params": [ 6.226, -0.104, -0.617, -16.471, 20.024, 63.987 ], "frame": { "rmsd": null, "origin": [ 25.295, 23.663, 69.544 ], "x_axis": [ 0.381, -0.012, -0.924 ], "y_axis": [ -0.910, 0.170, -0.378 ], "z_axis": [ 0.162, 0.985, 0.053 ], "quaternion": [ 0.633, -0.538, 0.429, 0.354 ] } }, { "index": 150, "nt1": "///G/3", "nt2": "///R/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -165.475, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.481, "chi2": -165.204, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.865, "C1C1_dist": 10.636, "N1N9_dist": 8.823, "C6C8_dist": 9.659, "CNNC_torsion": -4.920, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.76],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.80]", "interBase_angle": 11.063, "planarity": 0.172, "simple_Shear": -0.688, "simple_Stretch": -0.321, "simple_Buckle": 1.636, "simple_Propeller": -10.941, "bp_simpleParams": [ -0.688, -0.321, -0.307, 1.636, -10.941, -1.162 ], "bp_params": [ -0.666, -0.364, -0.307, 2.333, -10.814, -1.167 ], "frame": { "rmsd": null, "origin": [ 28.402, 26.511, 65.794 ], "x_axis": [ -0.659, -0.238, -0.714 ], "y_axis": [ -0.751, 0.145, 0.644 ], "z_axis": [ -0.050, 0.960, -0.274 ], "quaternion": [ 0.230, -0.343, 0.721, 0.557 ] } }, { "index": 151, "nt1": "///G/4", "nt2": "///R/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -167.643, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.213, "chi2": -168.158, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.450, "C1C1_dist": 10.560, "N1N9_dist": 8.866, "C6C8_dist": 9.802, "CNNC_torsion": -12.695, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.60],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 13.870, "planarity": 0.175, "simple_Shear": -0.024, "simple_Stretch": -0.200, "simple_Buckle": 3.530, "simple_Propeller": -13.413, "bp_simpleParams": [ -0.024, -0.200, 0.187, 3.530, -13.413, 0.797 ], "bp_params": [ -0.022, -0.200, 0.187, 3.646, -13.382, 0.802 ], "frame": { "rmsd": null, "origin": [ 29.144, 29.512, 63.769 ], "x_axis": [ -0.949, -0.199, -0.244 ], "y_axis": [ -0.278, 0.163, 0.947 ], "z_axis": [ -0.148, 0.967, -0.209 ], "quaternion": [ 0.032, -0.156, 0.762, 0.628 ] } }, { "index": 152, "nt1": "///G/5", "nt2": "///R/53", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -130.931, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.306, "chi2": -167.812, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.465, "C1C1_dist": 10.759, "N1N9_dist": 8.966, "C6C8_dist": 9.834, "CNNC_torsion": 2.445, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.79],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[2.86]", "interBase_angle": 4.697, "planarity": 0.057, "simple_Shear": 0.367, "simple_Stretch": -0.143, "simple_Buckle": 4.657, "simple_Propeller": -0.618, "bp_simpleParams": [ 0.367, -0.143, -0.094, 4.657, -0.618, -1.314 ], "bp_params": [ 0.363, -0.155, -0.094, 4.634, -0.767, -1.313 ], "frame": { "rmsd": null, "origin": [ 28.527, 32.240, 61.182 ], "x_axis": [ -0.929, -0.225, 0.294 ], "y_axis": [ 0.217, 0.312, 0.925 ], "z_axis": [ -0.300, 0.923, -0.241 ], "quaternion": [ -0.188, -0.002, 0.788, 0.587 ] } }, { "index": 153, "nt1": "///G/7", "nt2": "///R/27", "bp": "G-G", "name": "--", "Saenger": "--", "LW": "tH.", "DSSR": "tM-.", "intra_chain": false, "chi1": 178.808, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 9.402, "chi2": -140.454, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 86.670, "C1C1_dist": 11.571, "N1N9_dist": 10.103, "C6C8_dist": 10.402, "CNNC_torsion": -53.812, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N2(amino)[2.85]", "interBase_angle": 4.480, "planarity": 0.087, "simple_Shear": -6.770, "simple_Stretch": 3.301, "simple_Buckle": -2.288, "simple_Propeller": 3.852, "bp_simpleParams": [ -6.770, 3.301, 0.309, -2.288, 3.852, -16.737 ], "bp_params": [ -7.177, -2.285, 0.309, -4.314, 1.208, -16.726 ], "frame": { "rmsd": null, "origin": [ 28.600, 36.167, 60.902 ], "x_axis": [ -0.153, 0.185, 0.971 ], "y_axis": [ 0.981, 0.147, 0.127 ], "z_axis": [ -0.120, 0.972, -0.204 ], "quaternion": [ -0.444, 0.475, 0.613, 0.448 ] } }, { "index": 154, "nt1": "///G/7", "nt2": "///R/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 178.808, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.075, "chi2": -167.478, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.262, "C1C1_dist": 10.430, "N1N9_dist": 8.803, "C6C8_dist": 9.738, "CNNC_torsion": -12.992, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.23],N1(imino)-N3[3.05],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 32.334, "planarity": 0.401, "simple_Shear": -0.755, "simple_Stretch": 0.037, "simple_Buckle": -28.266, "simple_Propeller": -15.702, "bp_simpleParams": [ -0.755, 0.037, 0.048, -28.266, -15.702, 3.264 ], "bp_params": [ -0.755, -0.004, 0.048, -27.471, -17.054, 3.208 ], "frame": { "rmsd": null, "origin": [ 27.913, 35.468, 57.607 ], "x_axis": [ -0.288, 0.010, 0.958 ], "y_axis": [ 0.891, 0.369, 0.264 ], "z_axis": [ -0.351, 0.929, -0.115 ], "quaternion": [ -0.491, 0.338, 0.666, 0.448 ] } }, { "index": 155, "nt1": "///G/8", "nt2": "///R/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -152.749, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.622, "chi2": -152.923, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.798, "C1C1_dist": 10.651, "N1N9_dist": 8.906, "C6C8_dist": 9.764, "CNNC_torsion": -13.801, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.81],N1-N3(imino)[2.89]", "interBase_angle": 19.020, "planarity": 0.234, "simple_Shear": -0.023, "simple_Stretch": -0.083, "simple_Buckle": 15.857, "simple_Propeller": -10.502, "bp_simpleParams": [ -0.023, -0.083, 0.228, 15.857, -10.502, -3.032 ], "bp_params": [ -0.023, -0.083, 0.228, 15.926, -10.397, -3.016 ], "frame": { "rmsd": null, "origin": [ 27.979, 39.037, 60.385 ], "x_axis": [ 0.766, 0.075, 0.639 ], "y_axis": [ 0.643, -0.127, -0.756 ], "z_axis": [ 0.024, 0.989, -0.146 ], "quaternion": [ 0.611, -0.714, -0.251, -0.232 ] } }, { "index": 156, "nt1": "///G/8", "nt2": "///R/50", "bp": "A+U", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": false, "chi1": -152.749, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 90.276, "chi2": -102.427, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 30.989, "C1C1_dist": 7.753, "N1N9_dist": 6.865, "C6C8_dist": 8.759, "CNNC_torsion": 170.501, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O4(carbonyl)[2.73],N3*O2(carbonyl)[3.17],N3-N3(imino)[3.32]", "unusual_base2base_hbonds": 1, "interBase_angle": 14.767, "planarity": 0.269, "simple_Shear": 5.038, "simple_Stretch": 1.657, "simple_Buckle": -3.997, "simple_Propeller": -14.215, "bp_simpleParams": [ 5.038, 1.657, 1.108, -3.997, -14.215, -122.107 ], "bp_params": [ -1.633, -5.046, 1.108, -9.139, 11.599, -122.200 ], "frame": { "rmsd": null, "origin": [ 27.926, 38.621, 57.737 ], "x_axis": [ 0.916, 0.192, -0.353 ], "y_axis": [ -0.348, -0.059, -0.936 ], "z_axis": [ -0.201, 0.980, 0.013 ], "quaternion": [ 0.684, -0.700, 0.056, 0.198 ] } }, { "index": 157, "nt1": "///G/9", "nt2": "///R/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -147.384, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.102, "chi2": -157.439, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.322, "C1C1_dist": 10.494, "N1N9_dist": 8.874, "C6C8_dist": 9.862, "CNNC_torsion": -24.762, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.22],N1-N3(imino)[3.02]", "interBase_angle": 32.743, "planarity": 0.405, "simple_Shear": -0.196, "simple_Stretch": 0.038, "simple_Buckle": 15.761, "simple_Propeller": -28.700, "bp_simpleParams": [ -0.196, 0.038, 0.031, 15.761, -28.700, 3.483 ], "bp_params": [ -0.197, 0.031, 0.031, 16.532, -28.263, 3.557 ], "frame": { "rmsd": null, "origin": [ 28.028, 42.450, 60.689 ], "x_axis": [ 0.990, -0.088, 0.110 ], "y_axis": [ 0.104, -0.079, -0.991 ], "z_axis": [ 0.096, 0.993, -0.069 ], "quaternion": [ 0.679, -0.731, -0.005, -0.071 ] } }, { "index": 158, "nt1": "///G/10", "nt2": "///R/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -157.608, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.050, "chi2": -166.743, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.723, "C1C1_dist": 10.761, "N1N9_dist": 9.047, "C6C8_dist": 9.928, "CNNC_torsion": -21.091, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.27],N3-N1(imino)[3.00],N4(amino)-O6(carbonyl)[2.92]", "interBase_angle": 31.620, "planarity": 0.373, "simple_Shear": 0.045, "simple_Stretch": -0.076, "simple_Buckle": 8.020, "simple_Propeller": -30.586, "bp_simpleParams": [ 0.045, -0.076, -0.390, 8.020, -30.586, -0.478 ], "bp_params": [ 0.045, -0.076, -0.390, 8.107, -30.563, -0.494 ], "frame": { "rmsd": null, "origin": [ 28.758, 45.736, 61.741 ], "x_axis": [ 0.830, -0.317, -0.458 ], "y_axis": [ -0.466, 0.058, -0.883 ], "z_axis": [ 0.306, 0.947, -0.100 ], "quaternion": [ 0.669, -0.684, 0.286, 0.056 ] } }, { "index": 159, "nt1": "///G/11", "nt2": "///R/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.681, "conf1": "anti", "pucker1": "----", "lambda1": 54.152, "chi2": -166.751, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.922, "C1C1_dist": 10.633, "N1N9_dist": 8.887, "C6C8_dist": 9.736, "CNNC_torsion": -11.715, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.82],O4(carbonyl)-N6(amino)[2.72]", "interBase_angle": 10.631, "planarity": 0.141, "simple_Shear": 0.006, "simple_Stretch": -0.199, "simple_Buckle": -4.405, "simple_Propeller": -9.675, "bp_simpleParams": [ 0.006, -0.199, 0.325, -4.405, -9.675, -4.567 ], "bp_params": [ 0.006, -0.199, 0.325, -4.387, -9.684, -4.580 ], "frame": { "rmsd": null, "origin": [ 30.874, 49.126, 62.504 ], "x_axis": [ 0.419, -0.395, -0.818 ], "y_axis": [ -0.845, 0.160, -0.510 ], "z_axis": [ 0.332, 0.905, -0.267 ], "quaternion": [ 0.572, -0.618, 0.502, 0.197 ] } }, { "index": 160, "nt1": "///G/11", "nt2": "///R/111", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": false, "chi1": -164.681, "conf1": "anti", "pucker1": "----", "lambda1": 153.494, "chi2": -139.658, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 101.233, "C1C1_dist": 5.373, "N1N9_dist": 7.131, "C6C8_dist": 9.695, "CNNC_torsion": -40.403, "hbonds_num": 3, "hbonds_desc": "O3'-O2'(hydroxyl)[2.72],O2'(hydroxyl)-N3[2.60],O2(carbonyl)-N2(amino)[2.77]", "interBase_angle": 22.248, "planarity": 0.307, "simple_Shear": 0.455, "simple_Stretch": 7.856, "simple_Buckle": -9.980, "simple_Propeller": -19.884, "bp_simpleParams": [ 0.455, 7.856, 0.158, -9.980, -19.884, 159.074 ], "bp_params": [ 2.059, 7.595, 0.158, -13.798, -17.452, 159.160 ], "frame": { "rmsd": null, "origin": [ 28.746, 50.199, 65.584 ], "x_axis": [ 0.863, -0.311, 0.397 ], "y_axis": [ 0.356, -0.183, -0.916 ], "z_axis": [ 0.358, 0.933, -0.048 ], "quaternion": [ 0.639, -0.724, -0.015, -0.261 ] } }, { "index": 161, "nt1": "///R/12", "nt2": "///R/22", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 177.200, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.968, "chi2": -158.351, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.197, "C1C1_dist": 11.036, "N1N9_dist": 9.132, "C6C8_dist": 9.868, "CNNC_torsion": -10.216, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.76],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[3.27]", "interBase_angle": 12.691, "planarity": 0.144, "simple_Shear": -0.180, "simple_Stretch": -0.160, "simple_Buckle": -5.289, "simple_Propeller": -11.536, "bp_simpleParams": [ -0.180, -0.160, -0.026, -5.289, -11.536, -9.775 ], "bp_params": [ -0.178, -0.162, -0.026, -5.132, -11.607, -9.815 ], "frame": { "rmsd": null, "origin": [ 33.628, 51.521, 62.220 ], "x_axis": [ -0.034, -0.359, -0.933 ], "y_axis": [ -0.918, 0.380, -0.113 ], "z_axis": [ 0.395, 0.852, -0.343 ], "quaternion": [ 0.501, -0.482, 0.663, 0.279 ] } }, { "index": 162, "nt1": "///R/13", "nt2": "///R/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.633, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.492, "chi2": -143.932, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.552, "C1C1_dist": 10.977, "N1N9_dist": 9.102, "C6C8_dist": 9.787, "CNNC_torsion": -11.996, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.79],N1(imino)-N3[3.14]", "interBase_angle": 42.334, "planarity": 0.464, "simple_Shear": -0.023, "simple_Stretch": -0.093, "simple_Buckle": -23.874, "simple_Propeller": -34.960, "bp_simpleParams": [ -0.023, -0.093, -1.373, -23.874, -34.960, -2.552 ], "bp_params": [ -0.027, -0.092, -1.373, -24.844, -34.278, -2.614 ], "frame": { "rmsd": null, "origin": [ 36.812, 53.907, 60.588 ], "x_axis": [ -0.683, -0.257, -0.683 ], "y_axis": [ -0.644, 0.653, 0.398 ], "z_axis": [ 0.344, 0.713, -0.612 ], "quaternion": [ 0.299, -0.263, 0.858, 0.324 ] } }, { "index": 163, "nt1": "///R/14", "nt2": "///R/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.753, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.212, "chi2": -169.236, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.418, "C1C1_dist": 10.742, "N1N9_dist": 9.163, "C6C8_dist": 10.249, "CNNC_torsion": -12.865, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.86],N3-N1(imino)[3.19],N4(amino)-O6(carbonyl)[3.54]", "interBase_angle": 19.229, "planarity": 0.233, "simple_Shear": -0.160, "simple_Stretch": 0.272, "simple_Buckle": 5.375, "simple_Propeller": -18.462, "bp_simpleParams": [ -0.160, 0.272, -0.087, 5.375, -18.462, 7.742 ], "bp_params": [ -0.167, 0.268, -0.087, 5.781, -18.339, 7.833 ], "frame": { "rmsd": null, "origin": [ 37.558, 55.475, 58.514 ], "x_axis": [ -0.921, 0.072, -0.382 ], "y_axis": [ -0.291, 0.524, 0.801 ], "z_axis": [ 0.258, 0.849, -0.461 ], "quaternion": [ 0.188, -0.064, 0.852, 0.484 ] } }, { "index": 164, "nt1": "///R/15", "nt2": "///R/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.936, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.095, "chi2": -149.239, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.501, "C1C1_dist": 10.959, "N1N9_dist": 9.147, "C6C8_dist": 9.977, "CNNC_torsion": -4.657, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.90],N1-N3(imino)[3.15]", "interBase_angle": 15.747, "planarity": 0.243, "simple_Shear": -0.012, "simple_Stretch": 0.031, "simple_Buckle": 6.001, "simple_Propeller": -14.558, "bp_simpleParams": [ -0.012, 0.031, -0.624, 6.001, -14.558, -3.942 ], "bp_params": [ -0.012, 0.031, -0.624, 5.998, -14.560, -3.969 ], "frame": { "rmsd": null, "origin": [ 38.888, 57.482, 55.668 ], "x_axis": [ -0.984, 0.095, 0.150 ], "y_axis": [ 0.178, 0.512, 0.841 ], "z_axis": [ 0.003, 0.854, -0.520 ], "quaternion": [ -0.042, 0.078, 0.868, 0.488 ] } }, { "index": 165, "nt1": "///R/16", "nt2": "///R/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.979, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.691, "chi2": -171.894, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.356, "C1C1_dist": 10.654, "N1N9_dist": 8.942, "C6C8_dist": 9.871, "CNNC_torsion": -10.621, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.78],N3-N1(imino)[2.96],N4(amino)-O6(carbonyl)[2.98]", "interBase_angle": 10.900, "planarity": 0.150, "simple_Shear": 0.466, "simple_Stretch": -0.144, "simple_Buckle": 2.432, "simple_Propeller": -10.625, "bp_simpleParams": [ 0.466, -0.144, 0.306, 2.432, -10.625, -0.678 ], "bp_params": [ 0.459, -0.163, 0.306, 1.983, -10.718, -0.681 ], "frame": { "rmsd": null, "origin": [ 37.440, 59.864, 53.066 ], "x_axis": [ -0.665, 0.171, 0.727 ], "y_axis": [ 0.737, 0.309, 0.601 ], "z_axis": [ -0.122, 0.935, -0.332 ], "quaternion": [ -0.280, 0.299, 0.759, 0.506 ] } }, { "index": 166, "nt1": "///R/17", "nt2": "///R/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.748, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.846, "chi2": -172.597, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.128, "C1C1_dist": 10.777, "N1N9_dist": 9.164, "C6C8_dist": 10.192, "CNNC_torsion": -8.323, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[3.16],N4(amino)-O6(carbonyl)[3.37]", "interBase_angle": 8.708, "planarity": 0.119, "simple_Shear": 0.101, "simple_Stretch": 0.188, "simple_Buckle": -4.425, "simple_Propeller": -7.500, "bp_simpleParams": [ 0.101, 0.188, 0.332, -4.425, -7.500, 4.854 ], "bp_params": [ 0.102, 0.188, 0.332, -4.467, -7.475, 4.861 ], "frame": { "rmsd": null, "origin": [ 34.908, 62.470, 51.540 ], "x_axis": [ -0.196, 0.229, 0.953 ], "y_axis": [ 0.964, 0.223, 0.144 ], "z_axis": [ -0.180, 0.947, -0.265 ], "quaternion": [ -0.437, 0.460, 0.649, 0.421 ] } }, { "index": 167, "nt1": "///R/17", "nt2": "///R/17", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": true, "chi1": -154.753, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 117.188, "chi2": -91.541, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 89.541, "C1C1_dist": 7.276, "N1N9_dist": 7.967, "C6C8_dist": 10.101, "CNNC_torsion": 14.125, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.40]", "interBase_angle": 65.528, "planarity": 0.621, "simple_Shear": 0.745, "simple_Stretch": 4.319, "simple_Buckle": 56.870, "simple_Propeller": 32.553, "bp_simpleParams": [ 0.745, 4.319, -3.172, 56.870, 32.553, 105.308 ], "bp_params": [ 1.469, 4.129, -3.172, 62.172, 20.700, 97.473 ], "frame": { "rmsd": null, "origin": [ 31.188, 71.109, 54.343 ], "x_axis": [ 0.394, 0.300, 0.869 ], "y_axis": [ 0.899, -0.322, -0.297 ], "z_axis": [ 0.191, 0.898, -0.396 ], "quaternion": [ -0.411, 0.727, 0.412, 0.365 ] } }, { "index": 168, "nt1": "///R/24", "nt2": "///R/112", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -166.743, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 88.705, "chi2": -128.346, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.477, "C1C1_dist": 8.551, "N1N9_dist": 8.222, "C6C8_dist": 10.471, "CNNC_torsion": 160.204, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.71],N2(amino)-N3[2.85]", "interBase_angle": 20.893, "planarity": 0.258, "simple_Shear": 6.797, "simple_Stretch": 3.685, "simple_Buckle": 14.964, "simple_Propeller": -14.580, "bp_simpleParams": [ 6.797, 3.685, -0.092, 14.964, -14.580, -153.921 ], "bp_params": [ -2.222, -7.405, -0.092, -20.892, -0.213, -153.497 ], "frame": { "rmsd": null, "origin": [ 27.019, 47.166, 64.910 ], "x_axis": [ 0.650, -0.123, 0.750 ], "y_axis": [ -0.667, 0.382, 0.640 ], "z_axis": [ -0.365, -0.916, 0.166 ], "quaternion": [ 0.741, 0.525, -0.376, 0.183 ] } }, { "index": 169, "nt1": "///R/27", "nt2": "///R/52", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -140.454, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 146.026, "chi2": -167.478, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 18.011, "C1C1_dist": 8.617, "N1N9_dist": 8.417, "C6C8_dist": 8.874, "CNNC_torsion": 16.467, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N4(amino)[2.86],N3-N4(amino)[3.82]", "interBase_angle": 28.896, "planarity": 0.375, "simple_Shear": 0.462, "simple_Stretch": 6.859, "simple_Buckle": -5.482, "simple_Propeller": -28.371, "bp_simpleParams": [ 0.462, 6.859, 0.106, -5.482, -28.371, -21.064 ], "bp_params": [ 6.381, -2.559, 0.106, -25.339, 13.888, -20.718 ], "frame": { "rmsd": null, "origin": [ 28.502, 36.149, 61.267 ], "x_axis": [ -0.156, 0.074, 0.985 ], "y_axis": [ -0.910, -0.399, -0.114 ], "z_axis": [ 0.385, -0.914, 0.130 ], "quaternion": [ 0.379, 0.528, -0.396, 0.649 ] } }, { "index": 170, "nt1": "///R/28", "nt2": "///R/29", "bp": "A+C", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -79.552, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 142.398, "chi2": -176.599, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 40.305, "C1C1_dist": 6.787, "N1N9_dist": 6.832, "C6C8_dist": 6.875, "CNNC_torsion": 29.406, "hbonds_num": 1, "hbonds_desc": "N3-N4(amino)[2.96]", "interBase_angle": 33.913, "planarity": 0.383, "simple_Shear": -0.140, "simple_Stretch": 7.204, "simple_Buckle": 5.646, "simple_Propeller": 33.440, "bp_simpleParams": [ -0.140, 7.204, -1.787, 5.646, 33.440, 5.572 ], "bp_params": [ 7.182, 0.586, -1.787, 33.742, -3.406, 5.335 ], "frame": { "rmsd": null, "origin": [ 15.738, 25.073, 60.004 ], "x_axis": [ 0.958, -0.060, -0.280 ], "y_axis": [ 0.230, 0.745, 0.626 ], "z_axis": [ 0.171, -0.664, 0.728 ], "quaternion": [ 0.926, 0.348, 0.122, -0.078 ] } }, { "index": 171, "nt1": "///R/29", "nt2": "///R/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.599, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.149, "chi2": 177.097, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.593, "C1C1_dist": 10.656, "N1N9_dist": 8.916, "C6C8_dist": 9.851, "CNNC_torsion": -2.576, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.72],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.96]", "interBase_angle": 16.994, "planarity": 0.177, "simple_Shear": 0.229, "simple_Stretch": -0.089, "simple_Buckle": -14.859, "simple_Propeller": 8.247, "bp_simpleParams": [ 0.229, -0.089, 0.510, -14.859, 8.247, 2.325 ], "bp_params": [ 0.228, -0.092, 0.510, -14.762, 8.419, 2.312 ], "frame": { "rmsd": null, "origin": [ 12.245, 24.666, 61.315 ], "x_axis": [ 0.954, -0.139, -0.266 ], "y_axis": [ 0.256, 0.840, 0.478 ], "z_axis": [ 0.157, -0.524, 0.837 ], "quaternion": [ 0.953, 0.263, 0.111, -0.104 ] } }, { "index": 172, "nt1": "///R/30", "nt2": "///R/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 175.518, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.972, "chi2": -166.920, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.936, "C1C1_dist": 10.716, "N1N9_dist": 8.961, "C6C8_dist": 9.773, "CNNC_torsion": -9.531, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.58],N1(imino)-N3[2.84],N2(amino)-O2(carbonyl)[2.87]", "interBase_angle": 8.671, "planarity": 0.121, "simple_Shear": -0.035, "simple_Stretch": -0.240, "simple_Buckle": 2.626, "simple_Propeller": -8.264, "bp_simpleParams": [ -0.035, -0.240, 0.235, 2.626, -8.264, -5.079 ], "bp_params": [ -0.035, -0.240, 0.235, 2.622, -8.265, -5.091 ], "frame": { "rmsd": null, "origin": [ 12.175, 21.964, 63.247 ], "x_axis": [ 0.983, 0.172, -0.060 ], "y_axis": [ -0.105, 0.805, 0.584 ], "z_axis": [ 0.149, -0.568, 0.809 ], "quaternion": [ 0.948, 0.304, 0.055, 0.073 ] } }, { "index": 173, "nt1": "///R/30", "nt2": "///R/123", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": 175.518, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 100.888, "chi2": -155.109, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.755, "C1C1_dist": 10.080, "N1N9_dist": 9.568, "C6C8_dist": 11.270, "CNNC_torsion": 121.147, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N1[3.13]", "interBase_angle": 60.847, "planarity": 0.845, "simple_Shear": 3.521, "simple_Stretch": 4.813, "simple_Buckle": -37.728, "simple_Propeller": -47.739, "bp_simpleParams": [ 3.521, 4.813, -0.622, -37.728, -47.739, -107.246 ], "bp_params": [ 2.221, -5.535, -0.622, -21.253, 57.015, -113.171 ], "frame": { "rmsd": null, "origin": [ 9.240, 21.742, 63.815 ], "x_axis": [ 0.516, 0.330, 0.790 ], "y_axis": [ -0.857, 0.216, 0.469 ], "z_axis": [ -0.016, -0.919, 0.394 ], "quaternion": [ 0.729, 0.476, -0.276, 0.407 ] } }, { "index": 174, "nt1": "///R/31", "nt2": "///R/43", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.812, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.918, "chi2": -160.566, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.768, "C1C1_dist": 10.642, "N1N9_dist": 8.918, "C6C8_dist": 9.773, "CNNC_torsion": -4.646, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.84],N1-N3(imino)[2.91]", "interBase_angle": 15.719, "planarity": 0.169, "simple_Shear": -0.119, "simple_Stretch": -0.120, "simple_Buckle": -11.477, "simple_Propeller": -10.740, "bp_simpleParams": [ -0.119, -0.120, -0.503, -11.477, -10.740, -3.218 ], "bp_params": [ -0.119, -0.120, -0.503, -11.447, -10.772, -3.216 ], "frame": { "rmsd": null, "origin": [ 13.277, 18.178, 64.753 ], "x_axis": [ 0.712, 0.673, 0.201 ], "y_axis": [ -0.643, 0.510, 0.571 ], "z_axis": [ 0.282, -0.536, 0.796 ], "quaternion": [ 0.869, 0.319, 0.023, 0.379 ] } }, { "index": 175, "nt1": "///R/35", "nt2": "///R/65", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.850, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.214, "chi2": -161.145, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.923, "C1C1_dist": 10.617, "N1N9_dist": 8.823, "C6C8_dist": 9.644, "CNNC_torsion": -10.001, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.52],N1(imino)-N3[2.76],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 10.436, "planarity": 0.138, "simple_Shear": -0.214, "simple_Stretch": -0.358, "simple_Buckle": 1.457, "simple_Propeller": -10.333, "bp_simpleParams": [ -0.214, -0.358, 0.042, 1.457, -10.333, -4.617 ], "bp_params": [ -0.208, -0.362, 0.042, 1.648, -10.305, -4.635 ], "frame": { "rmsd": null, "origin": [ 22.728, -2.687, 71.151 ], "x_axis": [ -0.614, 0.105, -0.782 ], "y_axis": [ -0.546, 0.659, 0.517 ], "z_axis": [ 0.570, 0.745, -0.347 ], "quaternion": [ 0.418, -0.136, 0.809, 0.390 ] } }, { "index": 176, "nt1": "///R/36", "nt2": "///R/64", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.607, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.748, "chi2": -166.936, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.102, "C1C1_dist": 10.901, "N1N9_dist": 9.139, "C6C8_dist": 10.014, "CNNC_torsion": -10.496, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.02],N1(imino)-N3[3.10],N2(amino)-O2(carbonyl)[3.01]", "interBase_angle": 16.557, "planarity": 0.187, "simple_Shear": -0.172, "simple_Stretch": 0.030, "simple_Buckle": -7.292, "simple_Propeller": -14.865, "bp_simpleParams": [ -0.172, 0.030, -0.107, -7.292, -14.865, -1.470 ], "bp_params": [ -0.173, 0.029, -0.107, -7.134, -14.941, -1.479 ], "frame": { "rmsd": null, "origin": [ 25.590, -1.251, 68.768 ], "x_axis": [ -0.879, 0.367, -0.304 ], "y_axis": [ -0.095, 0.491, 0.866 ], "z_axis": [ 0.467, 0.790, -0.397 ], "quaternion": [ 0.232, 0.082, 0.832, 0.498 ] } }, { "index": 177, "nt1": "///R/37", "nt2": "///R/63", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.579, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 42.352, "chi2": -151.126, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 67.705, "C1C1_dist": 10.460, "N1N9_dist": 8.834, "C6C8_dist": 9.745, "CNNC_torsion": -14.030, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.98],N1(imino)-O2(carbonyl)[2.83]", "interBase_angle": 16.524, "planarity": 0.205, "simple_Shear": -2.362, "simple_Stretch": 0.037, "simple_Buckle": -5.795, "simple_Propeller": -15.475, "bp_simpleParams": [ -2.362, 0.037, 0.016, -5.795, -15.475, 0.293 ], "bp_params": [ -2.308, -0.506, 0.016, -2.066, -16.395, 0.296 ], "frame": { "rmsd": null, "origin": [ 26.432, 0.530, 66.207 ], "x_axis": [ -0.911, 0.377, 0.166 ], "y_axis": [ 0.280, 0.273, 0.920 ], "z_axis": [ 0.301, 0.885, -0.354 ], "quaternion": [ 0.042, 0.206, 0.797, 0.567 ] } }, { "index": 178, "nt1": "///R/38", "nt2": "///R/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.582, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.830, "chi2": -155.472, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.258, "C1C1_dist": 10.549, "N1N9_dist": 8.804, "C6C8_dist": 9.669, "CNNC_torsion": -15.426, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.69],N1(imino)-N3[2.76],N2(amino)-O2(carbonyl)[2.70]", "interBase_angle": 20.503, "planarity": 0.234, "simple_Shear": -0.221, "simple_Stretch": -0.301, "simple_Buckle": -10.508, "simple_Propeller": -17.605, "bp_simpleParams": [ -0.221, -0.301, -0.066, -10.508, -17.605, -1.720 ], "bp_params": [ -0.217, -0.303, -0.066, -10.284, -17.737, -1.734 ], "frame": { "rmsd": null, "origin": [ 26.581, 3.545, 63.903 ], "x_axis": [ -0.550, 0.322, 0.770 ], "y_axis": [ 0.811, -0.016, 0.586 ], "z_axis": [ 0.201, 0.946, -0.253 ], "quaternion": [ -0.213, 0.424, 0.668, 0.573 ] } }, { "index": 179, "nt1": "///R/39", "nt2": "///R/61", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.638, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.997, "chi2": -148.947, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.591, "C1C1_dist": 10.514, "N1N9_dist": 8.893, "C6C8_dist": 9.855, "CNNC_torsion": -22.254, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.96],O4(carbonyl)-N6(amino)[3.00]", "interBase_angle": 25.751, "planarity": 0.313, "simple_Shear": -0.313, "simple_Stretch": 0.019, "simple_Buckle": -15.798, "simple_Propeller": -20.336, "bp_simpleParams": [ -0.313, 0.019, 0.211, -15.798, -20.336, 1.001 ], "bp_params": [ -0.314, 0.012, 0.211, -15.304, -20.710, 1.009 ], "frame": { "rmsd": null, "origin": [ 26.171, 6.928, 62.959 ], "x_axis": [ -0.033, 0.122, 0.992 ], "y_axis": [ 0.985, -0.166, 0.053 ], "z_axis": [ 0.171, 0.979, -0.115 ], "quaternion": [ -0.414, 0.559, 0.496, 0.520 ] } }, { "index": 180, "nt1": "///R/40", "nt2": "///R/60", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -151.493, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 66.358, "chi2": -175.998, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 36.481, "C1C1_dist": 10.638, "N1N9_dist": 8.886, "C6C8_dist": 9.646, "CNNC_torsion": -13.885, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.91],N3(imino)-O6(carbonyl)[2.82]", "interBase_angle": 10.273, "planarity": 0.140, "simple_Shear": 2.905, "simple_Stretch": 0.107, "simple_Buckle": -0.583, "simple_Propeller": -10.256, "bp_simpleParams": [ 2.905, 0.107, 0.232, -0.583, -10.256, -6.051 ], "bp_params": [ 2.812, -0.738, 0.232, -3.523, -9.650, -6.070 ], "frame": { "rmsd": null, "origin": [ 26.027, 9.945, 62.962 ], "x_axis": [ 0.694, -0.091, 0.715 ], "y_axis": [ 0.701, -0.145, -0.699 ], "z_axis": [ 0.167, 0.985, -0.037 ], "quaternion": [ 0.615, -0.685, -0.223, -0.322 ] } }, { "index": 181, "nt1": "///R/45", "nt2": "///R/98", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": 177.097, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 100.625, "chi2": -156.850, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 43.077, "C1C1_dist": 10.228, "N1N9_dist": 9.646, "C6C8_dist": 11.267, "CNNC_torsion": 113.954, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N1[3.04]", "interBase_angle": 61.685, "planarity": 0.820, "simple_Shear": 3.242, "simple_Stretch": 4.739, "simple_Buckle": -33.779, "simple_Propeller": -51.615, "bp_simpleParams": [ 3.242, 4.739, 0.139, -33.779, -51.615, -106.829 ], "bp_params": [ 2.450, -5.193, 0.139, -28.585, 54.662, -111.390 ], "frame": { "rmsd": null, "origin": [ 9.264, 25.053, 61.500 ], "x_axis": [ 0.298, -0.363, -0.883 ], "y_axis": [ -0.954, -0.070, -0.293 ], "z_axis": [ 0.045, 0.929, -0.367 ], "quaternion": [ -0.464, 0.659, -0.500, -0.318 ] } }, { "index": 182, "nt1": "///R/46", "nt2": "///R/51", "bp": "A+U", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -166.317, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 31.645, "chi2": -135.862, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 36.617, "C1C1_dist": 11.232, "N1N9_dist": 8.935, "C6C8_dist": 9.775, "CNNC_torsion": -166.030, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.92],N1-N3(imino)[2.90]", "interBase_angle": 19.230, "planarity": 0.223, "simple_Shear": 1.023, "simple_Stretch": 0.059, "simple_Buckle": 19.163, "simple_Propeller": 1.606, "bp_simpleParams": [ 1.023, 0.059, 0.371, 19.163, 1.606, 170.531 ], "bp_params": [ 0.046, 1.024, 0.371, 0.362, 19.227, 170.663 ], "frame": { "rmsd": null, "origin": [ 12.541, 28.446, 59.865 ], "x_axis": [ 0.821, 0.555, 0.131 ], "y_axis": [ 0.535, -0.669, -0.516 ], "z_axis": [ -0.199, 0.494, -0.846 ], "quaternion": [ -0.277, 0.913, 0.298, -0.019 ] } }, { "index": 183, "nt1": "///R/56", "nt2": "///H/-1", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "c.H", "DSSR": "c.+M", "intra_chain": false, "chi1": -161.574, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 97.677, "chi2": -105.357, "conf2": "anti", "pucker2": "----", "lambda2": 11.072, "C1C1_dist": 12.259, "N1N9_dist": 11.103, "C6C8_dist": 11.444, "CNNC_torsion": -30.160, "hbonds_num": 1, "hbonds_desc": "N2(amino)*N6(amino)[2.89]", "interBase_angle": 29.129, "planarity": 0.385, "simple_Shear": 0.065, "simple_Stretch": 6.062, "simple_Buckle": 19.569, "simple_Propeller": -21.577, "bp_simpleParams": [ 0.065, 6.062, 0.649, 19.569, -21.577, -66.946 ], "bp_params": [ 6.063, -0.009, 0.649, -21.418, -19.743, -66.817 ], "frame": { "rmsd": null, "origin": [ 25.172, 23.683, 69.580 ], "x_axis": [ 0.364, -0.003, -0.931 ], "y_axis": [ 0.924, -0.123, 0.361 ], "z_axis": [ -0.116, -0.992, -0.042 ], "quaternion": [ 0.547, 0.618, 0.372, -0.424 ] } }, { "index": 184, "nt1": "///R/66", "nt2": "///R/84", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.564, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.030, "chi2": -123.747, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.178, "C1C1_dist": 10.889, "N1N9_dist": 9.047, "C6C8_dist": 9.761, "CNNC_torsion": -11.591, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.27],N3-N1(imino)[2.97],N4(amino)-O6(carbonyl)[2.62]", "interBase_angle": 10.443, "planarity": 0.147, "simple_Shear": 0.369, "simple_Stretch": -0.206, "simple_Buckle": -6.990, "simple_Propeller": -7.759, "bp_simpleParams": [ 0.369, -0.206, 0.387, -6.990, -7.759, -9.768 ], "bp_params": [ 0.361, -0.220, 0.387, -7.269, -7.498, -9.769 ], "frame": { "rmsd": null, "origin": [ 19.718, -4.310, 72.497 ], "x_axis": [ -0.095, -0.211, -0.973 ], "y_axis": [ 0.786, -0.616, 0.057 ], "z_axis": [ -0.611, -0.759, 0.224 ], "quaternion": [ -0.358, -0.569, -0.252, 0.695 ] } }, { "index": 185, "nt1": "///R/67", "nt2": "///R/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.463, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.471, "chi2": -153.364, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.682, "C1C1_dist": 10.566, "N1N9_dist": 8.883, "C6C8_dist": 9.801, "CNNC_torsion": -11.623, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.96],N2(amino)-O2(carbonyl)[2.92]", "interBase_angle": 13.200, "planarity": 0.190, "simple_Shear": -0.718, "simple_Stretch": -0.191, "simple_Buckle": 0.799, "simple_Propeller": -13.175, "bp_simpleParams": [ -0.718, -0.191, -0.167, 0.799, -13.175, 0.672 ], "bp_params": [ -0.703, -0.239, -0.167, 1.676, -13.093, 0.676 ], "frame": { "rmsd": null, "origin": [ 17.268, -6.296, 71.686 ], "x_axis": [ 0.404, -0.267, -0.875 ], "y_axis": [ 0.676, -0.558, 0.482 ], "z_axis": [ -0.617, -0.786, -0.045 ], "quaternion": [ 0.448, 0.708, 0.144, -0.527 ] } }, { "index": 186, "nt1": "///R/67", "nt2": "///R/86", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "t.W", "DSSR": "t.+W", "intra_chain": true, "chi1": -154.463, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 78.328, "chi2": -133.810, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.242, "C1C1_dist": 12.720, "N1N9_dist": 11.660, "C6C8_dist": 13.281, "CNNC_torsion": 153.597, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N1[3.87]", "interBase_angle": 38.728, "planarity": 0.434, "simple_Shear": 4.487, "simple_Stretch": 4.930, "simple_Buckle": 25.957, "simple_Propeller": -28.742, "bp_simpleParams": [ 4.487, 4.930, 1.012, 25.957, -28.742, -151.370 ], "bp_params": [ 2.289, -6.261, 1.012, -37.519, -9.603, -149.926 ], "frame": { "rmsd": null, "origin": [ 15.383, -5.185, 74.705 ], "x_axis": [ 0.779, -0.574, 0.253 ], "y_axis": [ -0.347, -0.059, 0.936 ], "z_axis": [ -0.522, -0.817, -0.245 ], "quaternion": [ 0.607, 0.722, -0.319, -0.093 ] } }, { "index": 187, "nt1": "///R/68", "nt2": "///R/82", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.632, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.313, "chi2": -166.063, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.764, "C1C1_dist": 10.492, "N1N9_dist": 8.874, "C6C8_dist": 9.884, "CNNC_torsion": -19.075, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.11],N1(imino)-N3[2.88],N2(amino)-O2(carbonyl)[2.69]", "interBase_angle": 23.091, "planarity": 0.282, "simple_Shear": -0.186, "simple_Stretch": -0.104, "simple_Buckle": -6.162, "simple_Propeller": -22.253, "bp_simpleParams": [ -0.186, -0.104, 0.173, -6.162, -22.253, 4.633 ], "bp_params": [ -0.185, -0.106, 0.173, -5.876, -22.331, 4.717 ], "frame": { "rmsd": null, "origin": [ 14.726, -8.625, 69.672 ], "x_axis": [ 0.764, -0.462, -0.450 ], "y_axis": [ 0.322, -0.331, 0.887 ], "z_axis": [ -0.559, -0.823, -0.104 ], "quaternion": [ 0.576, 0.742, -0.047, -0.340 ] } }, { "index": 188, "nt1": "///R/68", "nt2": "///R/87", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -176.632, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 88.161, "chi2": -119.087, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.397, "C1C1_dist": 8.062, "N1N9_dist": 7.742, "C6C8_dist": 9.931, "CNNC_torsion": 156.081, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.59],N2(amino)-N3[3.06]", "interBase_angle": 36.232, "planarity": 0.408, "simple_Shear": 7.035, "simple_Stretch": 3.504, "simple_Buckle": 30.586, "simple_Propeller": -19.423, "bp_simpleParams": [ 7.035, 3.504, 1.245, 30.586, -19.423, -152.657 ], "bp_params": [ -2.775, -7.353, 1.245, -35.588, -6.799, -151.382 ], "frame": { "rmsd": null, "origin": [ 12.887, -7.533, 73.080 ], "x_axis": [ 0.513, -0.363, 0.778 ], "y_axis": [ -0.733, 0.287, 0.617 ], "z_axis": [ -0.447, -0.886, -0.119 ], "quaternion": [ 0.648, 0.580, -0.472, 0.142 ] } }, { "index": 189, "nt1": "///R/69", "nt2": "///R/81", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.866, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.719, "chi2": -162.927, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.836, "C1C1_dist": 10.749, "N1N9_dist": 8.924, "C6C8_dist": 9.748, "CNNC_torsion": -13.374, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.73]", "interBase_angle": 20.871, "planarity": 0.255, "simple_Shear": -0.332, "simple_Stretch": -0.163, "simple_Buckle": -4.036, "simple_Propeller": -20.477, "bp_simpleParams": [ -0.332, -0.163, -0.260, -4.036, -20.477, -3.854 ], "bp_params": [ -0.327, -0.174, -0.260, -3.302, -20.608, -3.916 ], "frame": { "rmsd": null, "origin": [ 11.785, -10.177, 67.661 ], "x_axis": [ 0.829, -0.555, 0.073 ], "y_axis": [ -0.136, -0.073, 0.988 ], "z_axis": [ -0.543, -0.829, -0.136 ], "quaternion": [ 0.636, 0.714, -0.242, -0.164 ] } }, { "index": 190, "nt1": "///R/70", "nt2": "///R/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.212, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.674, "chi2": -153.529, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.943, "C1C1_dist": 10.610, "N1N9_dist": 8.912, "C6C8_dist": 9.874, "CNNC_torsion": -12.465, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[3.06]", "interBase_angle": 13.606, "planarity": 0.169, "simple_Shear": 0.260, "simple_Stretch": -0.054, "simple_Buckle": -5.620, "simple_Propeller": -12.391, "bp_simpleParams": [ 0.260, -0.054, 0.226, -5.620, -12.391, 1.610 ], "bp_params": [ 0.258, -0.060, 0.226, -5.901, -12.260, 1.617 ], "frame": { "rmsd": null, "origin": [ 10.905, -13.460, 66.637 ], "x_axis": [ 0.694, -0.354, 0.627 ], "y_axis": [ -0.582, 0.236, 0.778 ], "z_axis": [ -0.424, -0.905, -0.043 ], "quaternion": [ 0.687, 0.612, -0.382, 0.083 ] } }, { "index": 191, "nt1": "///R/71", "nt2": "///R/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.619, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.441, "chi2": -156.589, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.309, "C1C1_dist": 10.602, "N1N9_dist": 8.962, "C6C8_dist": 9.964, "CNNC_torsion": -8.391, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.09],N1(imino)-N3[2.97],N2(amino)-O2(carbonyl)[2.65]", "interBase_angle": 7.674, "planarity": 0.110, "simple_Shear": -0.132, "simple_Stretch": -0.037, "simple_Buckle": 1.464, "simple_Propeller": -7.533, "bp_simpleParams": [ -0.132, -0.037, 0.314, 1.464, -7.533, 3.572 ], "bp_params": [ -0.132, -0.038, 0.314, 1.535, -7.519, 3.580 ], "frame": { "rmsd": null, "origin": [ 11.114, -16.728, 66.302 ], "x_axis": [ 0.441, -0.015, 0.897 ], "y_axis": [ -0.849, 0.317, 0.423 ], "z_axis": [ -0.291, -0.948, 0.127 ], "quaternion": [ 0.686, 0.499, -0.433, 0.304 ] } }, { "index": 192, "nt1": "///R/73", "nt2": "///R/141", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.386, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.438, "chi2": -145.778, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.792, "C1C1_dist": 11.240, "N1N9_dist": 9.519, "C6C8_dist": 10.469, "CNNC_torsion": -8.787, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.48],O4(carbonyl)*N1[3.32]", "interBase_angle": 11.415, "planarity": 0.140, "simple_Shear": -1.222, "simple_Stretch": 0.599, "simple_Buckle": -4.252, "simple_Propeller": -10.593, "bp_simpleParams": [ -1.222, 0.599, -0.040, -4.252, -10.593, 1.310 ], "bp_params": [ -1.288, 0.439, -0.040, -2.868, -11.049, 1.316 ], "frame": { "rmsd": null, "origin": [ 1.985, -28.887, 73.507 ], "x_axis": [ 0.054, -0.359, -0.932 ], "y_axis": [ -0.539, 0.775, -0.330 ], "z_axis": [ 0.841, 0.520, -0.151 ], "quaternion": [ 0.648, -0.328, 0.684, 0.070 ] } }, { "index": 193, "nt1": "///R/74", "nt2": "///R/140", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.940, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.121, "chi2": -163.317, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 62.106, "C1C1_dist": 10.597, "N1N9_dist": 9.034, "C6C8_dist": 10.118, "CNNC_torsion": -16.288, "hbonds_num": 4, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.66],N3-N1(imino)[3.04],N3-N2(amino)[3.01],N4(amino)-O6(carbonyl)[3.39]", "interBase_angle": 20.125, "planarity": 0.249, "simple_Shear": -0.514, "simple_Stretch": 0.145, "simple_Buckle": 5.244, "simple_Propeller": -19.430, "bp_simpleParams": [ -0.514, 0.145, 0.228, 5.244, -19.430, 7.474 ], "bp_params": [ -0.522, 0.113, 0.228, 6.381, -19.087, 7.568 ], "frame": { "rmsd": null, "origin": [ 5.187, -28.343, 72.577 ], "x_axis": [ -0.306, 0.139, -0.942 ], "y_axis": [ -0.541, 0.788, 0.293 ], "z_axis": [ 0.783, 0.600, -0.166 ], "quaternion": [ 0.574, -0.134, 0.752, 0.297 ] } }, { "index": 194, "nt1": "///R/75", "nt2": "///R/139", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.772, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.388, "chi2": -168.301, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.339, "C1C1_dist": 10.780, "N1N9_dist": 9.120, "C6C8_dist": 10.138, "CNNC_torsion": -13.885, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.42],N1-N3(imino)[3.16]", "interBase_angle": 14.972, "planarity": 0.188, "simple_Shear": -0.335, "simple_Stretch": 0.203, "simple_Buckle": 3.834, "simple_Propeller": -14.473, "bp_simpleParams": [ -0.335, 0.203, 0.315, 3.834, -14.473, 3.273 ], "bp_params": [ -0.342, 0.192, 0.315, 4.273, -14.349, 3.296 ], "frame": { "rmsd": null, "origin": [ 8.301, -27.449, 71.492 ], "x_axis": [ -0.720, 0.424, -0.550 ], "y_axis": [ -0.251, 0.579, 0.775 ], "z_axis": [ 0.648, 0.696, -0.311 ], "quaternion": [ 0.371, 0.054, 0.808, 0.455 ] } }, { "index": 195, "nt1": "///R/76", "nt2": "///R/138", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.616, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 46.209, "chi2": -170.166, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.625, "C1C1_dist": 10.939, "N1N9_dist": 9.124, "C6C8_dist": 9.943, "CNNC_torsion": -8.669, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.00],O4(carbonyl)-N6(amino)[2.88]", "interBase_angle": 14.589, "planarity": 0.172, "simple_Shear": -0.913, "simple_Stretch": 0.075, "simple_Buckle": 6.738, "simple_Propeller": -12.940, "bp_simpleParams": [ -0.913, 0.075, -0.031, 6.738, -12.940, -5.641 ], "bp_params": [ -0.916, -0.015, -0.031, 7.968, -12.221, -5.659 ], "frame": { "rmsd": null, "origin": [ 10.627, -26.184, 69.166 ], "x_axis": [ -0.841, 0.538, -0.053 ], "y_axis": [ 0.151, 0.327, 0.933 ], "z_axis": [ 0.519, 0.777, -0.356 ], "quaternion": [ 0.180, 0.217, 0.794, 0.538 ] } }, { "index": 196, "nt1": "///R/77", "nt2": "///R/137", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.217, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.400, "chi2": 178.910, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.886, "C1C1_dist": 11.249, "N1N9_dist": 9.317, "C6C8_dist": 10.007, "CNNC_torsion": -10.560, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.46],N3-N1(imino)[3.16],N4(amino)-O6(carbonyl)[2.78]", "interBase_angle": 15.880, "planarity": 0.182, "simple_Shear": 0.166, "simple_Stretch": 0.029, "simple_Buckle": 5.469, "simple_Propeller": -14.908, "bp_simpleParams": [ 0.166, 0.029, -0.157, 5.469, -14.908, -9.731 ], "bp_params": [ 0.166, 0.027, -0.157, 5.303, -14.968, -9.804 ], "frame": { "rmsd": null, "origin": [ 11.332, -23.625, 66.703 ], "x_axis": [ -0.599, 0.592, 0.538 ], "y_axis": [ 0.661, -0.013, 0.750 ], "z_axis": [ 0.451, 0.806, -0.384 ], "quaternion": [ -0.031, 0.446, 0.702, 0.554 ] } }, { "index": 197, "nt1": "///R/78", "nt2": "///R/136", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.628, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.268, "chi2": -153.330, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.225, "C1C1_dist": 11.013, "N1N9_dist": 9.108, "C6C8_dist": 9.812, "CNNC_torsion": -10.101, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.69],N1-N3(imino)[2.97]", "interBase_angle": 11.037, "planarity": 0.144, "simple_Shear": 0.227, "simple_Stretch": -0.077, "simple_Buckle": 1.480, "simple_Propeller": -10.937, "bp_simpleParams": [ 0.227, -0.077, 0.245, 1.480, -10.937, -10.303 ], "bp_params": [ 0.225, -0.083, 0.245, 1.201, -10.971, -10.349 ], "frame": { "rmsd": null, "origin": [ 11.327, -20.546, 64.779 ], "x_axis": [ -0.291, 0.314, 0.904 ], "y_axis": [ 0.885, -0.271, 0.379 ], "z_axis": [ 0.364, 0.910, -0.199 ], "quaternion": [ -0.245, 0.543, 0.552, 0.584 ] } }, { "index": 198, "nt1": "///R/86", "nt2": "///S/85", "bp": "A+C", "name": "--", "Saenger": "--", "LW": "cW.", "DSSR": "cW+.", "intra_chain": false, "chi1": -133.810, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.017, "chi2": -126.372, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 15.768, "C1C1_dist": 12.673, "N1N9_dist": 10.302, "C6C8_dist": 9.826, "CNNC_torsion": 49.331, "hbonds_num": 1, "hbonds_desc": "N1-N4(amino)[2.89]", "interBase_angle": 62.581, "planarity": 0.704, "simple_Shear": -1.923, "simple_Stretch": 2.601, "simple_Buckle": -41.075, "simple_Propeller": 47.215, "bp_simpleParams": [ -1.923, 2.601, 0.329, -41.075, 47.215, -105.924 ], "bp_params": [ 1.853, 2.652, 0.329, 32.096, 53.723, -109.816 ], "frame": { "rmsd": null, "origin": [ 14.915, -5.025, 78.220 ], "x_axis": [ -0.961, -0.252, 0.117 ], "y_axis": [ -0.274, 0.792, -0.546 ], "z_axis": [ 0.044, -0.556, -0.830 ], "quaternion": [ -0.019, -0.139, 0.946, -0.291 ] } }, { "index": 199, "nt1": "///R/88", "nt2": "///R/134", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 179.524, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.227, "chi2": -163.607, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 71.976, "C1C1_dist": 10.379, "N1N9_dist": 8.863, "C6C8_dist": 9.877, "CNNC_torsion": -8.143, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.12],N1(imino)-O2(carbonyl)[2.78]", "interBase_angle": 11.859, "planarity": 0.137, "simple_Shear": -2.533, "simple_Stretch": 0.235, "simple_Buckle": -8.208, "simple_Propeller": -8.559, "bp_simpleParams": [ -2.533, 0.235, -0.040, -8.208, -8.559, 5.960 ], "bp_params": [ -2.513, -0.395, -0.040, -5.850, -10.315, 5.977 ], "frame": { "rmsd": null, "origin": [ -0.554, -9.216, 63.478 ], "x_axis": [ -0.683, 0.048, 0.729 ], "y_axis": [ 0.716, 0.237, 0.656 ], "z_axis": [ -0.141, 0.970, -0.197 ], "quaternion": [ -0.299, 0.263, 0.728, 0.559 ] } }, { "index": 200, "nt1": "///R/89", "nt2": "///R/133", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.142, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.713, "chi2": -161.726, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.551, "C1C1_dist": 10.670, "N1N9_dist": 9.007, "C6C8_dist": 9.983, "CNNC_torsion": -10.888, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.90],N3-N1(imino)[3.08],N4(amino)-O6(carbonyl)[3.19]", "interBase_angle": 16.059, "planarity": 0.220, "simple_Shear": 0.584, "simple_Stretch": 0.002, "simple_Buckle": -4.645, "simple_Propeller": -15.372, "bp_simpleParams": [ 0.584, 0.002, 0.039, -4.645, -15.372, 2.615 ], "bp_params": [ 0.583, -0.031, 0.039, -5.493, -15.090, 2.634 ], "frame": { "rmsd": null, "origin": [ -2.087, -6.352, 61.663 ], "x_axis": [ -0.016, 0.161, 0.987 ], "y_axis": [ 0.991, 0.136, -0.007 ], "z_axis": [ -0.136, 0.977, -0.162 ], "quaternion": [ -0.490, 0.502, 0.573, 0.423 ] } }, { "index": 201, "nt1": "///R/90", "nt2": "///R/132", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.441, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.130, "chi2": -161.801, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.921, "C1C1_dist": 10.652, "N1N9_dist": 8.915, "C6C8_dist": 9.802, "CNNC_torsion": -10.494, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.81]", "interBase_angle": 14.872, "planarity": 0.171, "simple_Shear": -0.327, "simple_Stretch": -0.116, "simple_Buckle": 5.262, "simple_Propeller": -13.910, "bp_simpleParams": [ -0.327, -0.116, -0.217, 5.262, -13.910, -2.156 ], "bp_params": [ -0.322, -0.129, -0.217, 5.784, -13.701, -2.169 ], "frame": { "rmsd": null, "origin": [ -4.097, -3.586, 61.426 ], "x_axis": [ 0.400, 0.048, 0.915 ], "y_axis": [ 0.910, 0.098, -0.403 ], "z_axis": [ -0.109, 0.994, -0.005 ], "quaternion": [ 0.611, -0.572, -0.419, -0.353 ] } }, { "index": 202, "nt1": "///R/91", "nt2": "///R/131", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.289, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.382, "chi2": -159.744, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.147, "C1C1_dist": 10.635, "N1N9_dist": 8.954, "C6C8_dist": 9.914, "CNNC_torsion": -9.935, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.96],O4(carbonyl)-N6(amino)[3.11]", "interBase_angle": 13.967, "planarity": 0.173, "simple_Shear": -0.206, "simple_Stretch": -0.004, "simple_Buckle": -0.266, "simple_Propeller": -13.964, "bp_simpleParams": [ -0.206, -0.004, -0.222, -0.266, -13.964, 1.496 ], "bp_params": [ -0.205, -0.009, -0.222, 0.091, -13.966, 1.507 ], "frame": { "rmsd": null, "origin": [ -5.422, -0.294, 62.740 ], "x_axis": [ 0.817, -0.067, 0.573 ], "y_axis": [ 0.576, 0.086, -0.813 ], "z_axis": [ 0.005, 0.994, 0.109 ], "quaternion": [ 0.709, -0.637, -0.200, -0.227 ] } }, { "index": 203, "nt1": "///R/92", "nt2": "///R/130", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.231, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.737, "chi2": -166.782, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.343, "C1C1_dist": 10.594, "N1N9_dist": 8.878, "C6C8_dist": 9.749, "CNNC_torsion": -11.962, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.83],O4(carbonyl)-N6(amino)[2.73]", "interBase_angle": 15.871, "planarity": 0.197, "simple_Shear": -0.139, "simple_Stretch": -0.182, "simple_Buckle": -3.719, "simple_Propeller": -15.430, "bp_simpleParams": [ -0.139, -0.182, -0.139, -3.719, -15.430, -3.024 ], "bp_params": [ -0.137, -0.184, -0.139, -3.459, -15.490, -3.050 ], "frame": { "rmsd": null, "origin": [ -5.443, 2.830, 64.565 ], "x_axis": [ 0.992, -0.127, -0.016 ], "y_axis": [ 0.002, 0.137, -0.991 ], "z_axis": [ 0.128, 0.982, 0.136 ], "quaternion": [ 0.753, -0.655, 0.048, -0.043 ] } }, { "index": 204, "nt1": "///R/93", "nt2": "///R/129", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.310, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 70.846, "chi2": -169.155, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.698, "C1C1_dist": 10.285, "N1N9_dist": 8.763, "C6C8_dist": 9.737, "CNNC_torsion": -12.615, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.70],N3(imino)-O6(carbonyl)[2.92]", "interBase_angle": 9.656, "planarity": 0.136, "simple_Shear": 2.601, "simple_Stretch": 0.089, "simple_Buckle": 0.235, "simple_Propeller": -9.653, "bp_simpleParams": [ 2.601, 0.089, 0.321, 0.235, -9.653, 2.605 ], "bp_params": [ 2.536, -0.582, 0.321, -2.255, -9.389, 2.614 ], "frame": { "rmsd": null, "origin": [ -4.249, 5.771, 65.949 ], "x_axis": [ 0.723, -0.078, -0.686 ], "y_axis": [ -0.666, 0.184, -0.723 ], "z_axis": [ 0.182, 0.980, 0.081 ], "quaternion": [ 0.705, -0.604, 0.308, 0.209 ] } }, { "index": 205, "nt1": "///R/94", "nt2": "///R/128", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -149.396, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.935, "chi2": -158.496, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.775, "C1C1_dist": 10.368, "N1N9_dist": 8.774, "C6C8_dist": 9.825, "CNNC_torsion": -16.197, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.22],N1-N3(imino)[2.85]", "interBase_angle": 18.669, "planarity": 0.233, "simple_Shear": 0.111, "simple_Stretch": -0.070, "simple_Buckle": -3.252, "simple_Propeller": -18.383, "bp_simpleParams": [ 0.111, -0.070, 0.100, -3.252, -18.383, 5.432 ], "bp_params": [ 0.110, -0.072, 0.100, -3.565, -18.325, 5.500 ], "frame": { "rmsd": null, "origin": [ -2.438, 8.349, 67.225 ], "x_axis": [ 0.330, -0.090, -0.940 ], "y_axis": [ -0.886, 0.313, -0.341 ], "z_axis": [ 0.325, 0.945, 0.023 ], "quaternion": [ 0.645, -0.498, 0.490, 0.308 ] } }, { "index": 206, "nt1": "///R/95", "nt2": "///R/127", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.114, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.499, "chi2": -171.209, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.162, "C1C1_dist": 10.655, "N1N9_dist": 8.876, "C6C8_dist": 9.736, "CNNC_torsion": -14.923, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.81],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.87]", "interBase_angle": 14.423, "planarity": 0.185, "simple_Shear": 0.270, "simple_Stretch": -0.259, "simple_Buckle": 0.295, "simple_Propeller": -14.420, "bp_simpleParams": [ 0.270, -0.259, 0.227, 0.295, -14.420, -2.222 ], "bp_params": [ 0.264, -0.265, 0.227, -0.021, -14.423, -2.240 ], "frame": { "rmsd": null, "origin": [ 0.086, 10.784, 66.881 ], "x_axis": [ -0.186, 0.013, -0.982 ], "y_axis": [ -0.918, 0.353, 0.179 ], "z_axis": [ 0.349, 0.936, -0.054 ], "quaternion": [ 0.527, -0.359, 0.631, 0.441 ] } }, { "index": 207, "nt1": "///R/96", "nt2": "///R/126", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -153.944, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 68.083, "chi2": -168.800, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 40.133, "C1C1_dist": 10.505, "N1N9_dist": 8.852, "C6C8_dist": 9.737, "CNNC_torsion": -10.239, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.81],N3(imino)-O6(carbonyl)[2.94]", "interBase_angle": 9.246, "planarity": 0.128, "simple_Shear": 3.029, "simple_Stretch": 0.218, "simple_Buckle": 1.888, "simple_Propeller": -9.051, "bp_simpleParams": [ 3.029, 0.218, 0.247, 1.888, -9.051, -0.681 ], "bp_params": [ 2.954, -0.703, 0.247, -0.924, -9.200, -0.683 ], "frame": { "rmsd": null, "origin": [ 2.444, 13.334, 65.938 ], "x_axis": [ -0.797, 0.158, -0.582 ], "y_axis": [ -0.510, 0.340, 0.790 ], "z_axis": [ 0.323, 0.927, -0.190 ], "quaternion": [ 0.297, -0.115, 0.763, 0.563 ] } }, { "index": 208, "nt1": "///R/99", "nt2": "///R/122", "bp": "A-C", "name": "~rHoogsteen", "Saenger": "25-XXV", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -150.134, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 6.448, "chi2": -157.746, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 23.328, "C1C1_dist": 11.135, "N1N9_dist": 8.374, "C6C8_dist": 7.278, "CNNC_torsion": 179.443, "hbonds_num": 3, "hbonds_desc": "N7-N4(amino)[2.99],N6(amino)-O2(carbonyl)[3.35],N6(amino)-N3[2.93]", "interBase_angle": 14.228, "planarity": 0.159, "simple_Shear": -2.834, "simple_Stretch": 1.089, "simple_Buckle": -3.654, "simple_Propeller": -13.750, "bp_simpleParams": [ -2.834, 1.089, -0.507, -3.654, -13.750, -93.560 ], "bp_params": [ -3.026, -0.253, -0.507, 2.712, -13.967, -93.970 ], "frame": { "rmsd": null, "origin": [ 4.648, 28.595, 62.534 ], "x_axis": [ -0.880, 0.027, 0.474 ], "y_axis": [ 0.474, 0.027, 0.880 ], "z_axis": [ 0.011, 0.999, -0.036 ], "quaternion": [ -0.166, 0.180, 0.697, 0.674 ] } }, { "index": 209, "nt1": "///R/100", "nt2": "///R/121", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -162.885, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 17.564, "chi2": -163.900, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 26.274, "C1C1_dist": 12.184, "N1N9_dist": 9.540, "C6C8_dist": 8.185, "CNNC_torsion": 135.461, "hbonds_num": 2, "hbonds_desc": "N7-N6(amino)[3.08],N6(amino)-N1[2.78]", "interBase_angle": 23.871, "planarity": 0.302, "simple_Shear": -2.987, "simple_Stretch": 3.029, "simple_Buckle": 6.803, "simple_Propeller": -22.881, "bp_simpleParams": [ -2.987, 3.029, -0.585, 6.803, -22.881, -103.929 ], "bp_params": [ -4.117, 1.072, -0.585, 17.507, -16.227, -103.834 ], "frame": { "rmsd": null, "origin": [ 4.038, 31.503, 61.381 ], "x_axis": [ -0.536, 0.116, 0.836 ], "y_axis": [ 0.844, 0.026, 0.536 ], "z_axis": [ 0.040, 0.993, -0.112 ], "quaternion": [ -0.308, 0.371, 0.647, 0.591 ] } }, { "index": 210, "nt1": "///R/101", "nt2": "///R/120", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -171.898, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 6.739, "chi2": -151.537, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.655, "C1C1_dist": 13.131, "N1N9_dist": 10.703, "C6C8_dist": 10.195, "CNNC_torsion": 123.101, "hbonds_num": 2, "hbonds_desc": "O4(carbonyl)-N1(imino)[3.00],O4(carbonyl)-N2(amino)[2.73]", "interBase_angle": 18.567, "planarity": 0.199, "simple_Shear": -4.360, "simple_Stretch": 2.996, "simple_Buckle": 6.599, "simple_Propeller": -17.355, "bp_simpleParams": [ -4.360, 2.996, -0.457, 6.599, -17.355, -64.203 ], "bp_params": [ -5.283, 0.274, -0.457, 14.676, -11.374, -64.035 ], "frame": { "rmsd": null, "origin": [ 1.274, 34.990, 61.741 ], "x_axis": [ -0.081, 0.094, 0.992 ], "y_axis": [ 0.995, -0.057, 0.086 ], "z_axis": [ 0.065, 0.994, -0.089 ], "quaternion": [ -0.440, 0.516, 0.527, 0.512 ] } }, { "index": 211, "nt1": "///R/102", "nt2": "///R/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.943, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.651, "chi2": -153.552, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.641, "C1C1_dist": 10.756, "N1N9_dist": 9.057, "C6C8_dist": 10.021, "CNNC_torsion": -10.473, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[3.08],N4(amino)-O6(carbonyl)[3.28]", "interBase_angle": 24.875, "planarity": 0.278, "simple_Shear": -0.110, "simple_Stretch": 0.158, "simple_Buckle": 18.506, "simple_Propeller": -16.622, "bp_simpleParams": [ -0.110, 0.158, -0.206, 18.506, -16.622, 4.001 ], "bp_params": [ -0.114, 0.155, -0.206, 18.996, -16.060, 3.986 ], "frame": { "rmsd": null, "origin": [ 1.595, 38.401, 65.303 ], "x_axis": [ 0.712, -0.218, 0.668 ], "y_axis": [ 0.669, -0.078, -0.739 ], "z_axis": [ 0.213, 0.973, 0.090 ], "quaternion": [ 0.656, -0.652, -0.173, -0.338 ] } }, { "index": 212, "nt1": "///R/103", "nt2": "///R/118", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.122, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.784, "chi2": -164.904, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.523, "C1C1_dist": 10.297, "N1N9_dist": 8.753, "C6C8_dist": 9.851, "CNNC_torsion": -22.211, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.30],N1-N3(imino)[2.87]", "interBase_angle": 26.289, "planarity": 0.322, "simple_Shear": -0.242, "simple_Stretch": -0.052, "simple_Buckle": 3.366, "simple_Propeller": -26.073, "bp_simpleParams": [ -0.242, -0.052, 0.312, 3.366, -26.073, 7.104 ], "bp_params": [ -0.240, -0.058, 0.312, 3.928, -25.994, 7.286 ], "frame": { "rmsd": null, "origin": [ 2.683, 41.200, 67.430 ], "x_axis": [ 0.838, -0.540, 0.076 ], "y_axis": [ 0.161, 0.112, -0.981 ], "z_axis": [ 0.521, 0.834, 0.180 ], "quaternion": [ 0.730, -0.622, 0.152, -0.240 ] } }, { "index": 213, "nt1": "///R/104", "nt2": "///R/117", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.379, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 67.251, "chi2": 177.121, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.507, "C1C1_dist": 10.594, "N1N9_dist": 8.928, "C6C8_dist": 9.839, "CNNC_torsion": -18.134, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.88],N3(imino)-O6(carbonyl)[2.97]", "interBase_angle": 23.628, "planarity": 0.298, "simple_Shear": 2.364, "simple_Stretch": 0.102, "simple_Buckle": 6.017, "simple_Propeller": -22.849, "bp_simpleParams": [ 2.364, 0.102, -0.028, 6.017, -22.849, 0.585 ], "bp_params": [ 2.324, -0.446, -0.028, 0.509, -23.623, 0.598 ], "frame": { "rmsd": null, "origin": [ 4.726, 43.454, 69.462 ], "x_axis": [ 0.721, -0.329, -0.609 ], "y_axis": [ -0.404, 0.516, -0.756 ], "z_axis": [ 0.563, 0.791, 0.240 ], "quaternion": [ 0.787, -0.491, 0.372, 0.024 ] } }, { "index": 214, "nt1": "///R/105", "nt2": "///R/116", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.824, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.808, "chi2": -155.966, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.073, "C1C1_dist": 10.704, "N1N9_dist": 8.917, "C6C8_dist": 9.752, "CNNC_torsion": -10.416, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.85],O4(carbonyl)-N6(amino)[2.67]", "interBase_angle": 12.360, "planarity": 0.152, "simple_Shear": -0.210, "simple_Stretch": -0.147, "simple_Buckle": -9.375, "simple_Propeller": -8.055, "bp_simpleParams": [ -0.210, -0.147, 0.241, -9.375, -8.055, -5.234 ], "bp_params": [ -0.207, -0.152, 0.241, -9.204, -8.249, -5.230 ], "frame": { "rmsd": null, "origin": [ 7.467, 44.949, 72.499 ], "x_axis": [ 0.438, -0.293, -0.850 ], "y_axis": [ -0.617, 0.590, -0.521 ], "z_axis": [ 0.654, 0.752, 0.078 ], "quaternion": [ 0.726, -0.439, 0.518, 0.112 ] } }, { "index": 215, "nt1": "///R/106", "nt2": "///R/115", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.314, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 61.190, "chi2": -157.411, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.909, "C1C1_dist": 10.744, "N1N9_dist": 9.119, "C6C8_dist": 10.175, "CNNC_torsion": -13.714, "hbonds_num": 1, "hbonds_desc": "N1-N3(imino)[3.12]", "interBase_angle": 16.446, "planarity": 0.198, "simple_Shear": 0.656, "simple_Stretch": 0.263, "simple_Buckle": 0.069, "simple_Propeller": -16.446, "bp_simpleParams": [ 0.656, 0.263, -0.010, 0.069, -16.446, 5.866 ], "bp_params": [ 0.673, 0.215, -0.010, -1.105, -16.409, 5.926 ], "frame": { "rmsd": null, "origin": [ 10.424, 46.381, 72.578 ], "x_axis": [ -0.044, 0.055, -0.998 ], "y_axis": [ -0.705, 0.706, 0.070 ], "z_axis": [ 0.708, 0.706, 0.007 ], "quaternion": [ 0.646, -0.246, 0.660, 0.294 ] } }, { "index": 216, "nt1": "///R/107", "nt2": "///R/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.898, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.784, "chi2": -175.036, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.065, "C1C1_dist": 10.648, "N1N9_dist": 8.966, "C6C8_dist": 9.907, "CNNC_torsion": -12.033, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.17],N1-N3(imino)[3.01]", "interBase_angle": 18.111, "planarity": 0.217, "simple_Shear": -0.121, "simple_Stretch": 0.042, "simple_Buckle": 14.099, "simple_Propeller": -11.367, "bp_simpleParams": [ -0.121, 0.042, 0.536, 14.099, -11.367, 0.535 ], "bp_params": [ -0.121, 0.041, 0.536, 14.262, -11.162, 0.533 ], "frame": { "rmsd": null, "origin": [ 13.265, 47.533, 72.298 ], "x_axis": [ -0.390, 0.364, -0.846 ], "y_axis": [ -0.638, 0.556, 0.533 ], "z_axis": [ 0.664, 0.748, 0.015 ], "quaternion": [ 0.543, -0.099, 0.695, 0.461 ] } }, { "index": 217, "nt1": "///R/108", "nt2": "///R/113", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.650, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.428, "chi2": -175.774, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.208, "C1C1_dist": 10.871, "N1N9_dist": 9.225, "C6C8_dist": 10.259, "CNNC_torsion": -1.818, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.50],N1(imino)-N3[3.22],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 4.812, "planarity": 0.064, "simple_Shear": -0.124, "simple_Stretch": 0.269, "simple_Buckle": 3.303, "simple_Propeller": -3.499, "bp_simpleParams": [ -0.124, 0.269, 0.100, 3.303, -3.499, 5.795 ], "bp_params": [ -0.126, 0.268, 0.100, 3.327, -3.476, 5.795 ], "frame": { "rmsd": null, "origin": [ 16.075, 49.523, 70.070 ], "x_axis": [ -0.770, 0.479, -0.422 ], "y_axis": [ -0.264, 0.362, 0.894 ], "z_axis": [ 0.581, 0.800, -0.152 ], "quaternion": [ 0.332, 0.071, 0.756, 0.560 ] } }, { "index": 218, "nt1": "///R/109", "nt2": "///R/112", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -159.240, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 86.909, "chi2": -128.346, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 20.440, "C1C1_dist": 9.800, "N1N9_dist": 8.564, "C6C8_dist": 8.578, "CNNC_torsion": -154.621, "hbonds_num": 3, "hbonds_desc": "N1(imino)-OP2[3.15],N2(amino)-OP2[2.69],N2(amino)-N7[3.09]", "interBase_angle": 18.471, "planarity": 0.253, "simple_Shear": 8.362, "simple_Stretch": 4.464, "simple_Buckle": 18.329, "simple_Propeller": -2.285, "bp_simpleParams": [ 8.362, 4.464, 0.914, 18.329, -2.285, -38.857 ], "bp_params": [ 7.638, -5.613, 0.914, 5.876, -17.512, -39.233 ], "frame": { "rmsd": null, "origin": [ 20.923, 50.362, 67.880 ], "x_axis": [ -0.746, 0.367, 0.555 ], "y_axis": [ 0.581, -0.048, 0.813 ], "z_axis": [ 0.325, 0.929, -0.177 ], "quaternion": [ -0.084, 0.346, 0.685, 0.636 ] } }, { "index": 219, "nt1": "///H/0", "nt2": "///S/57", "bp": "a+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": false, "chi1": -125.345, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 63.533, "chi2": -175.721, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 88.314, "C1C1_dist": 8.197, "N1N9_dist": 7.972, "C6C8_dist": 10.305, "CNNC_torsion": 155.741, "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.82],N3-N2(amino)[3.11]", "interBase_angle": 26.039, "planarity": 0.311, "simple_Shear": 7.171, "simple_Stretch": 3.809, "simple_Buckle": 14.307, "simple_Propeller": -21.756, "bp_simpleParams": [ 7.171, 3.809, -0.500, 14.307, -21.756, 157.895 ], "bp_params": [ 2.826, 7.612, -0.500, 25.128, -6.827, 157.404 ], "frame": { "rmsd": null, "origin": [ 16.058, 22.753, 86.211 ], "x_axis": [ -0.966, 0.220, -0.133 ], "y_axis": [ 0.070, -0.272, -0.960 ], "z_axis": [ -0.248, -0.937, 0.248 ], "quaternion": [ 0.048, -0.121, -0.601, 0.788 ] } }, { "index": 220, "nt1": "///H/1", "nt2": "///S/30", "bp": "G-G", "name": "--", "Saenger": "--", "LW": "cSH", "DSSR": "cm-M", "intra_chain": false, "chi1": -68.869, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 115.387, "chi2": 169.308, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 19.630, "C1C1_dist": 8.202, "N1N9_dist": 7.518, "C6C8_dist": 6.408, "CNNC_torsion": 49.989, "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-N7[2.58]", "interBase_angle": 34.585, "planarity": 0.469, "simple_Shear": 5.711, "simple_Stretch": 7.911, "simple_Buckle": 26.977, "simple_Propeller": 21.642, "bp_simpleParams": [ 5.711, 7.911, 1.535, 26.977, 21.642, 104.820 ], "bp_params": [ 6.289, -7.460, 1.535, 14.343, -31.470, 106.485 ], "frame": { "rmsd": null, "origin": [ 25.000, 23.881, 93.586 ], "x_axis": [ -0.643, -0.084, 0.761 ], "y_axis": [ 0.602, -0.670, 0.435 ], "z_axis": [ 0.473, 0.738, 0.481 ], "quaternion": [ -0.205, 0.369, 0.351, 0.836 ] } }, { "index": 221, "nt1": "///H/1", "nt2": "///S/44", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM+W", "intra_chain": false, "chi1": -68.869, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 63.543, "chi2": -167.069, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 13.437, "C1C1_dist": 10.999, "N1N9_dist": 8.944, "C6C8_dist": 7.176, "CNNC_torsion": -10.664, "hbonds_num": 1, "hbonds_desc": "N7-N4(amino)[3.83]", "interBase_angle": 34.699, "planarity": 0.436, "simple_Shear": -7.718, "simple_Stretch": 5.421, "simple_Buckle": -27.930, "simple_Propeller": 20.590, "bp_simpleParams": [ -7.718, 5.421, 0.501, -27.930, 20.590, 108.119 ], "bp_params": [ 6.385, -6.942, 0.501, 23.017, -25.967, 108.404 ], "frame": { "rmsd": null, "origin": [ 24.894, 24.103, 93.619 ], "x_axis": [ -0.637, -0.032, 0.770 ], "y_axis": [ 0.547, -0.722, 0.424 ], "z_axis": [ 0.542, 0.691, 0.477 ], "quaternion": [ -0.172, 0.390, 0.331, 0.842 ] } }, { "index": 222, "nt1": "///H/2", "nt2": "///S/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -169.812, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.105, "chi2": -155.682, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.091, "C1C1_dist": 10.635, "N1N9_dist": 8.985, "C6C8_dist": 9.940, "CNNC_torsion": -8.663, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.67],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.97]", "interBase_angle": 11.646, "planarity": 0.137, "simple_Shear": -0.059, "simple_Stretch": -0.071, "simple_Buckle": 5.503, "simple_Propeller": -10.264, "bp_simpleParams": [ -0.059, -0.071, -0.060, 5.503, -10.264, 2.096 ], "bp_params": [ -0.058, -0.072, -0.060, 5.630, -10.195, 2.102 ], "frame": { "rmsd": null, "origin": [ 15.951, 26.820, 88.889 ], "x_axis": [ 0.188, -0.059, 0.980 ], "y_axis": [ 0.944, -0.263, -0.197 ], "z_axis": [ 0.269, 0.963, 0.006 ], "quaternion": [ -0.483, 0.601, 0.368, 0.520 ] } }, { "index": 223, "nt1": "///H/3", "nt2": "///S/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -161.266, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.975, "chi2": -157.964, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.182, "C1C1_dist": 10.477, "N1N9_dist": 8.792, "C6C8_dist": 9.738, "CNNC_torsion": -4.982, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.89],N1(imino)-N3[2.84],N2(amino)-O2(carbonyl)[2.67]", "interBase_angle": 9.179, "planarity": 0.147, "simple_Shear": -0.506, "simple_Stretch": -0.254, "simple_Buckle": 2.902, "simple_Propeller": -8.708, "bp_simpleParams": [ -0.506, -0.254, -0.215, 2.902, -8.708, 2.109 ], "bp_params": [ -0.493, -0.277, -0.215, 3.301, -8.565, 2.114 ], "frame": { "rmsd": null, "origin": [ 15.151, 30.576, 89.009 ], "x_axis": [ 0.587, -0.320, 0.744 ], "y_axis": [ 0.715, -0.226, -0.661 ], "z_axis": [ 0.380, 0.920, 0.096 ], "quaternion": [ 0.603, -0.655, -0.151, -0.429 ] } }, { "index": 224, "nt1": "///H/4", "nt2": "///S/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -160.090, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.294, "chi2": -162.251, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.069, "C1C1_dist": 10.444, "N1N9_dist": 8.727, "C6C8_dist": 9.658, "CNNC_torsion": -11.441, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.63],N3-N1(imino)[2.76],N4(amino)-O6(carbonyl)[2.76]", "interBase_angle": 17.994, "planarity": 0.214, "simple_Shear": 0.485, "simple_Stretch": -0.332, "simple_Buckle": 6.360, "simple_Propeller": -16.832, "bp_simpleParams": [ 0.485, -0.332, -0.234, 6.360, -16.832, 1.780 ], "bp_params": [ 0.471, -0.352, -0.234, 5.633, -17.089, 1.798 ], "frame": { "rmsd": null, "origin": [ 15.510, 33.794, 90.429 ], "x_axis": [ 0.853, -0.459, 0.247 ], "y_axis": [ 0.267, -0.022, -0.963 ], "z_axis": [ 0.448, 0.888, 0.104 ], "quaternion": [ 0.695, -0.665, 0.072, -0.261 ] } }, { "index": 225, "nt1": "///H/5", "nt2": "///S/53", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -111.447, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.283, "chi2": -165.536, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.244, "C1C1_dist": 10.750, "N1N9_dist": 8.935, "C6C8_dist": 9.724, "CNNC_torsion": 3.154, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.92],N3-N1(imino)[2.93],N4(amino)-O6(carbonyl)[2.69]", "interBase_angle": 18.759, "planarity": 0.209, "simple_Shear": 0.176, "simple_Stretch": -0.201, "simple_Buckle": 16.753, "simple_Propeller": -8.440, "bp_simpleParams": [ 0.176, -0.201, -0.842, 16.753, -8.440, -3.802 ], "bp_params": [ 0.175, -0.203, -0.842, 16.706, -8.533, -3.772 ], "frame": { "rmsd": null, "origin": [ 16.706, 36.530, 92.451 ], "x_axis": [ 0.791, -0.572, -0.216 ], "y_axis": [ -0.060, 0.279, -0.958 ], "z_axis": [ 0.608, 0.772, 0.187 ], "quaternion": [ 0.751, -0.576, 0.274, -0.170 ] } }, { "index": 226, "nt1": "///H/7", "nt2": "///S/27", "bp": "G-G", "name": "--", "Saenger": "--", "LW": "tH.", "DSSR": "tM-.", "intra_chain": false, "chi1": 177.895, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 9.551, "chi2": -138.496, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 89.104, "C1C1_dist": 11.555, "N1N9_dist": 10.156, "C6C8_dist": 10.521, "CNNC_torsion": -35.474, "hbonds_num": 1, "hbonds_desc": "O6(carbonyl)-N2(amino)[2.73]", "interBase_angle": 7.506, "planarity": 0.123, "simple_Shear": -6.700, "simple_Stretch": 3.325, "simple_Buckle": -2.061, "simple_Propeller": 7.218, "bp_simpleParams": [ -6.700, 3.325, 0.282, -2.061, 7.218, -12.622 ], "bp_params": [ -7.171, -2.125, 0.282, -6.421, 3.887, -12.610 ], "frame": { "rmsd": null, "origin": [ 18.219, 40.515, 92.062 ], "x_axis": [ 0.165, -0.016, -0.986 ], "y_axis": [ -0.889, 0.432, -0.155 ], "z_axis": [ 0.428, 0.902, 0.057 ], "quaternion": [ 0.643, -0.411, 0.550, 0.339 ] } }, { "index": 227, "nt1": "///H/7", "nt2": "///S/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": 177.895, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.904, "chi2": -163.225, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.262, "C1C1_dist": 10.408, "N1N9_dist": 8.791, "C6C8_dist": 9.742, "CNNC_torsion": -8.255, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.28],N1(imino)-N3[3.01],N2(amino)-O2(carbonyl)[2.66]", "interBase_angle": 34.276, "planarity": 0.393, "simple_Shear": -0.547, "simple_Stretch": 0.101, "simple_Buckle": -30.886, "simple_Propeller": -14.861, "bp_simpleParams": [ -0.547, 0.101, -0.279, -30.886, -14.861, 5.148 ], "bp_params": [ -0.550, 0.084, -0.279, -30.514, -15.612, 5.016 ], "frame": { "rmsd": null, "origin": [ 18.812, 40.262, 95.519 ], "x_axis": [ 0.219, -0.221, -0.950 ], "y_axis": [ -0.741, 0.596, -0.309 ], "z_axis": [ 0.635, 0.772, -0.033 ], "quaternion": [ 0.667, -0.405, 0.594, 0.195 ] } }, { "index": 228, "nt1": "///H/8", "nt2": "///S/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.262, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.143, "chi2": -155.594, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.346, "C1C1_dist": 10.870, "N1N9_dist": 9.058, "C6C8_dist": 9.853, "CNNC_torsion": -14.527, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.92],N1-N3(imino)[3.02]", "interBase_angle": 22.048, "planarity": 0.270, "simple_Shear": -0.130, "simple_Stretch": -0.002, "simple_Buckle": 14.163, "simple_Propeller": -16.898, "bp_simpleParams": [ -0.130, -0.002, 0.265, 14.163, -16.898, -5.743 ], "bp_params": [ -0.130, -0.005, 0.265, 14.458, -16.646, -5.759 ], "frame": { "rmsd": null, "origin": [ 19.738, 42.948, 92.576 ], "x_axis": [ -0.726, 0.195, -0.660 ], "y_axis": [ -0.631, 0.194, 0.751 ], "z_axis": [ 0.275, 0.961, -0.018 ], "quaternion": [ 0.336, -0.156, 0.696, 0.615 ] } }, { "index": 229, "nt1": "///H/8", "nt2": "///S/50", "bp": "A+U", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": false, "chi1": -164.262, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 93.741, "chi2": -161.593, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 24.621, "C1C1_dist": 8.050, "N1N9_dist": 7.064, "C6C8_dist": 8.654, "CNNC_torsion": 154.142, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O4(carbonyl)[2.37],N3-N3(imino)[3.25]", "interBase_angle": 30.073, "planarity": 0.374, "simple_Shear": 3.862, "simple_Stretch": 2.033, "simple_Buckle": -28.268, "simple_Propeller": -10.261, "bp_simpleParams": [ 3.862, 2.033, -1.290, -28.268, -10.261, -102.614 ], "bp_params": [ -0.235, -4.358, -1.290, 5.851, 29.498, -104.407 ], "frame": { "rmsd": null, "origin": [ 20.387, 43.425, 94.789 ], "x_axis": [ -0.737, 0.663, 0.134 ], "y_axis": [ 0.100, -0.089, 0.991 ], "z_axis": [ 0.669, 0.743, -0.001 ], "quaternion": [ 0.208, 0.297, 0.642, 0.676 ] } }, { "index": 230, "nt1": "///H/9", "nt2": "///S/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -164.155, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.552, "chi2": -160.747, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.997, "C1C1_dist": 10.732, "N1N9_dist": 9.054, "C6C8_dist": 10.015, "CNNC_torsion": -17.996, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.30],N1-N3(imino)[3.17]", "interBase_angle": 26.627, "planarity": 0.322, "simple_Shear": -0.269, "simple_Stretch": 0.196, "simple_Buckle": 16.604, "simple_Propeller": -20.816, "bp_simpleParams": [ -0.269, 0.196, 0.228, 16.604, -20.816, 1.593 ], "bp_params": [ -0.276, 0.186, 0.228, 17.325, -20.219, 1.600 ], "frame": { "rmsd": null, "origin": [ 20.640, 45.988, 91.263 ], "x_axis": [ -0.970, 0.136, -0.202 ], "y_axis": [ -0.192, 0.086, 0.978 ], "z_axis": [ 0.151, 0.987, -0.057 ], "quaternion": [ 0.121, -0.019, 0.727, 0.676 ] } }, { "index": 231, "nt1": "///H/10", "nt2": "///S/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -163.571, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.227, "chi2": -173.113, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.973, "C1C1_dist": 10.463, "N1N9_dist": 8.850, "C6C8_dist": 9.869, "CNNC_torsion": -21.069, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.68],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[3.12]", "interBase_angle": 20.013, "planarity": 0.263, "simple_Shear": 0.490, "simple_Stretch": -0.137, "simple_Buckle": -0.732, "simple_Propeller": -19.999, "bp_simpleParams": [ 0.490, -0.137, 0.456, -0.732, -19.999, 3.794 ], "bp_params": [ 0.483, -0.160, 0.456, -1.657, -19.944, 3.852 ], "frame": { "rmsd": null, "origin": [ 20.417, 49.555, 89.746 ], "x_axis": [ -0.866, -0.011, 0.500 ], "y_axis": [ 0.500, -0.009, 0.866 ], "z_axis": [ -0.005, 1.000, 0.013 ], "quaternion": [ -0.186, 0.180, 0.679, 0.687 ] } }, { "index": 232, "nt1": "///H/11", "nt2": "///S/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": false, "chi1": -166.645, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.650, "chi2": -166.056, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.318, "C1C1_dist": 10.893, "N1N9_dist": 9.145, "C6C8_dist": 10.038, "CNNC_torsion": -15.555, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.07],O4(carbonyl)-N6(amino)[3.12]", "interBase_angle": 15.439, "planarity": 0.199, "simple_Shear": -0.524, "simple_Stretch": 0.127, "simple_Buckle": -8.126, "simple_Propeller": -13.128, "bp_simpleParams": [ -0.524, 0.127, 0.413, -8.126, -13.128, -2.880 ], "bp_params": [ -0.530, 0.100, 0.413, -7.408, -13.546, -2.895 ], "frame": { "rmsd": null, "origin": [ 19.476, 52.792, 88.027 ], "x_axis": [ -0.551, -0.123, 0.825 ], "y_axis": [ 0.830, 0.022, 0.558 ], "z_axis": [ -0.087, 0.992, 0.090 ], "quaternion": [ -0.375, 0.290, 0.609, 0.636 ] } }, { "index": 233, "nt1": "///H/11", "nt2": "///S/111", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cSS", "DSSR": "cm-m", "intra_chain": false, "chi1": -166.645, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 150.066, "chi2": -138.281, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 99.841, "C1C1_dist": 5.438, "N1N9_dist": 7.090, "C6C8_dist": 9.622, "CNNC_torsion": -40.643, "hbonds_num": 4, "hbonds_desc": "O3'-O2'(hydroxyl)[3.04],O2'(hydroxyl)-O2'(hydroxyl)[3.20],O2'(hydroxyl)-N3[2.71],O2(carbonyl)-N2(amino)[2.68]", "interBase_angle": 25.878, "planarity": 0.370, "simple_Shear": 0.460, "simple_Stretch": 7.625, "simple_Buckle": -14.955, "simple_Propeller": -21.119, "bp_simpleParams": [ 0.460, 7.625, -0.065, -14.955, -21.119, 157.691 ], "bp_params": [ 1.999, 7.373, -0.065, -18.884, -17.694, 157.648 ], "frame": { "rmsd": null, "origin": [ 22.055, 52.618, 84.920 ], "x_axis": [ -0.913, -0.112, -0.393 ], "y_axis": [ -0.407, 0.151, 0.901 ], "z_axis": [ -0.042, 0.982, -0.184 ], "quaternion": [ 0.117, -0.173, 0.750, 0.628 ] } }, { "index": 234, "nt1": "///S/12", "nt2": "///S/22", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.217, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.249, "chi2": -157.661, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.031, "C1C1_dist": 10.809, "N1N9_dist": 9.045, "C6C8_dist": 9.914, "CNNC_torsion": -12.351, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.25],N1(imino)-N3[3.14],N2(amino)-O2(carbonyl)[3.27]", "interBase_angle": 18.846, "planarity": 0.214, "simple_Shear": -1.124, "simple_Stretch": -0.055, "simple_Buckle": -10.863, "simple_Propeller": -15.400, "bp_simpleParams": [ -1.124, -0.055, -0.001, -10.863, -15.400, -2.889 ], "bp_params": [ -1.113, -0.171, -0.001, -9.192, -16.452, -2.909 ], "frame": { "rmsd": null, "origin": [ 17.177, 55.740, 87.457 ], "x_axis": [ -0.054, -0.209, 0.976 ], "y_axis": [ 0.983, 0.160, 0.089 ], "z_axis": [ -0.175, 0.965, 0.197 ], "quaternion": [ 0.571, -0.384, -0.504, -0.522 ] } }, { "index": 235, "nt1": "///S/13", "nt2": "///S/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.115, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.836, "chi2": -162.753, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 63.958, "C1C1_dist": 10.869, "N1N9_dist": 9.307, "C6C8_dist": 10.401, "CNNC_torsion": -20.170, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O2(carbonyl)[3.10]", "interBase_angle": 20.171, "planarity": 0.268, "simple_Shear": -1.261, "simple_Stretch": 0.485, "simple_Buckle": -2.970, "simple_Propeller": -19.951, "bp_simpleParams": [ -1.261, 0.485, 0.517, -2.970, -19.951, 8.782 ], "bp_params": [ -1.310, 0.330, 0.517, -0.520, -20.165, 8.919 ], "frame": { "rmsd": null, "origin": [ 15.235, 58.213, 88.480 ], "x_axis": [ 0.511, -0.120, 0.851 ], "y_axis": [ 0.852, 0.199, -0.483 ], "z_axis": [ -0.112, 0.972, 0.204 ], "quaternion": [ 0.692, -0.526, -0.348, -0.351 ] } }, { "index": 236, "nt1": "///S/14", "nt2": "///S/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.944, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.178, "chi2": -178.877, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.644, "C1C1_dist": 10.921, "N1N9_dist": 9.266, "C6C8_dist": 10.294, "CNNC_torsion": -22.735, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.02],N3-N1(imino)[3.37],N4(amino)-O6(carbonyl)[3.79]", "interBase_angle": 27.358, "planarity": 0.345, "simple_Shear": 0.732, "simple_Stretch": 0.363, "simple_Buckle": 13.806, "simple_Propeller": -23.619, "bp_simpleParams": [ 0.732, 0.363, 0.381, 13.806, -23.619, 5.818 ], "bp_params": [ 0.752, 0.321, 0.381, 12.340, -24.417, 5.919 ], "frame": { "rmsd": null, "origin": [ 14.204, 60.837, 90.068 ], "x_axis": [ 0.920, 0.134, 0.368 ], "y_axis": [ 0.326, 0.261, -0.909 ], "z_axis": [ -0.218, 0.956, 0.197 ], "quaternion": [ 0.771, -0.605, -0.190, -0.062 ] } }, { "index": 237, "nt1": "///S/15", "nt2": "///S/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.733, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 40.899, "chi2": -170.452, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 60.859, "C1C1_dist": 11.096, "N1N9_dist": 9.257, "C6C8_dist": 9.977, "CNNC_torsion": -17.049, "hbonds_num": 2, "hbonds_desc": "N6(amino)*N3(imino)[3.26],N1*O2(carbonyl)[3.38]", "unusual_base2base_hbonds": 1, "interBase_angle": 32.904, "planarity": 0.403, "simple_Shear": -1.645, "simple_Stretch": 0.455, "simple_Buckle": 22.878, "simple_Propeller": -23.649, "bp_simpleParams": [ -1.645, 0.455, 0.474, 22.878, -23.649, -8.170 ], "bp_params": [ -1.701, 0.140, 0.474, 26.880, -18.977, -8.063 ], "frame": { "rmsd": null, "origin": [ 13.229, 62.929, 91.825 ], "x_axis": [ 0.999, 0.026, -0.044 ], "y_axis": [ -0.049, 0.245, -0.968 ], "z_axis": [ -0.015, 0.969, 0.246 ], "quaternion": [ 0.789, -0.614, 0.009, 0.024 ] } }, { "index": 238, "nt1": "///S/16", "nt2": "///S/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.701, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.085, "chi2": 179.699, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.913, "C1C1_dist": 11.034, "N1N9_dist": 9.055, "C6C8_dist": 9.662, "CNNC_torsion": -4.325, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.50],N3-N1(imino)[3.10],N4(amino)-O6(carbonyl)[2.59]", "interBase_angle": 13.165, "planarity": 0.139, "simple_Shear": 0.790, "simple_Stretch": -0.226, "simple_Buckle": 9.524, "simple_Propeller": -9.089, "bp_simpleParams": [ 0.790, -0.226, -0.239, 9.524, -9.089, -13.634 ], "bp_params": [ 0.772, -0.283, -0.239, 8.838, -9.757, -13.643 ], "frame": { "rmsd": null, "origin": [ 14.119, 65.976, 94.724 ], "x_axis": [ 0.637, 0.017, -0.771 ], "y_axis": [ -0.747, 0.262, -0.611 ], "z_axis": [ 0.191, 0.965, 0.179 ], "quaternion": [ 0.721, -0.547, 0.334, 0.265 ] } }, { "index": 239, "nt1": "///S/17", "nt2": "///S/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.518, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.940, "chi2": -171.606, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.568, "C1C1_dist": 10.532, "N1N9_dist": 8.850, "C6C8_dist": 9.808, "CNNC_torsion": -3.218, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.67],N3-N1(imino)[2.92],N4(amino)-O6(carbonyl)[2.99]", "interBase_angle": 3.512, "planarity": 0.114, "simple_Shear": 0.603, "simple_Stretch": -0.185, "simple_Buckle": 3.462, "simple_Propeller": 0.591, "bp_simpleParams": [ 0.603, -0.185, 0.344, 3.462, 0.591, 2.462 ], "bp_params": [ 0.592, -0.218, 0.344, 3.489, 0.399, 2.461 ], "frame": { "rmsd": null, "origin": [ 16.878, 68.852, 95.208 ], "x_axis": [ 0.160, -0.036, -0.986 ], "y_axis": [ -0.963, 0.212, -0.164 ], "z_axis": [ 0.215, 0.977, -0.001 ], "quaternion": [ 0.585, -0.487, 0.513, 0.396 ] } }, { "index": 240, "nt1": "///S/17", "nt2": "///S/17", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cSW", "DSSR": "cm-W", "intra_chain": true, "chi1": -145.369, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 117.190, "chi2": -94.712, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 97.933, "C1C1_dist": 6.964, "N1N9_dist": 7.867, "C6C8_dist": 9.936, "CNNC_torsion": 8.715, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.18]", "interBase_angle": 72.925, "planarity": 0.670, "simple_Shear": 0.474, "simple_Stretch": 4.641, "simple_Buckle": 64.531, "simple_Propeller": 33.968, "bp_simpleParams": [ 0.474, 4.641, -4.233, 64.531, 33.968, 116.324 ], "bp_params": [ 1.136, 4.525, -4.233, 69.600, 21.772, 106.661 ], "frame": { "rmsd": null, "origin": [ 20.766, 76.342, 89.661 ], "x_axis": [ -0.372, -0.016, -0.928 ], "y_axis": [ -0.922, -0.109, 0.372 ], "z_axis": [ -0.107, 0.994, 0.026 ], "quaternion": [ 0.369, -0.421, 0.556, 0.614 ] } }, { "index": 241, "nt1": "///S/24", "nt2": "///S/112", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "intra_chain": true, "chi1": -173.113, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 87.321, "chi2": -125.117, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.321, "C1C1_dist": 8.395, "N1N9_dist": 7.987, "C6C8_dist": 10.201, "CNNC_torsion": 160.118, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.53],N2(amino)-N3[2.76]", "interBase_angle": 23.794, "planarity": 0.272, "simple_Shear": 6.799, "simple_Stretch": 3.509, "simple_Buckle": 18.545, "simple_Propeller": -14.908, "bp_simpleParams": [ 6.799, 3.509, 0.474, 18.545, -14.908, -152.160 ], "bp_params": [ -2.373, -7.274, 0.474, -23.667, -2.456, -151.586 ], "frame": { "rmsd": null, "origin": [ 22.573, 49.440, 86.368 ], "x_axis": [ -0.670, -0.023, -0.742 ], "y_axis": [ 0.742, -0.027, -0.669 ], "z_axis": [ -0.004, -0.999, 0.035 ], "quaternion": [ -0.291, -0.284, -0.634, 0.658 ] } }, { "index": 242, "nt1": "///S/27", "nt2": "///S/52", "bp": "G+C", "name": "--", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -138.496, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 149.165, "chi2": -163.225, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 16.926, "C1C1_dist": 8.543, "N1N9_dist": 8.385, "C6C8_dist": 8.816, "CNNC_torsion": 13.453, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N4(amino)[2.93],N3-N4(amino)[3.84]", "interBase_angle": 29.881, "planarity": 0.347, "simple_Shear": 0.413, "simple_Stretch": 7.002, "simple_Buckle": -7.096, "simple_Propeller": -29.026, "bp_simpleParams": [ 0.413, 7.002, 0.501, -7.096, -29.026, -19.657 ], "bp_params": [ 6.534, -2.550, 0.501, -25.500, 15.576, -19.365 ], "frame": { "rmsd": null, "origin": [ 18.399, 40.537, 91.809 ], "x_axis": [ 0.152, -0.124, -0.980 ], "y_axis": [ 0.723, -0.662, 0.196 ], "z_axis": [ -0.674, -0.739, -0.011 ], "quaternion": [ 0.346, 0.676, 0.222, -0.612 ] } }, { "index": 243, "nt1": "///S/28", "nt2": "///S/29", "bp": "A+C", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -81.291, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 142.709, "chi2": 179.985, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 40.773, "C1C1_dist": 6.879, "N1N9_dist": 6.918, "C6C8_dist": 6.958, "CNNC_torsion": 34.361, "hbonds_num": 1, "hbonds_desc": "N3-N4(amino)[3.16]", "interBase_angle": 35.293, "planarity": 0.416, "simple_Shear": -0.128, "simple_Stretch": 7.376, "simple_Buckle": 1.682, "simple_Propeller": 35.253, "bp_simpleParams": [ -0.128, 7.376, -1.879, 1.682, 35.253, 6.527 ], "bp_params": [ 7.332, 0.815, -1.879, 35.254, 1.663, 6.222 ], "frame": { "rmsd": null, "origin": [ 26.627, 25.932, 94.979 ], "x_axis": [ -0.903, 0.329, 0.276 ], "y_axis": [ 0.036, 0.699, -0.714 ], "z_axis": [ -0.428, -0.635, -0.643 ], "quaternion": [ -0.195, 0.101, 0.901, -0.375 ] } }, { "index": 244, "nt1": "///S/29", "nt2": "///S/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 179.985, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.239, "chi2": 176.784, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.151, "C1C1_dist": 10.659, "N1N9_dist": 8.995, "C6C8_dist": 9.956, "CNNC_torsion": -5.300, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[3.06],N4(amino)-O6(carbonyl)[3.14]", "interBase_angle": 16.567, "planarity": 0.191, "simple_Shear": 0.224, "simple_Stretch": 0.007, "simple_Buckle": -15.932, "simple_Propeller": 4.543, "bp_simpleParams": [ 0.224, 0.007, 0.833, -15.932, 4.543, 2.613 ], "bp_params": [ 0.224, 0.003, 0.833, -15.872, 4.747, 2.590 ], "frame": { "rmsd": null, "origin": [ 29.774, 24.037, 93.946 ], "x_axis": [ -0.934, 0.235, 0.269 ], "y_axis": [ 0.040, 0.817, -0.575 ], "z_axis": [ -0.355, -0.526, -0.773 ], "quaternion": [ -0.166, 0.073, 0.939, -0.293 ] } }, { "index": 245, "nt1": "///S/30", "nt2": "///S/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 169.308, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.765, "chi2": -167.069, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.880, "C1C1_dist": 10.831, "N1N9_dist": 9.013, "C6C8_dist": 9.820, "CNNC_torsion": -9.425, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.79],N1(imino)-N3[3.01],N2(amino)-O2(carbonyl)[3.00]", "interBase_angle": 9.128, "planarity": 0.120, "simple_Shear": -0.423, "simple_Stretch": -0.161, "simple_Buckle": 0.281, "simple_Propeller": -9.124, "bp_simpleParams": [ -0.423, -0.161, 0.206, 0.281, -9.124, -4.729 ], "bp_params": [ -0.416, -0.177, 0.206, 0.631, -9.106, -4.744 ], "frame": { "rmsd": null, "origin": [ 28.799, 21.303, 92.479 ], "x_axis": [ -0.851, 0.516, 0.097 ], "y_axis": [ 0.317, 0.651, -0.690 ], "z_axis": [ -0.419, -0.556, -0.717 ], "quaternion": [ -0.144, 0.232, 0.897, -0.347 ] } }, { "index": 246, "nt1": "///S/30", "nt2": "///S/123", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": 169.308, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 96.883, "chi2": -162.688, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.506, "C1C1_dist": 10.124, "N1N9_dist": 9.478, "C6C8_dist": 11.070, "CNNC_torsion": 117.674, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N1[2.78]", "interBase_angle": 65.083, "planarity": 0.891, "simple_Shear": 3.053, "simple_Stretch": 4.561, "simple_Buckle": -44.099, "simple_Propeller": -47.865, "bp_simpleParams": [ 3.053, 4.561, -0.743, -44.099, -47.865, -106.128 ], "bp_params": [ 2.522, -4.875, -0.743, -20.971, 61.612, -113.313 ], "frame": { "rmsd": null, "origin": [ 31.384, 19.903, 92.082 ], "x_axis": [ -0.445, 0.383, -0.809 ], "y_axis": [ 0.836, -0.146, -0.529 ], "z_axis": [ -0.321, -0.912, -0.255 ], "quaternion": [ 0.196, 0.489, 0.623, -0.578 ] } }, { "index": 247, "nt1": "///S/31", "nt2": "///S/43", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.576, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.220, "chi2": -170.929, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.905, "C1C1_dist": 10.575, "N1N9_dist": 8.898, "C6C8_dist": 9.847, "CNNC_torsion": -6.365, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.91],N1-N3(imino)[2.87]", "interBase_angle": 8.811, "planarity": 0.104, "simple_Shear": -0.013, "simple_Stretch": -0.095, "simple_Buckle": -0.755, "simple_Propeller": -8.778, "bp_simpleParams": [ -0.013, -0.095, -0.019, -0.755, -8.778, 0.428 ], "bp_params": [ -0.013, -0.095, -0.019, -0.777, -8.776, 0.429 ], "frame": { "rmsd": null, "origin": [ 26.530, 18.274, 91.617 ], "x_axis": [ -0.472, 0.823, -0.317 ], "y_axis": [ 0.782, 0.224, -0.581 ], "z_axis": [ -0.407, -0.522, -0.749 ], "quaternion": [ -0.029, 0.513, 0.782, -0.353 ] } }, { "index": 248, "nt1": "///S/35", "nt2": "///S/65", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.880, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.908, "chi2": 170.545, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 42.159, "C1C1_dist": 11.509, "N1N9_dist": 9.467, "C6C8_dist": 10.050, "CNNC_torsion": -13.123, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.69],N1(imino)-N3[3.20],N2(amino)-O2(carbonyl)[3.60]", "interBase_angle": 13.973, "planarity": 0.197, "simple_Shear": 0.656, "simple_Stretch": 0.150, "simple_Buckle": 9.171, "simple_Propeller": -10.542, "bp_simpleParams": [ 0.656, 0.150, 0.153, 9.171, -10.542, -14.083 ], "bp_params": [ 0.665, 0.107, 0.153, 8.454, -11.125, -14.111 ], "frame": { "rmsd": null, "origin": [ 9.315, 1.053, 88.610 ], "x_axis": [ 0.715, 0.054, 0.697 ], "y_axis": [ 0.644, 0.338, -0.686 ], "z_axis": [ -0.272, 0.940, 0.207 ], "quaternion": [ 0.751, -0.541, -0.323, -0.196 ] } }, { "index": 249, "nt1": "///S/36", "nt2": "///S/64", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.121, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.953, "chi2": -169.365, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.426, "C1C1_dist": 10.554, "N1N9_dist": 8.826, "C6C8_dist": 9.717, "CNNC_torsion": -12.235, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-O2(carbonyl)[3.16],N1(imino)-N3[2.99],N2(amino)-O2(carbonyl)[2.93]", "interBase_angle": 15.595, "planarity": 0.191, "simple_Shear": -1.057, "simple_Stretch": -0.240, "simple_Buckle": -3.609, "simple_Propeller": -15.172, "bp_simpleParams": [ -1.057, -0.240, 0.060, -3.609, -15.172, -0.616 ], "bp_params": [ -1.028, -0.344, 0.060, -2.052, -15.460, -0.622 ], "frame": { "rmsd": null, "origin": [ 7.718, 3.632, 91.127 ], "x_axis": [ 0.956, 0.039, 0.290 ], "y_axis": [ 0.266, 0.299, -0.917 ], "z_axis": [ -0.122, 0.953, 0.275 ], "quaternion": [ 0.795, -0.588, -0.130, -0.071 ] } }, { "index": 250, "nt1": "///S/37", "nt2": "///S/63", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.432, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.523, "chi2": -160.845, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 62.531, "C1C1_dist": 10.783, "N1N9_dist": 9.059, "C6C8_dist": 9.916, "CNNC_torsion": -14.364, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.14],N1(imino)-O2(carbonyl)[3.14]", "interBase_angle": 15.183, "planarity": 0.200, "simple_Shear": -1.693, "simple_Stretch": 0.055, "simple_Buckle": -0.976, "simple_Propeller": -15.152, "bp_simpleParams": [ -1.693, 0.055, 0.282, -0.976, -15.152, -3.486 ], "bp_params": [ -1.679, -0.225, 0.282, 1.548, -15.104, -3.516 ], "frame": { "rmsd": null, "origin": [ 7.597, 6.048, 93.372 ], "x_axis": [ 0.960, 0.062, -0.273 ], "y_axis": [ -0.280, 0.200, -0.939 ], "z_axis": [ -0.004, 0.978, 0.209 ], "quaternion": [ 0.769, -0.623, 0.087, 0.111 ] } }, { "index": 251, "nt1": "///S/38", "nt2": "///S/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.167, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.439, "chi2": -153.133, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.610, "C1C1_dist": 10.750, "N1N9_dist": 9.076, "C6C8_dist": 10.053, "CNNC_torsion": -16.853, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.23],N1(imino)-N3[3.02],N2(amino)-O2(carbonyl)[2.85],N2(amino)-N3[3.24]", "interBase_angle": 25.940, "planarity": 0.297, "simple_Shear": 0.302, "simple_Stretch": 0.096, "simple_Buckle": -11.149, "simple_Propeller": -23.422, "bp_simpleParams": [ 0.302, 0.096, -0.110, -11.149, -23.422, 4.099 ], "bp_params": [ 0.306, 0.082, -0.110, -12.123, -22.933, 4.160 ], "frame": { "rmsd": null, "origin": [ 8.804, 9.446, 94.681 ], "x_axis": [ 0.545, -0.015, -0.838 ], "y_axis": [ -0.819, 0.206, -0.536 ], "z_axis": [ 0.181, 0.978, 0.100 ], "quaternion": [ 0.680, -0.556, 0.374, 0.295 ] } }, { "index": 252, "nt1": "///S/39", "nt2": "///S/61", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.694, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.463, "chi2": -155.333, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.813, "C1C1_dist": 10.555, "N1N9_dist": 8.947, "C6C8_dist": 10.011, "CNNC_torsion": -21.217, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.03],O4(carbonyl)-N6(amino)[3.41]", "interBase_angle": 25.103, "planarity": 0.305, "simple_Shear": -0.009, "simple_Stretch": 0.136, "simple_Buckle": -11.147, "simple_Propeller": -22.492, "bp_simpleParams": [ -0.009, 0.136, 0.251, -11.147, -22.492, 6.032 ], "bp_params": [ -0.009, 0.136, 0.251, -11.147, -22.492, 6.122 ], "frame": { "rmsd": null, "origin": [ 10.337, 12.262, 94.923 ], "x_axis": [ 0.003, -0.066, -0.998 ], "y_axis": [ -0.981, 0.191, -0.015 ], "z_axis": [ 0.192, 0.979, -0.065 ], "quaternion": [ 0.531, -0.468, 0.560, 0.431 ] } }, { "index": 253, "nt1": "///S/40", "nt2": "///S/60", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.101, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 64.939, "chi2": -173.746, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 39.362, "C1C1_dist": 10.870, "N1N9_dist": 9.116, "C6C8_dist": 9.886, "CNNC_torsion": -15.083, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.13],N3(imino)-O6(carbonyl)[3.03]", "interBase_angle": 13.068, "planarity": 0.196, "simple_Shear": 2.464, "simple_Stretch": 0.204, "simple_Buckle": -7.832, "simple_Propeller": -10.461, "bp_simpleParams": [ 2.464, 0.204, 0.850, -7.832, -10.461, -7.096 ], "bp_params": [ 2.438, -0.412, 0.850, -10.172, -8.204, -7.086 ], "frame": { "rmsd": null, "origin": [ 11.742, 15.298, 94.601 ], "x_axis": [ -0.708, -0.017, -0.706 ], "y_axis": [ -0.696, 0.182, 0.694 ], "z_axis": [ 0.117, 0.983, -0.141 ], "quaternion": [ 0.289, -0.250, 0.713, 0.588 ] } }, { "index": 254, "nt1": "///S/45", "nt2": "///S/98", "bp": "G+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": 176.784, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 101.503, "chi2": -146.295, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 48.343, "C1C1_dist": 10.068, "N1N9_dist": 9.627, "C6C8_dist": 11.405, "CNNC_torsion": 119.677, "hbonds_num": 1, "hbonds_desc": "N2(amino)-N1[3.22]", "interBase_angle": 63.651, "planarity": 0.857, "simple_Shear": 3.629, "simple_Stretch": 4.862, "simple_Buckle": -33.952, "simple_Propeller": -53.840, "bp_simpleParams": [ 3.629, 4.862, 0.004, -33.952, -53.840, -113.130 ], "bp_params": [ 2.087, -5.697, 0.004, -27.856, 57.233, -118.126 ], "frame": { "rmsd": null, "origin": [ 32.919, 23.366, 93.947 ], "x_axis": [ -0.305, -0.133, 0.943 ], "y_axis": [ 0.904, -0.351, 0.243 ], "z_axis": [ 0.299, 0.927, 0.227 ], "quaternion": [ -0.378, 0.452, 0.426, 0.686 ] } }, { "index": 255, "nt1": "///S/46", "nt2": "///S/51", "bp": "A+U", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -169.143, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 30.907, "chi2": -141.423, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 40.543, "C1C1_dist": 11.183, "N1N9_dist": 8.962, "C6C8_dist": 9.878, "CNNC_torsion": -167.139, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.98],N1-N3(imino)[2.94]", "interBase_angle": 13.533, "planarity": 0.164, "simple_Shear": 1.205, "simple_Stretch": 0.126, "simple_Buckle": 11.742, "simple_Propeller": 6.727, "bp_simpleParams": [ 1.205, 0.126, 0.411, 11.742, 6.727, 168.006 ], "bp_params": [ 0.023, 1.211, 0.411, -5.222, 12.484, 168.064 ], "frame": { "rmsd": null, "origin": [ 30.976, 28.351, 94.733 ], "x_axis": [ -0.583, 0.781, -0.224 ], "y_axis": [ -0.730, -0.382, 0.567 ], "z_axis": [ 0.357, 0.494, 0.793 ], "quaternion": [ 0.455, 0.040, 0.320, 0.830 ] } }, { "index": 256, "nt1": "///S/66", "nt2": "///S/84", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.770, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.592, "chi2": -128.384, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.265, "C1C1_dist": 10.548, "N1N9_dist": 8.945, "C6C8_dist": 10.027, "CNNC_torsion": -17.616, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.69],N3-N1(imino)[3.01],N4(amino)-O6(carbonyl)[3.41]", "interBase_angle": 22.182, "planarity": 0.301, "simple_Shear": 0.352, "simple_Stretch": 0.075, "simple_Buckle": -9.627, "simple_Propeller": -19.984, "bp_simpleParams": [ 0.352, 0.075, 0.314, -9.627, -19.984, 7.673 ], "bp_params": [ 0.355, 0.061, 0.314, -10.305, -19.643, 7.756 ], "frame": { "rmsd": null, "origin": [ 12.013, -1.636, 88.929 ], "x_axis": [ 0.046, 0.006, 0.999 ], "y_axis": [ -0.942, -0.334, 0.045 ], "z_axis": [ 0.334, -0.943, -0.010 ], "quaternion": [ 0.419, 0.589, -0.397, 0.565 ] } }, { "index": 257, "nt1": "///S/67", "nt2": "///S/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.165, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.676, "chi2": 176.179, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.376, "C1C1_dist": 10.647, "N1N9_dist": 8.993, "C6C8_dist": 9.970, "CNNC_torsion": -8.629, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.29],N1(imino)-N3[3.18],N2(amino)-O2(carbonyl)[2.91]", "interBase_angle": 4.917, "planarity": 0.152, "simple_Shear": -0.907, "simple_Stretch": -0.033, "simple_Buckle": 4.286, "simple_Propeller": -2.409, "bp_simpleParams": [ -0.907, -0.033, 0.821, 4.286, -2.409, 2.351 ], "bp_params": [ -0.901, -0.111, 0.821, 4.479, -2.029, 2.350 ], "frame": { "rmsd": null, "origin": [ 14.030, -4.026, 89.544 ], "x_axis": [ -0.458, -0.038, 0.888 ], "y_axis": [ -0.870, -0.186, -0.457 ], "z_axis": [ 0.183, -0.982, 0.052 ], "quaternion": [ 0.319, 0.411, -0.552, 0.651 ] } }, { "index": 258, "nt1": "///S/68", "nt2": "///S/82", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -179.134, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.698, "chi2": 176.759, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.496, "C1C1_dist": 11.023, "N1N9_dist": 9.378, "C6C8_dist": 10.453, "CNNC_torsion": -16.636, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.74],N1(imino)-N3[3.36],N2(amino)-O2(carbonyl)[2.91]", "interBase_angle": 18.479, "planarity": 0.235, "simple_Shear": 0.293, "simple_Stretch": 0.465, "simple_Buckle": -3.575, "simple_Propeller": -18.130, "bp_simpleParams": [ 0.293, 0.465, 0.296, -3.575, -18.130, 7.880 ], "bp_params": [ 0.310, 0.454, 0.296, -4.230, -17.988, 7.973 ], "frame": { "rmsd": null, "origin": [ 15.502, -6.879, 92.010 ], "x_axis": [ -0.878, -0.142, 0.457 ], "y_axis": [ -0.404, -0.291, -0.867 ], "z_axis": [ 0.257, -0.946, 0.198 ], "quaternion": [ 0.085, 0.232, -0.589, 0.769 ] } }, { "index": 259, "nt1": "///S/68", "nt2": "///S/87", "bp": "G+A", "name": "Linker", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -179.134, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 92.985, "chi2": -119.244, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.461, "C1C1_dist": 8.409, "N1N9_dist": 8.155, "C6C8_dist": 10.363, "CNNC_torsion": 150.916, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N1[2.60],N2(amino)-N3[3.66]", "interBase_angle": 37.970, "planarity": 0.430, "simple_Shear": 7.018, "simple_Stretch": 4.072, "simple_Buckle": 28.511, "simple_Propeller": -25.076, "bp_simpleParams": [ 7.018, 4.072, 1.308, 28.511, -25.076, -147.579 ], "bp_params": [ -2.527, -7.711, 1.308, -37.968, -0.358, -145.821 ], "frame": { "rmsd": null, "origin": [ 17.551, -7.227, 88.469 ], "x_axis": [ -0.593, -0.313, -0.742 ], "y_axis": [ 0.796, -0.089, -0.599 ], "z_axis": [ 0.122, -0.946, 0.302 ], "quaternion": [ -0.394, -0.220, -0.548, 0.704 ] } }, { "index": 260, "nt1": "///S/69", "nt2": "///S/81", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -176.373, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 45.480, "chi2": -175.668, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.083, "C1C1_dist": 11.626, "N1N9_dist": 9.725, "C6C8_dist": 10.470, "CNNC_torsion": -4.918, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N6(amino)[3.37]", "interBase_angle": 14.274, "planarity": 0.179, "simple_Shear": -0.929, "simple_Stretch": 0.659, "simple_Buckle": -13.767, "simple_Propeller": -3.773, "bp_simpleParams": [ -0.929, 0.659, 0.091, -13.767, -3.773, -7.958 ], "bp_params": [ -0.987, 0.567, 0.091, -13.351, -5.051, -7.912 ], "frame": { "rmsd": null, "origin": [ 18.429, -9.121, 94.858 ], "x_axis": [ -0.982, -0.179, 0.060 ], "y_axis": [ -0.025, -0.191, -0.981 ], "z_axis": [ 0.187, -0.965, 0.183 ], "quaternion": [ -0.050, 0.081, -0.634, 0.767 ] } }, { "index": 261, "nt1": "///S/70", "nt2": "///S/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.742, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.075, "chi2": -162.693, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.613, "C1C1_dist": 11.005, "N1N9_dist": 9.270, "C6C8_dist": 10.213, "CNNC_torsion": -4.290, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.24],O4(carbonyl)-N6(amino)[3.34]", "interBase_angle": 4.353, "planarity": 0.074, "simple_Shear": 0.055, "simple_Stretch": 0.276, "simple_Buckle": 3.462, "simple_Propeller": -2.640, "bp_simpleParams": [ 0.055, 0.276, 0.159, 3.462, -2.640, 0.325 ], "bp_params": [ 0.055, 0.276, 0.159, 3.460, -2.642, 0.325 ], "frame": { "rmsd": null, "origin": [ 18.274, -11.751, 96.623 ], "x_axis": [ -0.831, -0.187, -0.524 ], "y_axis": [ 0.535, -0.012, -0.845 ], "z_axis": [ 0.152, -0.982, 0.110 ], "quaternion": [ -0.258, -0.133, -0.654, 0.699 ] } }, { "index": 262, "nt1": "///S/70", "nt2": "///S/135", "bp": "U+G", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -165.742, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 99.871, "chi2": -158.544, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 40.581, "C1C1_dist": 9.831, "N1N9_dist": 9.292, "C6C8_dist": 11.058, "CNNC_torsion": 162.320, "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O6(carbonyl)[3.12],O2'(hydroxyl)-N1(imino)[3.34],O2(carbonyl)-N2(amino)[3.04]", "interBase_angle": 33.053, "planarity": 0.443, "simple_Shear": 5.475, "simple_Stretch": 4.758, "simple_Buckle": 32.185, "simple_Propeller": -7.523, "bp_simpleParams": [ 5.475, 4.758, 0.127, 32.185, -7.523, -115.892 ], "bp_params": [ 0.146, -7.252, 0.127, -26.283, -20.042, -115.297 ], "frame": { "rmsd": null, "origin": [ 21.957, -12.037, 96.599 ], "x_axis": [ 0.008, 0.027, -1.000 ], "y_axis": [ 0.997, -0.073, 0.006 ], "z_axis": [ -0.072, -0.997, -0.028 ], "quaternion": [ 0.476, 0.527, 0.487, -0.509 ] } }, { "index": 263, "nt1": "///S/71", "nt2": "///S/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.993, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 60.457, "chi2": -168.128, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.676, "C1C1_dist": 10.967, "N1N9_dist": 9.397, "C6C8_dist": 10.496, "CNNC_torsion": -11.193, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.72],N1(imino)-N3[3.39],N2(amino)-O2(carbonyl)[2.97]", "interBase_angle": 14.048, "planarity": 0.175, "simple_Shear": 0.182, "simple_Stretch": 0.497, "simple_Buckle": -1.226, "simple_Propeller": -13.994, "bp_simpleParams": [ 0.182, 0.497, 0.027, -1.226, -13.994, 8.001 ], "bp_params": [ 0.194, 0.493, 0.027, -1.556, -13.961, 8.060 ], "frame": { "rmsd": null, "origin": [ 16.460, -14.653, 96.931 ], "x_axis": [ -0.370, 0.125, -0.921 ], "y_axis": [ 0.923, -0.068, -0.380 ], "z_axis": [ -0.110, -0.990, -0.090 ], "quaternion": [ 0.344, 0.444, 0.590, -0.580 ] } }, { "index": 264, "nt1": "///S/73", "nt2": "///S/141", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 178.793, "conf1": "--", "pucker1": "~C3'-endo", "lambda1": 62.560, "chi2": -148.438, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.301, "C1C1_dist": 10.782, "N1N9_dist": 9.276, "C6C8_dist": 10.359, "CNNC_torsion": -17.995, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[3.57]", "interBase_angle": 33.480, "planarity": 0.381, "simple_Shear": 0.371, "simple_Stretch": 0.745, "simple_Buckle": -29.019, "simple_Propeller": -16.698, "bp_simpleParams": [ 0.371, 0.745, 0.875, -29.019, -16.698, 7.306 ], "bp_params": [ 0.409, 0.725, 0.875, -29.932, -14.999, 7.124 ], "frame": { "rmsd": null, "origin": [ 19.719, -28.815, 90.782 ], "x_axis": [ -0.024, -0.029, 0.999 ], "y_axis": [ 0.707, 0.706, 0.038 ], "z_axis": [ -0.706, 0.708, 0.004 ], "quaternion": [ 0.649, -0.258, -0.657, -0.284 ] } }, { "index": 265, "nt1": "///S/74", "nt2": "///S/140", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.942, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.438, "chi2": -158.012, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 71.622, "C1C1_dist": 10.368, "N1N9_dist": 9.133, "C6C8_dist": 10.525, "CNNC_torsion": -23.271, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.66],N3-N2(amino)[2.70]", "interBase_angle": 24.000, "planarity": 0.336, "simple_Shear": -0.924, "simple_Stretch": 0.692, "simple_Buckle": 1.192, "simple_Propeller": -23.970, "bp_simpleParams": [ -0.924, 0.692, 0.907, 1.192, -23.970, 20.304 ], "bp_params": [ -0.990, 0.593, 0.907, 3.636, -23.723, 20.728 ], "frame": { "rmsd": null, "origin": [ 17.441, -27.928, 92.282 ], "x_axis": [ 0.341, 0.185, 0.922 ], "y_axis": [ 0.669, 0.642, -0.376 ], "z_axis": [ -0.661, 0.744, 0.095 ], "quaternion": [ 0.721, -0.389, -0.549, -0.168 ] } }, { "index": 266, "nt1": "///S/75", "nt2": "///S/139", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 165.931, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 37.462, "chi2": -171.323, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.351, "C1C1_dist": 11.355, "N1N9_dist": 9.326, "C6C8_dist": 9.897, "CNNC_torsion": -20.225, "hbonds_num": 2, "hbonds_desc": "N6(amino)*N3(imino)[3.23],N6(amino)-O4(carbonyl)[3.38]", "unusual_base2base_hbonds": 1, "interBase_angle": 7.491, "planarity": 0.254, "simple_Shear": -1.506, "simple_Stretch": 0.085, "simple_Buckle": 0.510, "simple_Propeller": -7.474, "bp_simpleParams": [ -1.506, 0.085, 1.151, 0.510, -7.474, -15.841 ], "bp_params": [ -1.502, -0.143, 1.151, 1.630, -7.312, -15.872 ], "frame": { "rmsd": null, "origin": [ 14.154, -26.377, 92.617 ], "x_axis": [ 0.791, 0.258, 0.554 ], "y_axis": [ 0.450, 0.368, -0.814 ], "z_axis": [ -0.414, 0.893, 0.174 ], "quaternion": [ 0.764, -0.559, -0.317, -0.063 ] } }, { "index": 267, "nt1": "///S/76", "nt2": "///S/138", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.101, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 66.930, "chi2": -154.283, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.313, "C1C1_dist": 10.408, "N1N9_dist": 8.995, "C6C8_dist": 10.240, "CNNC_torsion": -21.878, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)*N1[3.15],N3(imino)-N1[3.40]", "unusual_base2base_hbonds": 1, "interBase_angle": 20.319, "planarity": 0.294, "simple_Shear": 1.087, "simple_Stretch": 0.403, "simple_Buckle": -4.277, "simple_Propeller": -19.863, "bp_simpleParams": [ 1.087, 0.403, 1.021, -4.277, -19.863, 13.298 ], "bp_params": [ 1.125, 0.282, 1.021, -6.381, -19.291, 13.467 ], "frame": { "rmsd": null, "origin": [ 13.645, -23.268, 95.000 ], "x_axis": [ 0.930, 0.238, -0.282 ], "y_axis": [ -0.330, 0.193, -0.924 ], "z_axis": [ -0.165, 0.952, 0.258 ], "quaternion": [ 0.771, -0.608, 0.038, 0.184 ] } }, { "index": 268, "nt1": "///S/77", "nt2": "///S/137", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -161.763, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.510, "chi2": -175.026, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.833, "C1C1_dist": 10.851, "N1N9_dist": 9.115, "C6C8_dist": 10.039, "CNNC_torsion": -22.271, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.05],N3-N1(imino)[3.29],N4(amino)-O6(carbonyl)[3.51]", "interBase_angle": 19.486, "planarity": 0.339, "simple_Shear": 0.837, "simple_Stretch": 0.038, "simple_Buckle": 10.650, "simple_Propeller": -16.319, "bp_simpleParams": [ 0.837, 0.038, 0.943, 10.650, -16.319, -0.317 ], "bp_params": [ 0.837, -0.023, 0.943, 9.399, -17.070, -0.320 ], "frame": { "rmsd": null, "origin": [ 13.591, -20.888, 97.043 ], "x_axis": [ 0.624, 0.252, -0.739 ], "y_axis": [ -0.770, 0.039, -0.637 ], "z_axis": [ -0.132, 0.967, 0.219 ], "quaternion": [ 0.686, -0.585, 0.221, 0.373 ] } }, { "index": 269, "nt1": "///S/78", "nt2": "///S/136", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.060, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.027, "chi2": -164.403, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.648, "C1C1_dist": 11.585, "N1N9_dist": 9.610, "C6C8_dist": 10.231, "CNNC_torsion": -9.094, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.97],N1-N3(imino)[3.49]", "interBase_angle": 21.219, "planarity": 0.280, "simple_Shear": 0.348, "simple_Stretch": 0.450, "simple_Buckle": 15.943, "simple_Propeller": -14.002, "bp_simpleParams": [ 0.348, 0.450, -0.200, 15.943, -14.002, -13.547 ], "bp_params": [ 0.361, 0.439, -0.200, 15.538, -14.451, -13.532 ], "frame": { "rmsd": null, "origin": [ 14.636, -18.095, 98.562 ], "x_axis": [ 0.288, 0.118, -0.950 ], "y_axis": [ -0.955, 0.107, -0.276 ], "z_axis": [ 0.069, 0.987, 0.144 ], "quaternion": [ 0.620, -0.509, 0.411, 0.433 ] } }, { "index": 270, "nt1": "///S/88", "nt2": "///S/134", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 179.332, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 43.638, "chi2": 161.378, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.447, "C1C1_dist": 10.772, "N1N9_dist": 8.899, "C6C8_dist": 9.612, "CNNC_torsion": -16.652, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[3.11],N1(imino)-O2(carbonyl)[3.22]", "interBase_angle": 16.772, "planarity": 0.289, "simple_Shear": -1.337, "simple_Stretch": -0.300, "simple_Buckle": 16.483, "simple_Propeller": -3.099, "bp_simpleParams": [ -1.337, -0.300, 1.589, 16.483, -3.099, -8.556 ], "bp_params": [ -1.285, -0.473, 1.589, 16.749, -0.883, -8.465 ], "frame": { "rmsd": null, "origin": [ 29.856, -11.826, 99.773 ], "x_axis": [ 0.681, -0.140, -0.719 ], "y_axis": [ -0.686, 0.222, -0.693 ], "z_axis": [ 0.257, 0.965, 0.056 ], "quaternion": [ 0.700, -0.592, 0.348, 0.195 ] } }, { "index": 271, "nt1": "///S/89", "nt2": "///S/133", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.593, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.309, "chi2": 173.091, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 45.262, "C1C1_dist": 11.220, "N1N9_dist": 9.329, "C6C8_dist": 10.073, "CNNC_torsion": -10.701, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.57],N4(amino)-O6(carbonyl)[3.24]", "interBase_angle": 17.284, "planarity": 0.200, "simple_Shear": 1.156, "simple_Stretch": 0.176, "simple_Buckle": 12.529, "simple_Propeller": -11.907, "bp_simpleParams": [ 1.156, 0.176, -0.033, 12.529, -11.907, -6.483 ], "bp_params": [ 1.168, 0.052, -0.033, 11.198, -13.166, -6.496 ], "frame": { "rmsd": null, "origin": [ 32.747, -9.340, 100.266 ], "x_axis": [ 0.023, 0.069, -0.997 ], "y_axis": [ -0.884, 0.467, 0.012 ], "z_axis": [ 0.467, 0.881, 0.072 ], "quaternion": [ 0.625, -0.348, 0.586, 0.381 ] } }, { "index": 272, "nt1": "///S/90", "nt2": "///S/132", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -150.690, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.794, "chi2": -164.975, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 43.143, "C1C1_dist": 11.092, "N1N9_dist": 9.216, "C6C8_dist": 9.969, "CNNC_torsion": 0.571, "hbonds_num": 4, "hbonds_desc": "O2(carbonyl)*N1[3.32],N3(imino)*N6(amino)[3.27],N3(imino)-N1[3.56],O4(carbonyl)-N6(amino)[3.40]", "unusual_base2base_hbonds": 1, "interBase_angle": 15.418, "planarity": 0.177, "simple_Shear": 1.498, "simple_Stretch": 0.188, "simple_Buckle": 13.783, "simple_Propeller": -6.911, "bp_simpleParams": [ 1.498, 0.188, -0.763, 13.783, -6.911, -5.785 ], "bp_params": [ 1.510, -0.030, -0.763, 12.659, -8.801, -5.767 ], "frame": { "rmsd": null, "origin": [ 36.436, -7.748, 100.506 ], "x_axis": [ -0.504, 0.173, -0.846 ], "y_axis": [ -0.708, 0.478, 0.520 ], "z_axis": [ 0.494, 0.861, -0.118 ], "quaternion": [ 0.462, -0.185, 0.725, 0.477 ] } }, { "index": 273, "nt1": "///S/91", "nt2": "///S/131", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.283, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.173, "chi2": -173.278, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 67.856, "C1C1_dist": 10.877, "N1N9_dist": 9.434, "C6C8_dist": 10.654, "CNNC_torsion": -4.318, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N1[3.70]", "interBase_angle": 15.642, "planarity": 0.192, "simple_Shear": -1.063, "simple_Stretch": 0.919, "simple_Buckle": 13.638, "simple_Propeller": -7.660, "bp_simpleParams": [ -1.063, 0.919, 0.021, 13.638, -7.660, 13.929 ], "bp_params": [ -1.165, 0.787, 0.021, 14.456, -5.975, 13.838 ], "frame": { "rmsd": null, "origin": [ 37.848, -5.281, 97.422 ], "x_axis": [ -0.767, 0.248, -0.592 ], "y_axis": [ -0.502, 0.344, 0.793 ], "z_axis": [ 0.400, 0.906, -0.139 ], "quaternion": [ 0.331, -0.085, 0.750, 0.566 ] } }, { "index": 274, "nt1": "///S/92", "nt2": "///S/130", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.716, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.815, "chi2": 171.145, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 39.617, "C1C1_dist": 11.957, "N1N9_dist": 9.752, "C6C8_dist": 10.083, "CNNC_torsion": 1.236, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N6(amino)[2.84]", "interBase_angle": 22.303, "planarity": 0.332, "simple_Shear": 0.561, "simple_Stretch": 0.276, "simple_Buckle": 6.918, "simple_Propeller": -21.203, "bp_simpleParams": [ 0.561, 0.276, -1.602, 6.918, -21.203, -22.059 ], "bp_params": [ 0.574, 0.247, -1.602, 5.750, -21.549, -22.418 ], "frame": { "rmsd": null, "origin": [ 40.073, -3.080, 94.752 ], "x_axis": [ -0.945, 0.328, 0.005 ], "y_axis": [ 0.128, 0.354, 0.926 ], "z_axis": [ 0.302, 0.876, -0.377 ], "quaternion": [ 0.091, 0.139, 0.818, 0.551 ] } }, { "index": 275, "nt1": "///S/93", "nt2": "///S/129", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 178.547, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 74.753, "chi2": -159.872, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.764, "C1C1_dist": 10.364, "N1N9_dist": 9.073, "C6C8_dist": 10.307, "CNNC_torsion": -13.630, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[3.10],O2(carbonyl)-N2(amino)[3.04]", "interBase_angle": 23.989, "planarity": 0.287, "simple_Shear": 1.818, "simple_Stretch": 0.697, "simple_Buckle": -19.522, "simple_Propeller": -13.940, "bp_simpleParams": [ 1.818, 0.697, 1.094, -19.522, -13.940, 15.433 ], "bp_params": [ 1.917, 0.341, 1.094, -21.826, -9.953, 15.216 ], "frame": { "rmsd": null, "origin": [ 38.457, 0.904, 92.530 ], "x_axis": [ -0.732, 0.289, 0.617 ], "y_axis": [ 0.643, -0.007, 0.766 ], "z_axis": [ 0.226, 0.957, -0.181 ], "quaternion": [ -0.142, 0.338, 0.690, 0.624 ] } }, { "index": 276, "nt1": "///S/94", "nt2": "///S/128", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.242, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.716, "chi2": -161.101, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.298, "C1C1_dist": 10.931, "N1N9_dist": 9.171, "C6C8_dist": 10.052, "CNNC_torsion": -10.678, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.27],N1-N3(imino)[3.30]", "interBase_angle": 15.195, "planarity": 0.181, "simple_Shear": -0.896, "simple_Stretch": 0.147, "simple_Buckle": -1.798, "simple_Propeller": -15.089, "bp_simpleParams": [ -0.896, 0.147, -0.172, -1.798, -15.089, -2.011 ], "bp_params": [ -0.905, 0.069, -0.172, -0.486, -15.188, -2.029 ], "frame": { "rmsd": null, "origin": [ 38.001, 2.842, 90.717 ], "x_axis": [ -0.407, 0.024, 0.913 ], "y_axis": [ 0.907, 0.126, 0.401 ], "z_axis": [ -0.105, 0.992, -0.073 ], "quaternion": [ -0.402, 0.368, 0.634, 0.550 ] } }, { "index": 277, "nt1": "///S/95", "nt2": "///S/127", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -144.330, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.652, "chi2": -170.370, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.509, "C1C1_dist": 10.630, "N1N9_dist": 9.008, "C6C8_dist": 10.005, "CNNC_torsion": -9.841, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.89],N3-N1(imino)[3.05],N4(amino)-O6(carbonyl)[3.14]", "interBase_angle": 22.385, "planarity": 0.256, "simple_Shear": 0.152, "simple_Stretch": 0.039, "simple_Buckle": 13.315, "simple_Propeller": -17.994, "bp_simpleParams": [ 0.152, 0.039, -0.628, 13.315, -17.994, 5.359 ], "bp_params": [ 0.152, 0.039, -0.628, 13.253, -18.039, 5.391 ], "frame": { "rmsd": null, "origin": [ 36.387, 5.803, 90.923 ], "x_axis": [ 0.213, 0.125, 0.969 ], "y_axis": [ 0.961, 0.151, -0.231 ], "z_axis": [ -0.176, 0.981, -0.088 ], "quaternion": [ 0.565, -0.536, -0.507, -0.370 ] } }, { "index": 278, "nt1": "///S/96", "nt2": "///S/126", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.551, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 64.975, "chi2": -164.878, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.647, "C1C1_dist": 10.741, "N1N9_dist": 9.014, "C6C8_dist": 9.880, "CNNC_torsion": -7.659, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.98],N3(imino)-O6(carbonyl)[3.05]", "interBase_angle": 10.129, "planarity": 0.142, "simple_Shear": 2.112, "simple_Stretch": 0.109, "simple_Buckle": -0.417, "simple_Propeller": -10.120, "bp_simpleParams": [ 2.112, 0.109, -0.050, -0.417, -10.120, -1.206 ], "bp_params": [ 2.089, -0.331, -0.050, -2.503, -9.815, -1.210 ], "frame": { "rmsd": null, "origin": [ 34.843, 9.520, 91.393 ], "x_axis": [ 0.766, 0.026, 0.642 ], "y_axis": [ 0.640, 0.054, -0.766 ], "z_axis": [ -0.055, 0.998, 0.025 ], "quaternion": [ 0.679, -0.650, -0.257, -0.226 ] } }, { "index": 279, "nt1": "///S/99", "nt2": "///S/122", "bp": "A-C", "name": "~rHoogsteen", "Saenger": "25-XXV", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -147.728, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 7.754, "chi2": -153.349, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 25.598, "C1C1_dist": 11.060, "N1N9_dist": 8.295, "C6C8_dist": 7.281, "CNNC_torsion": -160.431, "hbonds_num": 3, "hbonds_desc": "N7-N4(amino)[3.03],N6(amino)-O2(carbonyl)[3.01],N6(amino)-N3[2.81]", "interBase_angle": 11.632, "planarity": 0.157, "simple_Shear": -2.977, "simple_Stretch": 0.781, "simple_Buckle": -7.268, "simple_Propeller": -9.082, "bp_simpleParams": [ -2.977, 0.781, 0.096, -7.268, -9.082, -88.636 ], "bp_params": [ -3.024, -0.575, 0.096, -2.651, -11.326, -88.901 ], "frame": { "rmsd": null, "origin": [ 38.154, 24.724, 92.283 ], "x_axis": [ 0.844, -0.260, -0.469 ], "y_axis": [ -0.469, 0.066, -0.881 ], "z_axis": [ 0.260, 0.963, -0.066 ], "quaternion": [ 0.679, -0.679, 0.268, 0.077 ] } }, { "index": 280, "nt1": "///S/100", "nt2": "///S/121", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -157.597, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 17.924, "chi2": -166.180, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 27.441, "C1C1_dist": 12.278, "N1N9_dist": 9.635, "C6C8_dist": 8.326, "CNNC_torsion": 144.923, "hbonds_num": 2, "hbonds_desc": "N7-N6(amino)[3.31],N6(amino)-N1[3.02]", "interBase_angle": 24.426, "planarity": 0.301, "simple_Shear": -3.235, "simple_Stretch": 3.224, "simple_Buckle": 4.348, "simple_Propeller": -24.036, "bp_simpleParams": [ -3.235, 3.224, -0.539, 4.348, -24.036, -102.660 ], "bp_params": [ -4.474, 0.921, -0.539, 16.776, -17.754, -102.729 ], "frame": { "rmsd": null, "origin": [ 39.808, 27.606, 93.004 ], "x_axis": [ 0.533, -0.209, -0.820 ], "y_axis": [ -0.785, 0.238, -0.572 ], "z_axis": [ 0.315, 0.949, -0.037 ], "quaternion": [ 0.658, -0.577, 0.431, 0.219 ] } }, { "index": 281, "nt1": "///S/101", "nt2": "///S/120", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -174.965, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 7.790, "chi2": -159.363, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.027, "C1C1_dist": 13.048, "N1N9_dist": 10.703, "C6C8_dist": 10.245, "CNNC_torsion": 119.648, "hbonds_num": 2, "hbonds_desc": "O4(carbonyl)-N1(imino)[3.08],O4(carbonyl)-N2(amino)[2.70]", "interBase_angle": 18.964, "planarity": 0.234, "simple_Shear": -4.457, "simple_Stretch": 3.058, "simple_Buckle": 12.446, "simple_Propeller": -14.308, "bp_simpleParams": [ -4.457, 3.058, -0.087, 12.446, -14.308, -62.835 ], "bp_params": [ -5.400, 0.241, -0.087, 18.124, -5.580, -62.258 ], "frame": { "rmsd": null, "origin": [ 43.499, 29.662, 91.785 ], "x_axis": [ 0.048, -0.082, -0.995 ], "y_axis": [ -0.960, 0.272, -0.069 ], "z_axis": [ 0.277, 0.959, -0.066 ], "quaternion": [ 0.560, -0.459, 0.568, 0.392 ] } }, { "index": 282, "nt1": "///S/102", "nt2": "///S/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.256, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.985, "chi2": -153.715, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.858, "C1C1_dist": 10.877, "N1N9_dist": 9.041, "C6C8_dist": 9.869, "CNNC_torsion": -10.606, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.93],N3-N1(imino)[2.98],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 17.996, "planarity": 0.204, "simple_Shear": 0.271, "simple_Stretch": -0.081, "simple_Buckle": 12.074, "simple_Propeller": -13.345, "bp_simpleParams": [ 0.271, -0.081, -0.077, 12.074, -13.345, -2.515 ], "bp_params": [ 0.270, -0.086, -0.077, 11.849, -13.545, -2.520 ], "frame": { "rmsd": null, "origin": [ 44.612, 32.425, 87.811 ], "x_axis": [ -0.815, -0.060, -0.577 ], "y_axis": [ -0.571, 0.255, 0.781 ], "z_axis": [ 0.100, 0.965, -0.242 ], "quaternion": [ 0.223, -0.207, 0.760, 0.574 ] } }, { "index": 283, "nt1": "///S/103", "nt2": "///S/118", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.526, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.901, "chi2": -162.561, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.131, "C1C1_dist": 10.561, "N1N9_dist": 8.865, "C6C8_dist": 9.837, "CNNC_torsion": -18.064, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.07],N1-N3(imino)[2.88]", "interBase_angle": 23.693, "planarity": 0.284, "simple_Shear": -0.198, "simple_Stretch": -0.100, "simple_Buckle": -0.031, "simple_Propeller": -23.693, "bp_simpleParams": [ -0.198, -0.100, -0.025, -0.031, -23.693, 2.126 ], "bp_params": [ -0.196, -0.103, -0.025, 0.355, -23.691, 2.172 ], "frame": { "rmsd": null, "origin": [ 44.565, 35.151, 85.210 ], "x_axis": [ -0.977, -0.213, 0.022 ], "y_axis": [ -0.049, 0.319, 0.946 ], "z_axis": [ -0.208, 0.923, -0.322 ], "quaternion": [ -0.071, -0.081, 0.809, 0.578 ] } }, { "index": 284, "nt1": "///S/104", "nt2": "///S/117", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.716, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 78.052, "chi2": -174.561, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 43.349, "C1C1_dist": 10.144, "N1N9_dist": 8.803, "C6C8_dist": 9.948, "CNNC_torsion": -20.297, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.73],N3(imino)-O6(carbonyl)[3.23]", "interBase_angle": 25.041, "planarity": 0.346, "simple_Shear": 2.984, "simple_Stretch": 0.471, "simple_Buckle": 0.150, "simple_Propeller": -25.040, "bp_simpleParams": [ 2.984, 0.471, 0.081, 0.150, -25.040, 12.306 ], "bp_params": [ 2.987, -0.449, 0.081, -7.396, -23.923, 12.552 ], "frame": { "rmsd": null, "origin": [ 42.840, 37.827, 83.201 ], "x_axis": [ -0.694, 0.036, 0.719 ], "y_axis": [ 0.660, 0.430, 0.616 ], "z_axis": [ -0.287, 0.902, -0.322 ], "quaternion": [ -0.321, 0.222, 0.782, 0.485 ] } }, { "index": 285, "nt1": "///S/105", "nt2": "///S/116", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -116.348, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.056, "chi2": -162.221, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.211, "C1C1_dist": 10.758, "N1N9_dist": 8.948, "C6C8_dist": 9.821, "CNNC_torsion": 9.411, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.91],O4(carbonyl)-N6(amino)[2.82]", "interBase_angle": 3.718, "planarity": 0.106, "simple_Shear": 0.047, "simple_Stretch": -0.127, "simple_Buckle": 2.475, "simple_Propeller": 2.775, "bp_simpleParams": [ 0.047, -0.127, -0.491, 2.475, 2.775, -3.581 ], "bp_params": [ 0.047, -0.128, -0.491, 2.480, 2.770, -3.581 ], "frame": { "rmsd": null, "origin": [ 40.835, 39.389, 80.460 ], "x_axis": [ -0.437, -0.014, 0.899 ], "y_axis": [ 0.776, 0.500, 0.385 ], "z_axis": [ -0.455, 0.866, -0.208 ], "quaternion": [ -0.462, 0.260, 0.732, 0.427 ] } }, { "index": 286, "nt1": "///S/106", "nt2": "///S/115", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.662, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.981, "chi2": -154.155, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.286, "C1C1_dist": 10.891, "N1N9_dist": 9.110, "C6C8_dist": 10.012, "CNNC_torsion": -6.694, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.11],N1-N3(imino)[3.05]", "interBase_angle": 9.459, "planarity": 0.119, "simple_Shear": 0.165, "simple_Stretch": 0.084, "simple_Buckle": -1.242, "simple_Propeller": -9.377, "bp_simpleParams": [ 0.165, 0.084, -0.273, -1.242, -9.377, -0.589 ], "bp_params": [ 0.167, 0.081, -0.273, -1.445, -9.348, -0.591 ], "frame": { "rmsd": null, "origin": [ 38.330, 41.812, 79.190 ], "x_axis": [ 0.080, 0.179, 0.981 ], "y_axis": [ 0.909, 0.390, -0.146 ], "z_axis": [ -0.409, 0.903, -0.132 ], "quaternion": [ 0.578, -0.453, -0.600, -0.315 ] } }, { "index": 287, "nt1": "///S/107", "nt2": "///S/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -153.798, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.287, "chi2": -163.649, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.129, "C1C1_dist": 10.282, "N1N9_dist": 8.767, "C6C8_dist": 9.888, "CNNC_torsion": -12.416, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.40],N1-N3(imino)[2.98]", "interBase_angle": 17.090, "planarity": 0.208, "simple_Shear": -0.571, "simple_Stretch": 0.035, "simple_Buckle": 9.372, "simple_Propeller": -14.291, "bp_simpleParams": [ -0.571, 0.035, 0.229, 9.372, -14.291, 8.132 ], "bp_params": [ -0.572, 0.001, 0.229, 10.171, -13.734, 8.159 ], "frame": { "rmsd": null, "origin": [ 36.005, 44.165, 79.738 ], "x_axis": [ 0.535, 0.287, 0.795 ], "y_axis": [ 0.758, 0.251, -0.601 ], "z_axis": [ -0.372, 0.924, -0.083 ], "quaternion": [ 0.653, -0.585, -0.447, -0.181 ] } }, { "index": 288, "nt1": "///S/108", "nt2": "///S/113", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.689, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.251, "chi2": -175.140, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.830, "C1C1_dist": 10.816, "N1N9_dist": 9.041, "C6C8_dist": 9.902, "CNNC_torsion": -0.839, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.02],N1(imino)-N3[3.07],N2(amino)-O2(carbonyl)[3.00]", "interBase_angle": 4.441, "planarity": 0.070, "simple_Shear": -0.689, "simple_Stretch": -0.082, "simple_Buckle": 1.943, "simple_Propeller": -3.993, "bp_simpleParams": [ -0.689, -0.082, -0.085, 1.943, -3.993, -1.923 ], "bp_params": [ -0.682, -0.126, -0.085, 2.196, -3.860, -1.924 ], "frame": { "rmsd": null, "origin": [ 33.788, 47.138, 81.167 ], "x_axis": [ 0.881, 0.265, 0.391 ], "y_axis": [ 0.379, 0.098, -0.920 ], "z_axis": [ -0.282, 0.959, -0.014 ], "quaternion": [ 0.701, -0.670, -0.240, -0.041 ] } }, { "index": 289, "nt1": "///S/109", "nt2": "///S/112", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -166.058, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 86.341, "chi2": -125.117, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 22.763, "C1C1_dist": 10.044, "N1N9_dist": 8.829, "C6C8_dist": 8.838, "CNNC_torsion": -158.081, "hbonds_num": 2, "hbonds_desc": "N2(amino)-OP2[2.63],N2(amino)-N7[3.37]", "interBase_angle": 20.164, "planarity": 0.279, "simple_Shear": 8.354, "simple_Stretch": 4.855, "simple_Buckle": 18.995, "simple_Propeller": -6.766, "bp_simpleParams": [ 8.354, 4.855, 1.160, 18.995, -6.766, -41.657 ], "bp_params": [ 7.867, -5.610, 1.160, 1.717, -20.091, -42.244 ], "frame": { "rmsd": null, "origin": [ 29.329, 49.952, 83.060 ], "x_axis": [ 0.818, -0.056, -0.573 ], "y_axis": [ -0.575, -0.015, -0.818 ], "z_axis": [ 0.037, 0.998, -0.045 ], "quaternion": [ 0.663, -0.685, 0.230, 0.195 ] } }, { "index": 290, "nt1": "///S/134", "nt2": "///S/135", "bp": "U+G", "name": "Platform", "Saenger": "--", "LW": "cWH", "DSSR": "cW+M", "intra_chain": true, "chi1": 161.378, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 74.661, "chi2": -158.544, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 83.529, "C1C1_dist": 6.765, "N1N9_dist": 6.198, "C6C8_dist": 6.074, "CNNC_torsion": -5.144, "hbonds_num": 1, "hbonds_desc": "N3(imino)-N7[3.75]", "interBase_angle": 16.681, "planarity": 0.469, "simple_Shear": -1.164, "simple_Stretch": 4.782, "simple_Buckle": -11.649, "simple_Propeller": -11.940, "bp_simpleParams": [ -1.164, 4.782, -0.796, -11.649, -11.940, -17.528 ], "bp_params": [ 1.669, 4.630, -0.796, -16.304, -3.527, -17.362 ], "frame": { "rmsd": null, "origin": [ 27.753, -12.434, 97.900 ], "x_axis": [ 0.739, -0.123, -0.662 ], "y_axis": [ 0.634, -0.207, 0.745 ], "z_axis": [ -0.229, -0.971, -0.075 ], "quaternion": [ 0.603, 0.711, 0.180, -0.313 ] } } ], "num_multiplets": 35, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "ACG", "nts_long": "///E/-1,///F/2,///Q/56", "planarity": 0.416 }, { "index": 2, "num_nts": 3, "nts_short": "CGA", "nts_long": "///E/2,///P/56,///F/-1", "planarity": 0.372 }, { "index": 3, "num_nts": 3, "nts_short": "GGC", "nts_long": "///E/7,///P/27,///P/52", "planarity": 0.335 }, { "index": 4, "num_nts": 3, "nts_short": "AUU", "nts_long": "///E/8,///P/26,///P/50", "planarity": 0.565 }, { "index": 5, "num_nts": 3, "nts_short": "UAG", "nts_long": "///E/11,///P/23,///P/111", "planarity": 0.361 }, { "index": 6, "num_nts": 3, "nts_short": "GCA", "nts_long": "///P/30,///P/44,///P/123", "planarity": 0.834 }, { "index": 7, "num_nts": 3, "nts_short": "GCA", "nts_long": "///P/68,///P/82,///P/87", "planarity": 0.341 }, { "index": 8, "num_nts": 3, "nts_short": "UAG", "nts_long": "///P/70,///P/80,///P/135", "planarity": 0.419 }, { "index": 9, "num_nts": 3, "nts_short": "GGC", "nts_long": "///F/7,///Q/27,///Q/52", "planarity": 0.329 }, { "index": 10, "num_nts": 3, "nts_short": "AUU", "nts_long": "///F/8,///Q/26,///Q/50", "planarity": 0.542 }, { "index": 11, "num_nts": 3, "nts_short": "UAG", "nts_long": "///F/11,///Q/23,///Q/111", "planarity": 0.327 }, { "index": 12, "num_nts": 3, "nts_short": "GCA", "nts_long": "///Q/30,///Q/44,///Q/123", "planarity": 0.796 }, { "index": 13, "num_nts": 3, "nts_short": "GCA", "nts_long": "///Q/67,///Q/83,///Q/86", "planarity": 0.362 }, { "index": 14, "num_nts": 3, "nts_short": "GCA", "nts_long": "///Q/68,///Q/82,///Q/87", "planarity": 0.347 }, { "index": 15, "num_nts": 3, "nts_short": "ACG", "nts_long": "///G/-1,///H/2,///S/56", "planarity": 0.349 }, { "index": 16, "num_nts": 3, "nts_short": "CGA", "nts_long": "///G/2,///R/56,///H/-1", "planarity": 0.377 }, { "index": 17, "num_nts": 3, "nts_short": "GGC", "nts_long": "///G/7,///R/27,///R/52", "planarity": 0.390 }, { "index": 18, "num_nts": 3, "nts_short": "AUU", "nts_long": "///G/8,///R/26,///R/50", "planarity": 0.527 }, { "index": 19, "num_nts": 3, "nts_short": "UAG", "nts_long": "///G/11,///R/23,///R/111", "planarity": 0.326 }, { "index": 20, "num_nts": 3, "nts_short": "GCA", "nts_long": "///R/30,///R/44,///R/123", "planarity": 0.807 }, { "index": 21, "num_nts": 3, "nts_short": "GCA", "nts_long": "///R/68,///R/82,///R/87", "planarity": 0.371 }, { "index": 22, "num_nts": 3, "nts_short": "GGC", "nts_long": "///H/7,///S/27,///S/52", "planarity": 0.360 }, { "index": 23, "num_nts": 3, "nts_short": "AUU", "nts_long": "///H/8,///S/26,///S/50", "planarity": 0.587 }, { "index": 24, "num_nts": 3, "nts_short": "UAG", "nts_long": "///H/11,///S/23,///S/111", "planarity": 0.371 }, { "index": 25, "num_nts": 3, "nts_short": "GCA", "nts_long": "///S/68,///S/82,///S/87", "planarity": 0.370 }, { "index": 26, "num_nts": 4, "nts_short": "CGGA", "nts_long": "///E/10,///P/24,///P/109,///P/112", "planarity": 0.340 }, { "index": 27, "num_nts": 4, "nts_short": "ACGA", "nts_long": "///P/28,///P/29,///P/45,///P/98", "planarity": 0.766 }, { "index": 28, "num_nts": 4, "nts_short": "CGGA", "nts_long": "///F/10,///Q/24,///Q/109,///Q/112", "planarity": 0.387 }, { "index": 29, "num_nts": 4, "nts_short": "CGGA", "nts_long": "///G/10,///R/24,///R/109,///R/112", "planarity": 0.369 }, { "index": 30, "num_nts": 4, "nts_short": "ACGA", "nts_long": "///R/28,///R/29,///R/45,///R/98", "planarity": 0.725 }, { "index": 31, "num_nts": 4, "nts_short": "GGCA", "nts_long": "///H/1,///S/30,///S/44,///S/123", "planarity": 1.105 }, { "index": 32, "num_nts": 4, "nts_short": "CGGA", "nts_long": "///H/10,///S/24,///S/109,///S/112", "planarity": 0.306 }, { "index": 33, "num_nts": 4, "nts_short": "ACGA", "nts_long": "///S/28,///S/29,///S/45,///S/98", "planarity": 0.747 }, { "index": 34, "num_nts": 4, "nts_short": "UAUG", "nts_long": "///S/70,///S/80,///S/134,///S/135", "planarity": 0.469 }, { "index": 35, "num_nts": 5, "nts_short": "ACGAU", "nts_long": "///Q/28,///Q/29,///Q/45,///Q/98,///R/49", "planarity": 1.125 } ], "num_helices": 20, "helices": [ { "index": 1, "num_stems": 3, "strand1": "aCGCCGAACUgGCACC", "strand2": "GGCGGCUUGACCGUGG", "bp_type": ".|||||||||||||||", "helix_form": "xAAAxx..AxA.AAA", "helical_rise": 3.079, "helical_rise_std": 0.892, "helical_radius": 9.445, "helical_radius_std": 2.516, "helical_axis": [ 0.168, -0.981, -0.096 ], "point1": [ 13.255, 37.660, 11.457 ], "point2": [ 21.020, -7.566, 7.027 ], "num_pairs": 16, "pairs": [ { "index": 1, "nt1": "///E/0", "nt2": "///P/57", "bp": "a+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "bp1_params": [ 2.811, 7.459, -0.670, 29.619, -8.284, 156.300 ], "step_params": [ 1.324, -3.235, 3.706, 8.959, 9.488, -67.594 ], "heli_params": [ 2.454, 1.563, 3.895, -8.448, 7.977, -68.695 ], "bp2_params": [ 0.652, -0.044, 0.265, 3.640, -7.157, 5.436 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.706, "simple_Twist": -1.404, "simple_hRise": 1.832, "simple_hTwist": -13.124 }, { "index": 2, "nt1": "///E/2", "nt2": "///P/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.652, -0.044, 0.265, 3.640, -7.157, 5.436 ], "step_params": [ -0.996, -1.808, 2.992, -1.498, 7.272, 27.224 ], "heli_params": [ -5.158, 1.745, 2.484, 15.096, 3.109, 28.200 ], "bp2_params": [ -0.405, -0.220, -0.129, 6.427, -9.859, 4.387 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.992, "simple_Twist": 32.667, "simple_hRise": 2.582, "simple_hTwist": 33.478 }, { "index": 3, "nt1": "///E/3", "nt2": "///P/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.405, -0.220, -0.129, 6.427, -9.859, 4.387 ], "step_params": [ -0.157, -1.615, 3.252, -0.811, 1.149, 31.450 ], "heli_params": [ -3.187, 0.139, 3.196, 2.118, 1.495, 31.481 ], "bp2_params": [ 0.199, -0.124, -0.233, 8.911, -15.875, 1.868 ], "groove_widths": [ 16.884, null, 18.565, null ], "simple_Rise": 3.252, "simple_Twist": 28.715, "simple_hRise": 3.190, "simple_hTwist": 28.749 }, { "index": 4, "nt1": "///E/4", "nt2": "///P/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.199, -0.124, -0.233, 8.911, -15.875, 1.868 ], "step_params": [ -0.162, -1.843, 3.217, 2.405, 17.066, 26.513 ], "heli_params": [ -6.010, 0.666, 1.723, 33.132, -4.668, 31.538 ], "bp2_params": [ -0.035, -0.136, -0.513, 10.525, -1.882, -2.006 ], "groove_widths": [ 16.746, 13.448, 13.880, 11.746 ], "simple_Rise": 3.217, "simple_Twist": 27.372, "simple_hRise": 1.771, "simple_hTwist": 32.258 }, { "index": 5, "nt1": "///E/5", "nt2": "///P/53", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.035, -0.136, -0.513, 10.525, -1.882, -2.006 ], "step_params": [ -2.628, -1.336, 4.119, -6.460, 7.272, 61.623 ], "heli_params": [ -1.716, 2.163, 4.183, 7.051, 6.264, 62.311 ], "bp2_params": [ -0.483, 0.199, -0.379, -28.026, -15.285, 4.977 ], "groove_widths": [ 16.150, 13.259, 9.996, 9.387 ], "simple_Rise": 4.119, "simple_Twist": 62.840, "simple_hRise": 4.182, "simple_hTwist": 63.512 }, { "index": 6, "nt1": "///E/7", "nt2": "///P/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.483, 0.199, -0.379, -28.026, -15.285, 4.977 ], "step_params": [ 3.039, -0.457, 3.062, -24.827, 5.121, 64.917 ], "heli_params": [ -0.550, -3.393, 1.894, 4.593, 22.267, 69.183 ], "bp2_params": [ 0.110, 0.009, 0.423, 16.140, -17.400, -3.437 ], "groove_widths": [ 17.428, 14.988, 8.463, 8.442 ], "simple_Rise": 3.062, "simple_Twist": 63.297, "simple_hRise": 1.856, "simple_hTwist": 67.692 }, { "index": 7, "nt1": "///E/8", "nt2": "///P/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.110, 0.009, 0.423, 16.140, -17.400, -3.437 ], "step_params": [ 0.609, -1.067, 3.070, -2.260, 8.212, 29.938 ], "heli_params": [ -3.389, -1.520, 2.639, 15.505, 4.266, 31.100 ], "bp2_params": [ -0.601, 0.067, 0.618, 19.863, -18.684, 6.622 ], "groove_widths": [ 20.463, null, 11.924, 9.173 ], "simple_Rise": 3.070, "simple_Twist": 34.173, "simple_hRise": 2.704, "simple_hTwist": 35.188 }, { "index": 8, "nt1": "///E/9", "nt2": "///P/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.601, 0.067, 0.618, 19.863, -18.684, 6.622 ], "step_params": [ -0.023, -1.366, 3.532, 4.753, 6.374, 37.823 ], "heli_params": [ -2.887, 0.648, 3.242, 9.703, -7.235, 38.620 ], "bp2_params": [ 0.044, 0.006, 0.002, 4.532, -28.084, 5.691 ], "groove_widths": [ null, null, 14.092, 9.530 ], "simple_Rise": 3.532, "simple_Twist": 33.795, "simple_hRise": 3.197, "simple_hTwist": 34.691 }, { "index": 9, "nt1": "///E/10", "nt2": "///P/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.044, 0.006, 0.002, 4.532, -28.084, 5.691 ], "step_params": [ -0.258, -1.688, 3.349, -2.764, 13.447, 28.520 ], "heli_params": [ -5.390, 0.003, 2.349, 25.511, 5.243, 31.590 ], "bp2_params": [ -0.495, 0.282, 0.194, -3.886, -13.099, 1.951 ], "groove_widths": [ null, null, 15.624, 12.250 ], "simple_Rise": 3.349, "simple_Twist": 31.139, "simple_hRise": 2.446, "simple_hTwist": 33.962 }, { "index": 10, "nt1": "///E/11", "nt2": "///P/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.495, 0.282, 0.194, -3.886, -13.099, 1.951 ], "step_params": [ -0.571, -1.828, 3.262, 3.075, 4.030, 34.353 ], "heli_params": [ -3.656, 1.408, 2.974, 6.777, -5.171, 34.714 ], "bp2_params": [ -0.239, 0.161, -0.094, -7.786, -16.719, -1.578 ], "groove_widths": [ 16.095, null, 17.000, 14.054 ], "simple_Rise": 3.262, "simple_Twist": 32.660, "simple_hRise": 2.956, "simple_hTwist": 33.040 }, { "index": 11, "nt1": "///P/12", "nt2": "///P/22", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.239, 0.161, -0.094, -7.786, -16.719, -1.578 ], "step_params": [ 0.099, -1.764, 3.358, -1.343, 6.272, 30.487 ], "heli_params": [ -4.452, -0.434, 2.938, 11.765, 2.519, 31.139 ], "bp2_params": [ -0.676, 0.206, -0.193, -13.427, -18.119, 8.089 ], "groove_widths": [ 16.195, 14.973, 17.109, null ], "simple_Rise": 3.358, "simple_Twist": 32.707, "simple_hRise": 2.971, "simple_hTwist": 33.313 }, { "index": 12, "nt1": "///P/13", "nt2": "///P/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.676, 0.206, -0.193, -13.427, -18.119, 8.089 ], "step_params": [ -0.183, -1.123, 2.882, -0.636, 2.116, 38.252 ], "heli_params": [ -1.943, 0.209, 2.821, 3.226, 0.970, 38.313 ], "bp2_params": [ 0.444, 0.228, 0.209, 0.497, -17.788, 10.537 ], "groove_widths": [ 16.941, 15.626, null, null ], "simple_Rise": 2.882, "simple_Twist": 32.841, "simple_hRise": 2.809, "simple_hTwist": 32.913 }, { "index": 13, "nt1": "///P/14", "nt2": "///P/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.444, 0.228, 0.209, 0.497, -17.788, 10.537 ], "step_params": [ -0.908, -1.235, 2.805, -0.896, 13.357, 27.245 ], "heli_params": [ -4.463, 1.597, 2.020, 26.427, 1.773, 30.301 ], "bp2_params": [ -0.670, -0.022, 0.277, 5.416, -16.407, -3.245 ], "groove_widths": [ 17.442, null, 15.411, null ], "simple_Rise": 2.805, "simple_Twist": 33.023, "simple_hRise": 2.182, "simple_hTwist": 35.563 }, { "index": 14, "nt1": "///P/15", "nt2": "///P/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.670, -0.022, 0.277, 5.416, -16.407, -3.245 ], "step_params": [ -0.068, -1.669, 3.085, 0.266, 4.515, 33.527 ], "heli_params": [ -3.532, 0.156, 2.842, 7.782, -0.459, 33.822 ], "bp2_params": [ 0.186, -0.130, -0.028, 12.677, -11.029, -8.695 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.085, "simple_Twist": 29.212, "simple_hRise": 2.800, "simple_hTwist": 29.552 }, { "index": 15, "nt1": "///P/16", "nt2": "///P/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, -0.130, -0.028, 12.677, -11.029, -8.695 ], "step_params": [ 0.323, -1.706, 3.383, 4.749, 9.017, 33.670 ], "heli_params": [ -4.142, 0.159, 2.864, 15.141, -7.975, 35.136 ], "bp2_params": [ 0.858, -0.132, -0.724, 8.850, -9.939, -3.017 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.383, "simple_Twist": 30.163, "simple_hRise": 2.788, "simple_hTwist": 31.801 }, { "index": 16, "nt1": "///P/17", "nt2": "///P/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 1, "strand1": "UCGA", "strand2": "AGCU", "bp_type": "|||.", "helix_form": "AAx", "helical_rise": 3.702, "helical_rise_std": 0.237, "helical_radius": 8.985, "helical_radius_std": 0.720, "helical_axis": [ 0.415, -0.644, -0.642 ], "point1": [ 26.016, 41.510, 11.505 ], "point2": [ 30.701, 34.245, 4.266 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///P/43", "nt2": "///P/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.108, -0.166, -0.295, -0.134, -12.026, -4.335 ], "step_params": [ 0.606, -2.133, 3.316, -0.997, 4.151, 38.263 ], "heli_params": [ -3.738, -1.040, 3.060, 6.309, 1.516, 38.491 ], "bp2_params": [ 0.327, -0.301, 0.344, -6.209, -5.375, -2.026 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.316, "simple_Twist": 37.177, "simple_hRise": 3.052, "simple_hTwist": 37.413 }, { "index": 2, "nt1": "///P/44", "nt2": "///P/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.327, -0.301, 0.344, -6.209, -5.375, -2.026 ], "step_params": [ 0.480, -1.279, 2.985, -1.221, 2.442, 18.204 ], "heli_params": [ -5.184, -2.094, 2.753, 7.663, 3.833, 18.406 ], "bp2_params": [ -0.304, 0.027, 0.431, 9.804, 2.946, 2.144 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.985, "simple_Twist": 21.428, "simple_hRise": 2.792, "simple_hTwist": 21.599 }, { "index": 3, "nt1": "///P/45", "nt2": "///P/29", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.304, 0.027, 0.431, 9.804, 2.946, 2.144 ], "step_params": [ 1.236, -2.634, 2.999, -1.015, -3.347, -46.500 ], "heli_params": [ 3.579, 1.486, 2.838, 4.232, -1.283, -46.624 ], "bp2_params": [ 0.026, 1.264, 0.298, -6.583, 16.862, 168.573 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.999, "simple_Twist": 61.252, "simple_hRise": 3.106, "simple_hTwist": 61.342 }, { "index": 4, "nt1": "///P/46", "nt2": "///P/51", "bp": "A+U", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W" } ] }, { "index": 3, "num_stems": 3, "strand1": "GACUCCCGGUUGUGAUGA", "strand2": "UUGGGGGCCAACACUACU", "bp_type": "||||||||||||||||||", "helix_form": "..A.Ax...AAx.....", "helical_rise": 2.654, "helical_rise_std": 0.493, "helical_radius": 9.079, "helical_radius_std": 1.387, "helical_axis": [ 0.177, 0.984, 0.033 ], "point1": [ 10.138, 46.692, 7.215 ], "point2": [ 18.128, 91.027, 8.712 ], "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///P/60", "nt2": "///P/40", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.395, -0.045, 0.215, -2.205, -10.529, 4.053 ], "step_params": [ -0.100, -0.566, 2.832, -1.279, 4.764, 42.802 ], "heli_params": [ -1.173, 0.028, 2.759, 6.502, 1.745, 43.072 ], "bp2_params": [ -0.217, -0.002, 0.201, 12.858, -21.830, 7.008 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.832, "simple_Twist": 31.984, "simple_hRise": 2.724, "simple_hTwist": 32.352 }, { "index": 2, "nt1": "///P/61", "nt2": "///P/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.217, -0.002, 0.201, 12.858, -21.830, 7.008 ], "step_params": [ -0.169, -1.081, 3.294, -1.942, 10.753, 33.080 ], "heli_params": [ -3.382, -0.001, 2.821, 18.275, 3.301, 34.790 ], "bp2_params": [ -0.277, -0.140, 0.432, 8.261, -19.449, 1.777 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.294, "simple_Twist": 33.232, "simple_hRise": 2.824, "simple_hTwist": 34.934 }, { "index": 3, "nt1": "///P/62", "nt2": "///P/38", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.277, -0.140, 0.432, 8.261, -19.449, 1.777 ], "step_params": [ -0.326, -1.254, 3.448, 2.262, 9.577, 39.685 ], "heli_params": [ -2.861, 0.719, 3.055, 13.850, -3.271, 40.839 ], "bp2_params": [ 1.884, -0.238, 0.216, -1.643, -17.033, -4.183 ], "groove_widths": [ 17.067, null, 14.100, null ], "simple_Rise": 3.448, "simple_Twist": 27.994, "simple_hRise": 2.839, "simple_hTwist": 29.641 }, { "index": 4, "nt1": "///P/63", "nt2": "///P/37", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.884, -0.238, 0.216, -1.643, -17.033, -4.183 ], "step_params": [ 0.449, -1.732, 2.720, 0.900, 7.376, 30.151 ], "heli_params": [ -4.332, -0.706, 2.256, 13.915, -1.698, 31.033 ], "bp2_params": [ 0.639, -0.196, 0.397, 4.971, -13.791, 2.180 ], "groove_widths": [ 16.924, 15.558, 13.915, 10.114 ], "simple_Rise": 2.720, "simple_Twist": 36.617, "simple_hRise": 2.350, "simple_hTwist": 37.338 }, { "index": 5, "nt1": "///P/64", "nt2": "///P/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.639, -0.196, 0.397, 4.971, -13.791, 2.180 ], "step_params": [ -0.044, -1.738, 3.071, 3.892, 4.635, 33.790 ], "heli_params": [ -3.603, 0.626, 2.793, 7.896, -6.630, 34.312 ], "bp2_params": [ 0.550, -0.075, -0.075, 3.066, -11.725, -8.823 ], "groove_widths": [ 16.889, 15.474, 14.805, 12.649 ], "simple_Rise": 3.071, "simple_Twist": 34.215, "simple_hRise": 2.797, "simple_hTwist": 34.730 }, { "index": 6, "nt1": "///P/65", "nt2": "///P/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.550, -0.075, -0.075, 3.066, -11.725, -8.823 ], "step_params": [ 0.871, -1.405, 3.544, -1.244, 13.630, 31.764 ], "heli_params": [ -4.472, -1.659, 2.698, 23.582, 2.152, 34.518 ], "bp2_params": [ -0.331, 0.178, 0.518, -8.953, -9.853, 1.612 ], "groove_widths": [ 17.254, 15.909, 14.792, 10.839 ], "simple_Rise": 3.544, "simple_Twist": 36.275, "simple_hRise": 2.825, "simple_hTwist": 38.690 }, { "index": 7, "nt1": "///P/66", "nt2": "///P/84", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.331, 0.178, 0.518, -8.953, -9.853, 1.612 ], "step_params": [ 0.669, -1.329, 2.820, -2.692, 6.871, 34.406 ], "heli_params": [ -3.036, -1.435, 2.460, 11.453, 4.487, 35.165 ], "bp2_params": [ -0.563, 0.109, 0.663, 4.819, -9.064, 6.477 ], "groove_widths": [ 17.885, 16.353, 15.978, 13.291 ], "simple_Rise": 2.820, "simple_Twist": 35.886, "simple_hRise": 2.477, "simple_hTwist": 36.613 }, { "index": 8, "nt1": "///P/67", "nt2": "///P/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.563, 0.109, 0.663, 4.819, -9.064, 6.477 ], "step_params": [ 0.532, -1.977, 3.403, 5.460, -0.710, 34.752 ], "heli_params": [ -3.159, -0.019, 3.483, -1.180, -9.071, 35.172 ], "bp2_params": [ 0.782, 0.339, 0.401, -0.438, -14.013, 6.438 ], "groove_widths": [ 16.728, 14.825, 17.944, 16.169 ], "simple_Rise": 3.403, "simple_Twist": 27.287, "simple_hRise": 3.490, "simple_hTwist": 27.827 }, { "index": 9, "nt1": "///P/68", "nt2": "///P/82", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.782, 0.339, 0.401, -0.438, -14.013, 6.438 ], "step_params": [ -1.766, -2.840, 3.286, 0.400, 7.220, 26.253 ], "heli_params": [ -7.641, 3.841, 2.407, 15.526, -0.859, 27.214 ], "bp2_params": [ -0.501, 0.371, -0.062, -7.970, -13.965, -17.369 ], "groove_widths": [ 15.817, 14.540, 18.601, 15.704 ], "simple_Rise": 3.286, "simple_Twist": 33.001, "simple_hRise": 2.603, "simple_hTwist": 33.762 }, { "index": 10, "nt1": "///P/69", "nt2": "///P/81", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.501, 0.371, -0.062, -7.970, -13.965, -17.369 ], "step_params": [ 0.510, -1.437, 3.141, -5.738, 6.683, 34.293 ], "heli_params": [ -3.259, -1.608, 2.705, 11.108, 9.537, 35.373 ], "bp2_params": [ 0.512, 0.355, 0.320, -0.652, -9.048, 0.585 ], "groove_widths": [ 16.802, 15.357, 16.980, 14.224 ], "simple_Rise": 3.141, "simple_Twist": 29.396, "simple_hRise": 2.615, "simple_hTwist": 30.659 }, { "index": 11, "nt1": "///P/70", "nt2": "///P/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.512, 0.355, 0.320, -0.652, -9.048, 0.585 ], "step_params": [ 0.490, -1.650, 3.010, 3.583, 20.345, 32.738 ], "heli_params": [ -4.500, -0.389, 1.767, 32.393, -5.705, 38.560 ], "bp2_params": [ 0.389, 0.237, 0.108, -5.385, -21.104, 9.017 ], "groove_widths": [ 16.855, 15.032, 15.245, 12.419 ], "simple_Rise": 3.010, "simple_Twist": 32.726, "simple_hRise": 1.766, "simple_hTwist": 38.550 }, { "index": 12, "nt1": "///P/71", "nt2": "///P/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.389, 0.237, 0.108, -5.385, -21.104, 9.017 ], "step_params": [ -1.960, -1.697, 3.239, -1.651, -3.683, 33.408 ], "heli_params": [ -2.312, 3.109, 3.491, -6.377, 2.859, 33.644 ], "bp2_params": [ -1.043, 0.181, -0.429, -7.992, -11.965, -13.558 ], "groove_widths": [ 16.379, 14.970, 16.065, 12.740 ], "simple_Rise": 3.239, "simple_Twist": 41.129, "simple_hRise": 3.445, "simple_hTwist": 41.318 }, { "index": 13, "nt1": "///P/136", "nt2": "///P/78", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.043, 0.181, -0.429, -7.992, -11.965, -13.558 ], "step_params": [ 0.782, -1.253, 3.199, -3.315, 11.529, 26.981 ], "heli_params": [ -4.652, -2.166, 2.366, 23.302, 6.700, 29.483 ], "bp2_params": [ -0.881, 0.464, 0.187, -5.535, -19.974, -0.066 ], "groove_widths": [ 17.110, 15.696, 16.276, 10.890 ], "simple_Rise": 3.199, "simple_Twist": 25.951, "simple_hRise": 2.327, "simple_hTwist": 28.546 }, { "index": 14, "nt1": "///P/137", "nt2": "///P/77", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.881, 0.464, 0.187, -5.535, -19.974, -0.066 ], "step_params": [ 0.737, -1.571, 2.663, -5.027, 4.208, 32.429 ], "heli_params": [ -3.306, -1.947, 2.310, 7.440, 8.888, 33.067 ], "bp2_params": [ -1.141, 0.319, 0.919, 11.550, -13.223, 13.878 ], "groove_widths": [ 17.961, 16.369, 20.145, 12.216 ], "simple_Rise": 2.663, "simple_Twist": 34.676, "simple_hRise": 2.336, "simple_hTwist": 35.271 }, { "index": 15, "nt1": "///P/138", "nt2": "///P/76", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.141, 0.319, 0.919, 11.550, -13.223, 13.878 ], "step_params": [ -0.357, -1.268, 3.762, 6.512, 17.991, 45.259 ], "heli_params": [ -3.006, 0.965, 3.008, 22.243, -8.050, 48.941 ], "bp2_params": [ 1.306, 0.159, -0.110, -6.116, -16.844, -10.487 ], "groove_widths": [ 18.060, null, 17.176, null ], "simple_Rise": 3.762, "simple_Twist": 32.247, "simple_hRise": 2.607, "simple_hTwist": 37.366 }, { "index": 16, "nt1": "///P/139", "nt2": "///P/75", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.306, 0.159, -0.110, -6.116, -16.844, -10.487 ], "step_params": [ 1.111, -1.442, 3.318, 1.975, 22.285, 31.796 ], "heli_params": [ -4.633, -1.458, 1.989, 35.687, -3.162, 38.712 ], "bp2_params": [ 0.908, 0.345, 0.645, -17.016, -17.375, 11.910 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.318, "simple_Twist": 32.755, "simple_hRise": 2.032, "simple_hTwist": 39.493 }, { "index": 17, "nt1": "///P/140", "nt2": "///P/74", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.908, 0.345, 0.645, -17.016, -17.375, 11.910 ], "step_params": [ -1.079, -1.651, 2.150, -2.845, -5.936, 24.752 ], "heli_params": [ -2.488, 1.843, 2.575, -13.545, 6.492, 25.599 ], "bp2_params": [ -0.844, -0.029, 1.011, 27.229, 4.145, -0.995 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.150, "simple_Twist": 34.604, "simple_hRise": 2.469, "simple_hTwist": 35.206 }, { "index": 18, "nt1": "///P/141", "nt2": "///P/73", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "num_stems": 2, "strand1": "CUUUACU", "strand2": "GAAGUGG", "bp_type": "|||||||", "helix_form": ".x..A.", "helical_rise": 2.800, "helical_rise_std": 0.923, "helical_radius": 9.554, "helical_radius_std": 1.792, "helical_axis": [ 0.137, -0.978, -0.157 ], "point1": [ 34.018, 69.440, 8.181 ], "point2": [ 36.286, 53.252, 5.585 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///P/89", "nt2": "///P/133", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.960, 0.090, 0.666, 14.778, -18.838, -2.336 ], "step_params": [ -0.853, -2.038, 3.768, 11.122, 1.989, 29.070 ], "heli_params": [ -4.209, 3.898, 3.097, 3.787, -21.175, 31.145 ], "bp2_params": [ 0.801, -0.144, -1.090, 9.779, -26.291, -6.378 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.768, "simple_Twist": 29.770, "simple_hRise": 3.117, "simple_hTwist": 31.796 }, { "index": 2, "nt1": "///P/90", "nt2": "///P/132", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.801, -0.144, -1.090, 9.779, -26.291, -6.378 ], "step_params": [ 0.693, -3.769, 6.905, 9.493, 27.632, 59.928 ], "heli_params": [ -5.615, 0.106, 4.988, 26.063, -8.954, 66.071 ], "bp2_params": [ 1.591, 0.228, -1.868, 6.527, -24.151, -19.692 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 6.905, "simple_Twist": 56.322, "simple_hRise": 4.823, "simple_hTwist": 62.894 }, { "index": 3, "nt1": "///P/92", "nt2": "///P/130", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.591, 0.228, -1.868, 6.527, -24.151, -19.692 ], "step_params": [ 0.934, -2.264, 4.239, -18.806, 12.485, 35.481 ], "heli_params": [ -4.651, -3.539, 2.557, 18.375, 27.679, 41.857 ], "bp2_params": [ 2.162, -0.261, 1.709, -31.291, 2.618, 5.175 ], "groove_widths": [ 19.967, null, 14.615, null ], "simple_Rise": 4.239, "simple_Twist": 30.845, "simple_hRise": 2.283, "simple_hTwist": 38.060 }, { "index": 4, "nt1": "///P/93", "nt2": "///P/129", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.162, -0.261, 1.709, -31.291, 2.618, 5.175 ], "step_params": [ -0.682, -1.616, 1.694, 13.861, 2.229, 23.355 ], "heli_params": [ -3.684, 2.988, 0.985, 4.972, -30.917, 27.199 ], "bp2_params": [ -0.470, -0.205, 0.425, 11.924, -20.015, -6.948 ], "groove_widths": [ 18.817, null, 15.830, null ], "simple_Rise": 1.694, "simple_Twist": 38.138, "simple_hRise": 1.287, "simple_hTwist": 40.549 }, { "index": 5, "nt1": "///P/94", "nt2": "///P/128", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.470, -0.205, 0.425, 11.924, -20.015, -6.948 ], "step_params": [ 0.722, -1.320, 3.312, 3.937, 2.033, 39.709 ], "heli_params": [ -2.169, -0.597, 3.297, 2.981, -5.774, 39.946 ], "bp2_params": [ 0.537, -0.189, -0.151, 9.005, -21.756, 0.662 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.312, "simple_Twist": 34.351, "simple_hRise": 3.290, "simple_hTwist": 34.627 }, { "index": 6, "nt1": "///P/95", "nt2": "///P/127", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.537, -0.189, -0.151, 9.005, -21.756, 0.662 ], "step_params": [ 0.006, -1.074, 3.770, 1.221, 11.042, 40.479 ], "heli_params": [ -2.783, 0.133, 3.376, 15.606, -1.726, 41.914 ], "bp2_params": [ 3.306, -0.640, 0.149, -7.705, -11.544, 7.237 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.770, "simple_Twist": 24.109, "simple_hRise": 2.994, "simple_hTwist": 26.511 }, { "index": 7, "nt1": "///P/96", "nt2": "///P/126", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "num_stems": 1, "strand1": "AAUCAUUAAGG", "strand2": "CAGGUGAUUCA", "bp_type": "...|||||||.", "helix_form": "...A...AA.", "helical_rise": 2.763, "helical_rise_std": 0.671, "helical_radius": 8.821, "helical_radius_std": 2.837, "helical_axis": [ -0.087, -0.989, 0.122 ], "point1": [ 40.816, 37.457, 14.960 ], "point2": [ 38.402, 10.157, 18.329 ], "num_pairs": 11, "pairs": [ { "index": 1, "nt1": "///P/99", "nt2": "///P/122", "bp": "A-C", "name": "~rHoogsteen", "Saenger": "25-XXV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -3.085, -0.339, -0.836, 1.443, -16.081, -93.291 ], "step_params": [ -0.265, -1.100, 2.929, 0.410, -3.340, 28.739 ], "heli_params": [ -1.526, 0.614, 3.031, -6.699, -0.823, 28.932 ], "bp2_params": [ -4.059, 1.245, -0.771, 19.772, -15.330, -103.864 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.929, "simple_Twist": 32.355, "simple_hRise": 3.021, "simple_hTwist": 32.525 }, { "index": 2, "nt1": "///P/100", "nt2": "///P/121", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.059, 1.245, -0.771, 19.772, -15.330, -103.864 ], "step_params": [ 1.737, -2.324, 3.239, -4.905, 1.698, 26.736 ], "heli_params": [ -5.329, -4.823, 2.732, 3.628, 10.482, 27.226 ], "bp2_params": [ -5.590, 0.135, -0.099, 18.953, -6.295, -64.519 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.239, "simple_Twist": 32.692, "simple_hRise": 2.834, "simple_hTwist": 33.090 }, { "index": 3, "nt1": "///P/101", "nt2": "///P/120", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -5.590, 0.135, -0.099, 18.953, -6.295, -64.519 ], "step_params": [ 3.053, -1.972, 3.372, -4.429, 10.373, 58.032 ], "heli_params": [ -2.507, -3.315, 2.795, 10.583, 4.519, 59.024 ], "bp2_params": [ 0.146, 0.005, -0.028, 15.461, -19.291, -3.239 ], "groove_widths": [ 18.063, null, 10.327, null ], "simple_Rise": 3.372, "simple_Twist": 31.886, "simple_hRise": 2.209, "simple_hTwist": 33.773 }, { "index": 4, "nt1": "///P/102", "nt2": "///P/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.146, 0.005, -0.028, 15.461, -19.291, -3.239 ], "step_params": [ 0.550, -1.765, 3.223, -2.216, 12.563, 32.274 ], "heli_params": [ -4.674, -1.225, 2.352, 21.577, 3.806, 34.641 ], "bp2_params": [ -0.140, -0.057, 0.506, 6.430, -21.801, 2.717 ], "groove_widths": [ 16.855, 15.551, 11.984, 9.426 ], "simple_Rise": 3.223, "simple_Twist": 33.602, "simple_hRise": 2.392, "simple_hTwist": 35.876 }, { "index": 5, "nt1": "///P/103", "nt2": "///P/118", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.140, -0.057, 0.506, 6.430, -21.801, 2.717 ], "step_params": [ 0.447, -1.596, 3.398, 8.237, 8.343, 41.362 ], "heli_params": [ -3.017, 0.214, 3.065, 11.535, -11.388, 42.922 ], "bp2_params": [ 2.276, -0.130, -0.074, -3.998, -20.308, 10.027 ], "groove_widths": [ 15.806, 14.165, 16.541, 11.203 ], "simple_Rise": 3.398, "simple_Twist": 27.457, "simple_hRise": 2.818, "simple_hTwist": 29.811 }, { "index": 6, "nt1": "///P/104", "nt2": "///P/117", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.276, -0.130, -0.074, -3.998, -20.308, 10.027 ], "step_params": [ -0.648, -1.940, 2.878, 4.119, 11.603, 19.130 ], "heli_params": [ -7.857, 2.687, 1.330, 31.088, -11.035, 22.719 ], "bp2_params": [ -0.068, 0.044, -0.379, 9.033, 3.895, 1.132 ], "groove_widths": [ 16.173, 14.571, 18.212, 14.155 ], "simple_Rise": 2.878, "simple_Twist": 32.354, "simple_hRise": 1.991, "simple_hTwist": 34.559 }, { "index": 7, "nt1": "///P/105", "nt2": "///P/116", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.068, 0.044, -0.379, 9.033, 3.895, 1.132 ], "step_params": [ -0.749, -1.618, 3.346, -5.688, 1.318, 28.152 ], "heli_params": [ -3.567, 0.188, 3.352, 2.674, 11.537, 28.739 ], "bp2_params": [ -0.356, -0.043, 0.130, 5.804, -5.696, -4.426 ], "groove_widths": [ 16.966, 15.666, 17.956, 16.663 ], "simple_Rise": 3.346, "simple_Twist": 29.628, "simple_hRise": 3.355, "simple_hTwist": 30.185 }, { "index": 8, "nt1": "///P/106", "nt2": "///P/115", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.356, -0.043, 0.130, 5.804, -5.696, -4.426 ], "step_params": [ 0.472, -1.284, 3.304, 2.058, 4.689, 36.123 ], "heli_params": [ -2.694, -0.472, 3.140, 7.515, -3.299, 36.472 ], "bp2_params": [ 0.144, -0.040, 0.071, 6.560, -13.946, 4.865 ], "groove_widths": [ 17.132, null, 19.142, null ], "simple_Rise": 3.304, "simple_Twist": 33.507, "simple_hRise": 3.124, "simple_hTwist": 33.885 }, { "index": 9, "nt1": "///P/107", "nt2": "///P/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.144, -0.040, 0.071, 6.560, -13.946, 4.865 ], "step_params": [ 0.160, -1.997, 3.353, -0.881, 4.318, 27.904 ], "heli_params": [ -5.076, -0.528, 3.010, 8.883, 1.813, 28.243 ], "bp2_params": [ -0.513, -0.032, 0.059, 3.566, -2.419, 0.468 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.353, "simple_Twist": 31.224, "simple_hRise": 3.051, "simple_hTwist": 31.526 }, { "index": 10, "nt1": "///P/108", "nt2": "///P/113", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.513, -0.032, 0.059, 3.566, -2.419, 0.468 ], "step_params": [ -4.045, -1.378, 3.397, 3.246, 16.433, 58.362 ], "heli_params": [ -2.134, 4.166, 2.748, 16.483, -3.256, 60.515 ], "bp2_params": [ 7.716, -5.560, 0.657, 3.680, -19.023, -37.386 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.397, "simple_Twist": 4.711, "simple_hRise": -1.132, "simple_hTwist": 17.396 }, { "index": 11, "nt1": "///P/109", "nt2": "///P/112", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] }, { "index": 6, "num_stems": 3, "strand1": "aCGCCGAACUgGCACC", "strand2": "GGCGGCUUGACCGUGG", "bp_type": ".|||||||||||||||", "helix_form": "xAAAxx..AxAAAAA", "helical_rise": 3.065, "helical_rise_std": 0.787, "helical_radius": 9.534, "helical_radius_std": 2.884, "helical_axis": [ 0.035, -0.955, 0.295 ], "point1": [ 30.518, 41.783, 35.418 ], "point2": [ 32.122, -2.042, 48.939 ], "num_pairs": 16, "pairs": [ { "index": 1, "nt1": "///F/0", "nt2": "///Q/57", "bp": "a+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "bp1_params": [ 2.811, 7.629, -0.852, 29.826, -2.384, 157.231 ], "step_params": [ 0.947, -3.030, 3.452, 11.128, 13.423, -70.398 ], "heli_params": [ 2.071, 1.217, 3.738, -11.468, 9.508, -72.253 ], "bp2_params": [ 0.172, -0.284, 0.101, 6.077, -6.803, -1.306 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.452, "simple_Twist": -2.382, "simple_hRise": 2.181, "simple_hTwist": -17.596 }, { "index": 2, "nt1": "///F/2", "nt2": "///Q/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.172, -0.284, 0.101, 6.077, -6.803, -1.306 ], "step_params": [ -0.845, -1.797, 3.342, -2.703, 6.067, 31.819 ], "heli_params": [ -4.256, 1.044, 3.017, 10.917, 4.865, 32.487 ], "bp2_params": [ -0.219, -0.323, -0.082, 2.295, -10.187, -0.476 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.342, "simple_Twist": 33.656, "simple_hRise": 3.038, "simple_hTwist": 34.286 }, { "index": 3, "nt1": "///F/3", "nt2": "///Q/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.219, -0.323, -0.082, 2.295, -10.187, -0.476 ], "step_params": [ -0.491, -1.632, 3.170, -1.087, 4.598, 30.157 ], "heli_params": [ -3.955, 0.730, 2.910, 8.770, 2.073, 30.516 ], "bp2_params": [ 0.296, -0.287, -0.233, 5.222, -16.854, -2.801 ], "groove_widths": [ 17.183, null, 18.377, null ], "simple_Rise": 3.170, "simple_Twist": 27.971, "simple_hRise": 2.886, "simple_hTwist": 28.359 }, { "index": 4, "nt1": "///F/4", "nt2": "///Q/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.296, -0.287, -0.233, 5.222, -16.854, -2.801 ], "step_params": [ -0.008, -1.795, 3.402, 0.543, 12.896, 28.903 ], "heli_params": [ -5.517, 0.109, 2.401, 24.363, -1.026, 31.598 ], "bp2_params": [ 0.493, -0.151, -0.253, 6.526, -7.115, -0.200 ], "groove_widths": [ 16.920, 13.682, 13.721, 11.590 ], "simple_Rise": 3.402, "simple_Twist": 27.542, "simple_hRise": 2.345, "simple_hTwist": 30.364 }, { "index": 5, "nt1": "///F/5", "nt2": "///Q/53", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.493, -0.151, -0.253, 6.526, -7.115, -0.200 ], "step_params": [ -2.608, -1.724, 3.985, -5.676, 3.588, 56.006 ], "heli_params": [ -2.076, 2.363, 4.102, 3.806, 6.020, 56.375 ], "bp2_params": [ -0.659, -0.151, 0.087, -21.642, -13.658, 1.090 ], "groove_widths": [ 16.112, 13.345, 9.756, 9.091 ], "simple_Rise": 3.985, "simple_Twist": 61.541, "simple_hRise": 4.092, "simple_hTwist": 61.870 }, { "index": 6, "nt1": "///F/7", "nt2": "///Q/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.659, -0.151, 0.087, -21.642, -13.658, 1.090 ], "step_params": [ 3.379, -0.470, 3.082, -20.482, 6.237, 67.746 ], "heli_params": [ -0.583, -3.500, 2.072, 5.458, 17.924, 70.662 ], "bp2_params": [ -0.308, 0.238, 0.181, 16.461, -9.971, 0.066 ], "groove_widths": [ 17.254, 14.758, 8.753, 8.624 ], "simple_Rise": 3.082, "simple_Twist": 66.621, "simple_hRise": 2.049, "simple_hTwist": 69.598 }, { "index": 7, "nt1": "///F/8", "nt2": "///Q/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.308, 0.238, 0.181, 16.461, -9.971, 0.066 ], "step_params": [ 0.204, -0.820, 3.259, -0.052, 6.177, 34.412 ], "heli_params": [ -2.276, -0.348, 3.070, 10.338, 0.087, 34.945 ], "bp2_params": [ -0.254, 0.048, 0.207, 18.286, -25.826, 5.119 ], "groove_widths": [ 20.092, null, 11.372, 9.181 ], "simple_Rise": 3.259, "simple_Twist": 34.892, "simple_hRise": 3.073, "simple_hTwist": 35.418 }, { "index": 8, "nt1": "///F/9", "nt2": "///Q/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.254, 0.048, 0.207, 18.286, -25.826, 5.119 ], "step_params": [ -0.139, -1.204, 3.283, 1.985, 7.299, 36.200 ], "heli_params": [ -2.853, 0.478, 2.981, 11.591, -3.153, 36.955 ], "bp2_params": [ -0.006, -0.066, -0.400, 10.167, -27.093, 2.886 ], "groove_widths": [ null, null, 13.702, 10.433 ], "simple_Rise": 3.283, "simple_Twist": 34.283, "simple_hRise": 2.960, "simple_hTwist": 35.083 }, { "index": 9, "nt1": "///F/10", "nt2": "///Q/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.006, -0.066, -0.400, 10.167, -27.093, 2.886 ], "step_params": [ -0.331, -1.549, 3.699, -5.530, 10.165, 32.111 ], "heli_params": [ -4.375, -0.378, 3.094, 17.676, 9.615, 34.081 ], "bp2_params": [ -0.213, -0.169, 0.491, -4.846, -9.612, -4.382 ], "groove_widths": [ null, null, 15.571, 12.351 ], "simple_Rise": 3.699, "simple_Twist": 32.613, "simple_hRise": 3.106, "simple_hTwist": 34.552 }, { "index": 10, "nt1": "///F/11", "nt2": "///Q/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.213, -0.169, 0.491, -4.846, -9.612, -4.382 ], "step_params": [ 0.083, -1.891, 2.973, 1.981, 2.812, 26.115 ], "heli_params": [ -4.813, 0.284, 2.756, 6.188, -4.360, 26.337 ], "bp2_params": [ -0.401, -0.085, 0.126, 1.794, -13.525, -3.216 ], "groove_widths": [ 16.084, null, 16.959, 14.583 ], "simple_Rise": 2.973, "simple_Twist": 27.405, "simple_hRise": 2.768, "simple_hTwist": 27.616 }, { "index": 11, "nt1": "///Q/12", "nt2": "///Q/22", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.401, -0.085, 0.126, 1.794, -13.525, -3.216 ], "step_params": [ -0.347, -1.873, 3.294, -1.717, 4.706, 36.088 ], "heli_params": [ -3.633, 0.323, 3.047, 7.552, 2.755, 36.422 ], "bp2_params": [ -0.070, -0.070, 0.248, -2.679, -15.930, -1.120 ], "groove_widths": [ 16.559, 15.365, 17.252, null ], "simple_Rise": 3.294, "simple_Twist": 33.971, "simple_hRise": 3.028, "simple_hTwist": 34.327 }, { "index": 12, "nt1": "///Q/13", "nt2": "///Q/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.070, -0.070, 0.248, -2.679, -15.930, -1.120 ], "step_params": [ 0.242, -1.453, 3.093, -0.477, 5.672, 33.185 ], "heli_params": [ -3.351, -0.489, 2.809, 9.841, 0.828, 33.656 ], "bp2_params": [ 0.185, -0.025, 0.227, 2.422, -12.101, 2.472 ], "groove_widths": [ 17.347, 16.018, null, null ], "simple_Rise": 3.093, "simple_Twist": 32.015, "simple_hRise": 2.797, "simple_hTwist": 32.504 }, { "index": 13, "nt1": "///Q/14", "nt2": "///Q/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.185, -0.025, 0.227, 2.422, -12.101, 2.472 ], "step_params": [ -0.122, -1.466, 2.739, -2.699, 10.413, 28.491 ], "heli_params": [ -4.387, -0.180, 2.088, 20.268, 5.254, 30.415 ], "bp2_params": [ 0.111, 0.074, 0.574, 13.065, -2.286, 4.495 ], "groove_widths": [ 17.870, null, 15.336, null ], "simple_Rise": 2.739, "simple_Twist": 28.965, "simple_hRise": 2.101, "simple_hTwist": 30.858 }, { "index": 14, "nt1": "///Q/15", "nt2": "///Q/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.111, 0.074, 0.574, 13.065, -2.286, 4.495 ], "step_params": [ 0.134, -1.345, 3.303, 6.229, 10.673, 33.584 ], "heli_params": [ -3.665, 0.641, 2.743, 17.742, -10.354, 35.724 ], "bp2_params": [ 0.236, -0.062, -0.154, 10.440, -17.380, 1.989 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.303, "simple_Twist": 33.130, "simple_hRise": 2.733, "simple_hTwist": 35.299 }, { "index": 15, "nt1": "///Q/16", "nt2": "///Q/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.236, -0.062, -0.154, 10.440, -17.380, 1.989 ], "step_params": [ 0.093, -2.073, 3.514, -2.697, 10.170, 32.292 ], "heli_params": [ -5.155, -0.584, 2.738, 17.709, 4.697, 33.919 ], "bp2_params": [ 0.362, -0.109, 0.163, -2.648, -6.049, 0.558 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.514, "simple_Twist": 31.276, "simple_hRise": 2.708, "simple_hTwist": 32.956 }, { "index": 16, "nt1": "///Q/17", "nt2": "///Q/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 7, "num_stems": 1, "strand1": "UCGA", "strand2": "AGCU", "bp_type": "|||.", "helix_form": "AAx", "helical_rise": 3.676, "helical_rise_std": 0.246, "helical_radius": 8.876, "helical_radius_std": 0.568, "helical_axis": [ -0.126, -0.646, 0.753 ], "point1": [ 14.512, 41.158, 35.621 ], "point2": [ 13.114, 33.959, 44.001 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///Q/43", "nt2": "///Q/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.013, -0.148, -0.234, 4.512, -7.802, -2.953 ], "step_params": [ 0.665, -2.109, 3.423, 0.360, 5.944, 37.665 ], "heli_params": [ -3.981, -0.972, 3.073, 9.136, -0.553, 38.116 ], "bp2_params": [ 0.275, -0.069, 0.214, -3.982, -7.197, -1.183 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.423, "simple_Twist": 36.333, "simple_hRise": 3.058, "simple_hTwist": 36.802 }, { "index": 2, "nt1": "///Q/44", "nt2": "///Q/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.275, -0.069, 0.214, -3.982, -7.197, -1.183 ], "step_params": [ 0.245, -1.273, 2.995, -3.989, 0.833, 19.362 ], "heli_params": [ -4.064, -2.425, 2.830, 2.442, 11.692, 19.783 ], "bp2_params": [ -0.468, -0.081, 0.540, 13.706, 5.829, 0.767 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.995, "simple_Twist": 23.017, "simple_hRise": 2.865, "simple_hTwist": 23.370 }, { "index": 3, "nt1": "///Q/45", "nt2": "///Q/29", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.468, -0.081, 0.540, 13.706, 5.829, 0.767 ], "step_params": [ 1.148, -2.191, 3.301, -0.476, -2.703, -45.811 ], "heli_params": [ 3.043, 1.431, 3.185, 3.469, -0.611, -45.889 ], "bp2_params": [ 0.140, 1.175, 0.203, -0.377, 13.468, 170.407 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.301, "simple_Twist": 61.871, "simple_hRise": 3.376, "simple_hTwist": 61.926 }, { "index": 4, "nt1": "///Q/46", "nt2": "///Q/51", "bp": "A+U", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W" } ] }, { "index": 8, "num_stems": 3, "strand1": "GACUCCCGGUUGUGAUGA", "strand2": "UUGGGGGCCAACACUACU", "bp_type": "||||||||||||||||||", "helix_form": ".A..Ax.AAAAxA...A", "helical_rise": 2.733, "helical_rise_std": 0.500, "helical_radius": 8.927, "helical_radius_std": 1.158, "helical_axis": [ -0.513, 0.854, -0.084 ], "point1": [ 27.783, 52.328, 35.505 ], "point2": [ 3.989, 91.950, 31.598 ], "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///Q/60", "nt2": "///Q/40", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -3.084, -0.955, 0.096, 0.586, -8.188, -7.581 ], "step_params": [ 0.021, -0.932, 2.805, -4.350, 2.607, 48.386 ], "heli_params": [ -1.301, -0.309, 2.742, 3.171, 5.290, 48.635 ], "bp2_params": [ 0.197, -0.067, 0.346, 15.543, -16.292, 0.246 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.805, "simple_Twist": 30.664, "simple_hRise": 2.690, "simple_hTwist": 31.071 }, { "index": 2, "nt1": "///Q/61", "nt2": "///Q/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.197, -0.067, 0.346, 15.543, -16.292, 0.246 ], "step_params": [ -0.132, -1.017, 3.432, 2.383, 7.768, 37.545 ], "heli_params": [ -2.535, 0.504, 3.154, 11.898, -3.651, 38.384 ], "bp2_params": [ 0.762, -0.376, -0.079, 10.607, -18.069, -2.232 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.432, "simple_Twist": 34.355, "simple_hRise": 3.119, "simple_hTwist": 35.275 }, { "index": 3, "nt1": "///Q/62", "nt2": "///Q/38", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.762, -0.376, -0.079, 10.607, -18.069, -2.232 ], "step_params": [ -0.023, -1.734, 3.512, 0.992, 9.624, 36.853 ], "heli_params": [ -3.893, 0.163, 2.981, 14.911, -1.536, 38.060 ], "bp2_params": [ 2.021, -0.501, 0.206, -0.062, -15.737, -3.144 ], "groove_widths": [ 16.709, null, 14.192, null ], "simple_Rise": 3.512, "simple_Twist": 29.864, "simple_hRise": 2.828, "simple_hTwist": 31.359 }, { "index": 4, "nt1": "///Q/63", "nt2": "///Q/37", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.021, -0.501, 0.206, -0.062, -15.737, -3.144 ], "step_params": [ 0.261, -1.868, 2.869, 2.961, 8.714, 27.369 ], "heli_params": [ -5.295, 0.002, 2.197, 17.791, -6.044, 28.847 ], "bp2_params": [ 0.405, -0.285, 0.151, 0.901, -12.076, 0.035 ], "groove_widths": [ 16.613, 15.162, 14.107, 10.659 ], "simple_Rise": 2.869, "simple_Twist": 35.991, "simple_hRise": 2.381, "simple_hTwist": 37.111 }, { "index": 5, "nt1": "///Q/64", "nt2": "///Q/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.405, -0.285, 0.151, 0.901, -12.076, 0.035 ], "step_params": [ 0.346, -1.724, 3.367, -0.522, 6.192, 36.723 ], "heli_params": [ -3.513, -0.610, 3.041, 9.743, 0.821, 37.227 ], "bp2_params": [ 0.481, -0.080, 0.677, -9.699, -11.211, -0.143 ], "groove_widths": [ 16.732, 15.287, 15.506, 13.362 ], "simple_Rise": 3.367, "simple_Twist": 36.282, "simple_hRise": 3.036, "simple_hTwist": 36.793 }, { "index": 6, "nt1": "///Q/65", "nt2": "///Q/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.481, -0.080, 0.677, -9.699, -11.211, -0.143 ], "step_params": [ 0.020, -1.555, 3.172, 2.174, 7.353, 32.529 ], "heli_params": [ -3.825, 0.296, 2.761, 12.904, -3.816, 33.397 ], "bp2_params": [ 0.554, -0.126, 0.443, -10.144, -9.147, -0.105 ], "groove_widths": [ 17.367, 16.102, 14.603, 10.588 ], "simple_Rise": 3.172, "simple_Twist": 31.867, "simple_hRise": 2.750, "simple_hTwist": 32.753 }, { "index": 7, "nt1": "///Q/66", "nt2": "///Q/84", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.554, -0.126, 0.443, -10.144, -9.147, -0.105 ], "step_params": [ 0.524, -0.832, 2.835, 1.251, 11.993, 28.597 ], "heli_params": [ -3.460, -0.783, 2.327, 23.030, -2.401, 30.986 ], "bp2_params": [ -0.514, -0.231, 0.257, 4.760, -15.306, -0.613 ], "groove_widths": [ 18.105, 16.732, 14.870, 11.508 ], "simple_Rise": 2.835, "simple_Twist": 34.823, "simple_hRise": 2.443, "simple_hTwist": 36.790 }, { "index": 8, "nt1": "///Q/67", "nt2": "///Q/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.514, -0.231, 0.257, 4.760, -15.306, -0.613 ], "step_params": [ 0.790, -1.845, 3.384, 2.395, 6.616, 31.737 ], "heli_params": [ -4.443, -0.998, 2.998, 11.915, -4.313, 32.488 ], "bp2_params": [ -0.152, -0.029, 0.364, -3.350, -20.648, 4.524 ], "groove_widths": [ 16.883, 15.034, 16.327, 13.734 ], "simple_Rise": 3.384, "simple_Twist": 29.404, "simple_hRise": 2.961, "simple_hTwist": 30.216 }, { "index": 9, "nt1": "///Q/68", "nt2": "///Q/82", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.152, -0.029, 0.364, -3.350, -20.648, 4.524 ], "step_params": [ -1.178, -1.785, 3.317, 5.457, 3.485, 32.412 ], "heli_params": [ -3.703, 2.956, 2.884, 6.166, -9.656, 33.036 ], "bp2_params": [ -0.194, 0.002, -0.524, -8.865, -17.996, -0.135 ], "groove_widths": [ 15.982, 14.815, 17.101, 15.481 ], "simple_Rise": 3.317, "simple_Twist": 32.430, "simple_hRise": 2.884, "simple_hTwist": 33.053 }, { "index": 10, "nt1": "///Q/69", "nt2": "///Q/81", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.194, 0.002, -0.524, -8.865, -17.996, -0.135 ], "step_params": [ 0.643, -0.768, 3.233, -4.319, 6.110, 33.571 ], "heli_params": [ -2.213, -1.734, 2.949, 10.417, 7.363, 34.371 ], "bp2_params": [ 0.058, 0.084, 0.195, -2.760, -10.394, 3.503 ], "groove_widths": [ 16.854, 15.714, 15.883, 14.633 ], "simple_Rise": 3.233, "simple_Twist": 32.649, "simple_hRise": 2.939, "simple_hTwist": 33.473 }, { "index": 11, "nt1": "///Q/70", "nt2": "///Q/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.058, 0.084, 0.195, -2.760, -10.394, 3.503 ], "step_params": [ 0.423, -1.314, 2.719, -1.330, 9.619, 28.147 ], "heli_params": [ -4.101, -1.037, 2.141, 19.074, 2.638, 29.743 ], "bp2_params": [ 0.100, 0.054, 0.788, 11.847, -8.211, 4.188 ], "groove_widths": [ 16.773, 15.030, 14.884, 12.919 ], "simple_Rise": 2.719, "simple_Twist": 28.112, "simple_hRise": 2.140, "simple_hTwist": 29.710 }, { "index": 12, "nt1": "///Q/71", "nt2": "///Q/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.100, 0.054, 0.788, 11.847, -8.211, 4.188 ], "step_params": [ -2.127, -1.393, 3.182, 4.858, 2.813, 45.588 ], "heli_params": [ -2.011, 3.116, 2.867, 3.614, -6.242, 45.914 ], "bp2_params": [ -0.183, -0.028, -0.521, 8.442, -17.238, -13.188 ], "groove_widths": [ 16.455, 14.915, 14.911, 12.624 ], "simple_Rise": 3.182, "simple_Twist": 47.459, "simple_hRise": 2.881, "simple_hTwist": 47.771 }, { "index": 13, "nt1": "///Q/136", "nt2": "///Q/78", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.183, -0.028, -0.521, 8.442, -17.238, -13.188 ], "step_params": [ 0.761, -1.630, 3.310, -6.404, 15.541, 27.008 ], "heli_params": [ -5.449, -2.408, 1.893, 29.884, 12.314, 31.729 ], "bp2_params": [ -0.858, 0.091, 0.205, 1.614, -5.416, 7.789 ], "groove_widths": [ 16.815, 15.271, 13.644, 10.129 ], "simple_Rise": 3.310, "simple_Twist": 30.014, "simple_hRise": 2.046, "simple_hTwist": 34.306 }, { "index": 14, "nt1": "///Q/137", "nt2": "///Q/77", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.858, 0.091, 0.205, 1.614, -5.416, 7.789 ], "step_params": [ -0.517, -1.439, 3.163, 3.966, 4.464, 36.866 ], "heli_params": [ -2.798, 1.297, 2.906, 7.003, -6.221, 37.330 ], "bp2_params": [ 0.125, 0.313, -0.319, 1.666, -13.764, 9.816 ], "groove_widths": [ 17.031, 15.591, 17.654, 10.708 ], "simple_Rise": 3.163, "simple_Twist": 31.508, "simple_hRise": 2.853, "simple_hTwist": 32.054 }, { "index": 15, "nt1": "///Q/138", "nt2": "///Q/76", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.125, 0.313, -0.319, 1.666, -13.764, 9.816 ], "step_params": [ 0.263, -1.013, 2.941, 2.940, 4.783, 36.206 ], "heli_params": [ -2.192, -0.063, 2.801, 7.639, -4.697, 36.624 ], "bp2_params": [ 0.520, 0.507, -0.426, 11.070, -17.548, 0.835 ], "groove_widths": [ 17.162, null, 15.387, null ], "simple_Rise": 2.941, "simple_Twist": 34.922, "simple_hRise": 2.794, "simple_hTwist": 35.357 }, { "index": 16, "nt1": "///Q/139", "nt2": "///Q/75", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.520, 0.507, -0.426, 11.070, -17.548, 0.835 ], "step_params": [ 0.491, -1.204, 3.431, -0.951, 20.515, 33.572 ], "heli_params": [ -4.139, -0.841, 2.331, 32.066, 1.486, 39.200 ], "bp2_params": [ 1.061, 0.246, 0.211, -3.844, -13.670, 7.754 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.431, "simple_Twist": 29.867, "simple_hRise": 2.172, "simple_hTwist": 36.114 }, { "index": 17, "nt1": "///Q/140", "nt2": "///Q/74", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.061, 0.246, 0.211, -3.844, -13.670, 7.754 ], "step_params": [ -0.972, -1.633, 3.043, 6.627, 9.601, 30.543 ], "heli_params": [ -4.286, 2.682, 2.191, 17.446, -12.042, 32.645 ], "bp2_params": [ 0.673, 0.308, -0.455, 5.951, 1.697, -4.078 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.043, "simple_Twist": 32.694, "simple_hRise": 2.255, "simple_hTwist": 34.660 }, { "index": 18, "nt1": "///Q/141", "nt2": "///Q/73", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 9, "num_stems": 1, "strand1": "GCUUUUACU", "strand2": "UGAAAGUGG", "bp_type": "|||||||||", "helix_form": ".AAA..A.", "helical_rise": 2.722, "helical_rise_std": 0.113, "helical_radius": 9.011, "helical_radius_std": 0.312, "helical_axis": [ 0.109, -0.985, 0.132 ], "point1": [ -2.680, 69.327, 35.773 ], "point2": [ -0.323, 48.029, 38.620 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///Q/88", "nt2": "///Q/134", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.041, -0.186, -0.070, -10.014, -8.777, 0.086 ], "step_params": [ -0.933, -1.665, 3.206, -0.913, -0.359, 41.506 ], "heli_params": [ -2.311, 1.220, 3.239, -0.506, 1.288, 41.517 ], "bp2_params": [ 1.039, -0.066, -0.037, -3.192, -10.816, 0.233 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.206, "simple_Twist": 25.363, "simple_hRise": 3.260, "simple_hTwist": 25.382 }, { "index": 2, "nt1": "///Q/89", "nt2": "///Q/133", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.039, -0.066, -0.037, -3.192, -10.816, 0.233 ], "step_params": [ 0.013, -1.775, 2.931, -1.908, 4.634, 21.326 ], "heli_params": [ -6.182, -0.656, 2.482, 12.303, 5.067, 21.900 ], "bp2_params": [ -0.599, 0.097, 0.171, 8.951, -11.058, 5.539 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.931, "simple_Twist": 30.822, "simple_hRise": 2.637, "simple_hTwist": 31.217 }, { "index": 3, "nt1": "///Q/90", "nt2": "///Q/132", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.599, 0.097, 0.171, 8.951, -11.058, 5.539 ], "step_params": [ 0.021, -1.407, 3.423, 2.851, 10.263, 34.280 ], "heli_params": [ -3.741, 0.369, 2.888, 16.913, -4.699, 35.849 ], "bp2_params": [ -0.184, 0.070, -0.264, 1.137, -17.683, 4.567 ], "groove_widths": [ 17.026, null, 15.903, null ], "simple_Rise": 3.423, "simple_Twist": 31.548, "simple_hRise": 2.830, "simple_hTwist": 33.254 }, { "index": 4, "nt1": "///Q/91", "nt2": "///Q/131", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.184, 0.070, -0.264, 1.137, -17.683, 4.567 ], "step_params": [ 0.321, -1.418, 3.307, -4.076, 8.657, 32.490 ], "heli_params": [ -3.766, -1.178, 2.789, 15.070, 7.096, 33.833 ], "bp2_params": [ -0.348, -0.008, 0.187, -4.902, -13.743, 2.426 ], "groove_widths": [ 16.567, 15.277, 15.425, 12.364 ], "simple_Rise": 3.307, "simple_Twist": 33.371, "simple_hRise": 2.805, "simple_hTwist": 34.678 }, { "index": 5, "nt1": "///Q/92", "nt2": "///Q/130", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.348, -0.008, 0.187, -4.902, -13.743, 2.426 ], "step_params": [ -0.176, -1.516, 3.254, -3.103, 3.328, 41.849 ], "heli_params": [ -2.448, -0.069, 3.135, 4.642, 4.329, 42.085 ], "bp2_params": [ 2.426, -0.655, 0.722, -6.529, -8.143, -3.562 ], "groove_widths": [ 16.531, 15.214, 15.174, 12.011 ], "simple_Rise": 3.254, "simple_Twist": 26.535, "simple_hRise": 3.045, "simple_hTwist": 26.915 }, { "index": 6, "nt1": "///Q/93", "nt2": "///Q/129", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.426, -0.655, 0.722, -6.529, -8.143, -3.562 ], "step_params": [ -0.292, -1.624, 2.876, 10.092, 7.062, 26.356 ], "heli_params": [ -4.487, 2.365, 2.128, 14.521, -20.753, 29.046 ], "bp2_params": [ -0.100, -0.151, -0.199, -1.838, -17.572, 2.531 ], "groove_widths": [ 16.798, null, 15.021, null ], "simple_Rise": 2.876, "simple_Twist": 40.199, "simple_hRise": 2.431, "simple_hTwist": 41.969 }, { "index": 7, "nt1": "///Q/94", "nt2": "///Q/128", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.100, -0.151, -0.199, -1.838, -17.572, 2.531 ], "step_params": [ 0.558, -1.329, 3.195, -0.709, 4.428, 33.518 ], "heli_params": [ -2.965, -1.069, 2.988, 7.636, 1.222, 33.808 ], "bp2_params": [ 0.591, -0.243, 0.165, 0.373, -13.798, 1.064 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.195, "simple_Twist": 29.909, "simple_hRise": 2.958, "simple_hTwist": 30.235 }, { "index": 8, "nt1": "///Q/95", "nt2": "///Q/127", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.591, -0.243, 0.165, 0.373, -13.798, 1.064 ], "step_params": [ -0.605, -1.660, 3.240, 1.898, 6.783, 34.667 ], "heli_params": [ -3.673, 1.259, 2.839, 11.239, -3.145, 35.353 ], "bp2_params": [ 2.012, -0.621, 0.068, 1.741, -9.813, -8.486 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.240, "simple_Twist": 27.266, "simple_hRise": 2.708, "simple_hTwist": 28.144 }, { "index": 9, "nt1": "///Q/96", "nt2": "///Q/126", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 10, "num_stems": 1, "strand1": "AAUCAUUAAGG", "strand2": "CAGGUGAUUCA", "bp_type": "...|||||||.", "helix_form": "...A..AAA.", "helical_rise": 2.771, "helical_rise_std": 0.556, "helical_radius": 8.570, "helical_radius_std": 2.564, "helical_axis": [ 0.431, -0.902, 0.018 ], "point1": [ 1.952, 31.628, 33.922 ], "point2": [ 13.881, 6.626, 34.431 ], "num_pairs": 11, "pairs": [ { "index": 1, "nt1": "///Q/99", "nt2": "///Q/122", "bp": "A-C", "name": "~rHoogsteen", "Saenger": "25-XXV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -3.173, -0.175, -0.509, 1.340, -12.524, -95.669 ], "step_params": [ -0.093, -1.142, 2.886, 2.678, -6.119, 26.593 ], "heli_params": [ -1.018, 0.806, 3.044, -13.043, -5.707, 27.404 ], "bp2_params": [ -4.377, 1.025, -0.407, 15.662, -12.009, -105.933 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.886, "simple_Twist": 31.500, "simple_hRise": 3.031, "simple_hTwist": 32.183 }, { "index": 2, "nt1": "///Q/100", "nt2": "///Q/121", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.377, 1.025, -0.407, 15.662, -12.009, -105.933 ], "step_params": [ 1.815, -2.475, 3.205, -4.104, 4.630, 30.324 ], "heli_params": [ -5.435, -4.109, 2.546, 8.737, 7.744, 30.934 ], "bp2_params": [ -5.297, 0.295, -0.379, 17.136, -11.086, -60.325 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.205, "simple_Twist": 33.049, "simple_hRise": 2.606, "simple_hTwist": 33.607 }, { "index": 3, "nt1": "///Q/101", "nt2": "///Q/120", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "t.W", "DSSR": "t.-W", "bp1_params": [ -5.297, 0.295, -0.379, 17.136, -11.086, -60.325 ], "step_params": [ 2.776, -1.709, 3.533, -5.964, 10.236, 53.637 ], "heli_params": [ -2.464, -3.369, 2.886, 11.190, 6.520, 54.835 ], "bp2_params": [ 0.116, -0.058, 0.034, 15.293, -14.171, 0.351 ], "groove_widths": [ 18.404, null, 9.990, null ], "simple_Rise": 3.533, "simple_Twist": 29.003, "simple_hRise": 2.216, "simple_hTwist": 31.281 }, { "index": 4, "nt1": "///Q/102", "nt2": "///Q/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.116, -0.058, 0.034, 15.293, -14.171, 0.351 ], "step_params": [ 0.581, -1.721, 3.222, -2.191, 17.067, 35.060 ], "heli_params": [ -4.378, -1.102, 2.150, 26.453, 3.395, 38.936 ], "bp2_params": [ -0.145, -0.050, 0.271, 4.032, -24.601, 4.460 ], "groove_widths": [ 17.236, 15.776, 12.959, 10.702 ], "simple_Rise": 3.222, "simple_Twist": 36.405, "simple_hRise": 2.195, "simple_hTwist": 40.142 }, { "index": 5, "nt1": "///Q/103", "nt2": "///Q/118", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, -0.050, 0.271, 4.032, -24.601, 4.460 ], "step_params": [ 0.384, -1.545, 3.441, 2.512, 2.514, 41.622 ], "heli_params": [ -2.443, -0.264, 3.363, 3.531, -3.527, 41.767 ], "bp2_params": [ 2.139, -0.206, 0.161, -2.411, -15.587, 4.708 ], "groove_widths": [ 16.077, 14.221, 16.354, 10.904 ], "simple_Rise": 3.441, "simple_Twist": 29.119, "simple_hRise": 3.319, "simple_hTwist": 29.331 }, { "index": 6, "nt1": "///Q/104", "nt2": "///Q/117", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.139, -0.206, 0.161, -2.411, -15.587, 4.708 ], "step_params": [ -1.411, -2.760, 3.251, -1.376, 8.456, 18.529 ], "heli_params": [ -10.933, 3.472, 1.916, 24.627, 4.008, 20.398 ], "bp2_params": [ -0.038, 0.052, 0.398, -9.365, -8.763, -3.419 ], "groove_widths": [ 16.364, 14.767, 18.224, 13.899 ], "simple_Rise": 3.251, "simple_Twist": 30.243, "simple_hRise": 2.468, "simple_hTwist": 31.406 }, { "index": 7, "nt1": "///Q/105", "nt2": "///Q/116", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.038, 0.052, 0.398, -9.365, -8.763, -3.419 ], "step_params": [ 0.430, -1.043, 3.131, 5.838, 8.606, 34.314 ], "heli_params": [ -2.850, 0.082, 2.829, 14.187, -9.624, 35.810 ], "bp2_params": [ 0.440, 0.242, -0.424, -3.861, -12.161, 9.494 ], "groove_widths": [ 17.204, 15.934, 16.886, 15.364 ], "simple_Rise": 3.131, "simple_Twist": 31.507, "simple_hRise": 2.791, "simple_hTwist": 33.138 }, { "index": 8, "nt1": "///Q/106", "nt2": "///Q/115", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.440, 0.242, -0.424, -3.861, -12.161, 9.494 ], "step_params": [ -0.258, -1.043, 2.983, -4.461, 1.704, 29.997 ], "heli_params": [ -2.302, -0.323, 2.928, 3.266, 8.551, 30.366 ], "bp2_params": [ -0.081, -0.006, 0.185, 6.492, -12.118, 2.800 ], "groove_widths": [ 17.617, null, 17.021, null ], "simple_Rise": 2.983, "simple_Twist": 33.163, "simple_hRise": 2.936, "simple_hTwist": 33.496 }, { "index": 9, "nt1": "///Q/107", "nt2": "///Q/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.081, -0.006, 0.185, 6.492, -12.118, 2.800 ], "step_params": [ 0.325, -2.003, 3.209, 1.732, 10.506, 30.022 ], "heli_params": [ -5.353, -0.312, 2.404, 19.525, -3.219, 31.814 ], "bp2_params": [ -0.333, -0.080, 0.055, 8.341, -0.335, -0.739 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.209, "simple_Twist": 31.314, "simple_hRise": 2.442, "simple_hTwist": 33.032 }, { "index": 10, "nt1": "///Q/108", "nt2": "///Q/113", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.333, -0.080, 0.055, 8.341, -0.335, -0.739 ], "step_params": [ -3.842, -1.370, 3.512, 2.022, 17.455, 55.930 ], "heli_params": [ -2.321, 4.043, 2.877, 18.121, -2.099, 58.412 ], "bp2_params": [ 7.465, -5.294, 0.986, 5.481, -19.039, -40.792 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.512, "simple_Twist": 5.183, "simple_hRise": -0.731, "simple_hTwist": 18.315 }, { "index": 11, "nt1": "///Q/109", "nt2": "///Q/112", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] }, { "index": 11, "num_stems": 3, "strand1": "aCGCCGAACUgGCACC", "strand2": "GGCGGCUUGACCGUGG", "bp_type": ".|||||||||||||||", "helix_form": "xAAAxx.AAxAAAAA", "helical_rise": 3.068, "helical_rise_std": 0.788, "helical_radius": 9.563, "helical_radius_std": 2.846, "helical_axis": [ 0.052, 0.958, -0.280 ], "point1": [ 30.179, 19.043, 66.148 ], "point2": [ 32.585, 63.053, 53.277 ], "num_pairs": 16, "pairs": [ { "index": 1, "nt1": "///G/0", "nt2": "///R/57", "bp": "a+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "bp1_params": [ 2.916, 7.701, -0.566, 26.818, -3.932, 157.762 ], "step_params": [ 0.965, -2.837, 3.586, 9.251, 12.284, -70.964 ], "heli_params": [ 1.935, 1.169, 3.836, -10.460, 7.877, -72.397 ], "bp2_params": [ 0.025, -0.258, -0.016, 4.816, -2.339, -1.784 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.586, "simple_Twist": -2.875, "simple_hRise": 2.318, "simple_hTwist": -15.643 }, { "index": 2, "nt1": "///G/2", "nt2": "///R/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.025, -0.258, -0.016, 4.816, -2.339, -1.784 ], "step_params": [ -0.760, -1.910, 3.301, -2.397, 7.800, 29.458 ], "heli_params": [ -5.089, 0.994, 2.768, 14.981, 4.604, 30.543 ], "bp2_params": [ -0.666, -0.364, -0.307, 2.333, -10.814, -1.167 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.301, "simple_Twist": 33.060, "simple_hRise": 2.837, "simple_hTwist": 34.025 }, { "index": 3, "nt1": "///G/3", "nt2": "///R/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.666, -0.364, -0.307, 2.333, -10.814, -1.167 ], "step_params": [ -0.242, -1.619, 3.314, -6.151, 2.811, 32.060 ], "heli_params": [ -3.356, -0.631, 3.155, 5.021, 10.984, 32.748 ], "bp2_params": [ -0.022, -0.200, 0.187, 3.646, -13.382, 0.802 ], "groove_widths": [ 17.097, null, 18.502, null ], "simple_Rise": 3.314, "simple_Twist": 29.200, "simple_hRise": 3.132, "simple_hTwist": 29.956 }, { "index": 4, "nt1": "///G/4", "nt2": "///R/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.022, -0.200, 0.187, 3.646, -13.382, 0.802 ], "step_params": [ -0.079, -1.887, 3.308, 2.085, 8.968, 30.026 ], "heli_params": [ -5.058, 0.511, 2.637, 16.819, -3.909, 31.375 ], "bp2_params": [ 0.363, -0.155, -0.094, 4.634, -0.767, -1.313 ], "groove_widths": [ 16.842, 13.674, 13.705, 11.507 ], "simple_Rise": 3.308, "simple_Twist": 27.448, "simple_hRise": 2.563, "simple_hTwist": 28.923 }, { "index": 5, "nt1": "///G/5", "nt2": "///R/53", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.363, -0.155, -0.094, 4.634, -0.767, -1.313 ], "step_params": [ -2.459, -1.681, 3.835, -3.144, 7.130, 56.453 ], "heli_params": [ -2.221, 2.377, 3.736, 7.498, 3.306, 56.944 ], "bp2_params": [ -0.755, -0.004, 0.048, -27.471, -17.054, 3.208 ], "groove_widths": [ 16.155, 13.400, 9.863, 9.251 ], "simple_Rise": 3.835, "simple_Twist": 61.838, "simple_hRise": 3.749, "simple_hTwist": 62.279 }, { "index": 6, "nt1": "///G/7", "nt2": "///R/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.755, -0.004, 0.048, -27.471, -17.054, 3.208 ], "step_params": [ 3.272, -0.322, 3.107, -21.436, 4.812, 68.139 ], "heli_params": [ -0.412, -3.415, 2.106, 4.186, 18.647, 71.185 ], "bp2_params": [ -0.023, -0.083, 0.228, 15.926, -10.397, -3.016 ], "groove_widths": [ 17.354, 14.840, 8.789, 8.689 ], "simple_Rise": 3.107, "simple_Twist": 65.219, "simple_hRise": 2.047, "simple_hTwist": 68.431 }, { "index": 7, "nt1": "///G/8", "nt2": "///R/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.023, -0.083, 0.228, 15.926, -10.397, -3.016 ], "step_params": [ 0.121, -0.676, 3.357, 2.417, 5.504, 34.283 ], "heli_params": [ -1.979, 0.171, 3.214, 9.248, -4.061, 34.790 ], "bp2_params": [ -0.197, 0.031, 0.031, 16.532, -28.263, 3.557 ], "groove_widths": [ 20.261, null, 11.831, 9.691 ], "simple_Rise": 3.357, "simple_Twist": 35.800, "simple_hRise": 3.223, "simple_hTwist": 36.285 }, { "index": 8, "nt1": "///G/9", "nt2": "///R/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.197, 0.031, 0.031, 16.532, -28.263, 3.557 ], "step_params": [ -0.199, -1.321, 3.264, 0.547, 12.483, 34.848 ], "heli_params": [ -3.654, 0.382, 2.649, 20.063, -0.879, 36.955 ], "bp2_params": [ 0.045, -0.076, -0.390, 8.107, -30.563, -0.494 ], "groove_widths": [ null, null, 14.235, 10.696 ], "simple_Rise": 3.264, "simple_Twist": 33.062, "simple_hRise": 2.608, "simple_hTwist": 35.282 }, { "index": 9, "nt1": "///G/10", "nt2": "///R/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.045, -0.076, -0.390, 8.107, -30.563, -0.494 ], "step_params": [ -0.340, -1.685, 3.688, -5.698, 8.236, 31.028 ], "heli_params": [ -4.546, -0.460, 3.160, 14.917, 10.319, 32.566 ], "bp2_params": [ 0.006, -0.199, 0.325, -4.387, -9.684, -4.580 ], "groove_widths": [ null, null, 16.225, 13.102 ], "simple_Rise": 3.688, "simple_Twist": 31.060, "simple_hRise": 3.161, "simple_hTwist": 32.597 }, { "index": 10, "nt1": "///G/11", "nt2": "///R/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.006, -0.199, 0.325, -4.387, -9.684, -4.580 ], "step_params": [ -0.145, -1.778, 3.196, 2.730, 5.772, 26.455 ], "heli_params": [ -5.111, 0.937, 2.725, 12.384, -5.858, 27.201 ], "bp2_params": [ -0.178, -0.162, -0.026, -5.132, -11.607, -9.815 ], "groove_widths": [ 16.230, null, 17.467, 15.007 ], "simple_Rise": 3.196, "simple_Twist": 26.924, "simple_hRise": 2.734, "simple_hTwist": 27.658 }, { "index": 11, "nt1": "///R/12", "nt2": "///R/22", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.178, -0.162, -0.026, -5.132, -11.607, -9.815 ], "step_params": [ -0.642, -1.767, 3.868, 4.322, 17.161, 37.601 ], "heli_params": [ -4.454, 1.400, 2.755, 25.002, -6.296, 41.421 ], "bp2_params": [ -0.027, -0.092, -1.373, -24.844, -34.278, -2.614 ], "groove_widths": [ 16.760, 15.515, 17.748, null ], "simple_Rise": 3.868, "simple_Twist": 34.988, "simple_hRise": 2.656, "simple_hTwist": 39.084 }, { "index": 12, "nt1": "///R/13", "nt2": "///R/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.027, -0.092, -1.373, -24.844, -34.278, -2.614 ], "step_params": [ 0.448, -0.689, 2.576, -12.574, -1.442, 29.436 ], "heli_params": [ -1.050, -2.559, 2.234, -2.688, 23.429, 31.986 ], "bp2_params": [ -0.167, 0.268, -0.087, 5.781, -18.339, 7.833 ], "groove_widths": [ 17.532, 16.064, null, null ], "simple_Rise": 2.576, "simple_Twist": 32.441, "simple_hRise": 2.279, "simple_hTwist": 34.761 }, { "index": 13, "nt1": "///R/14", "nt2": "///R/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.167, 0.268, -0.087, 5.781, -18.339, 7.833 ], "step_params": [ -0.809, -1.517, 3.308, 1.872, 14.912, 27.407 ], "heli_params": [ -5.356, 1.823, 2.156, 28.883, -3.627, 31.188 ], "bp2_params": [ -0.012, 0.031, -0.624, 5.998, -14.560, -3.969 ], "groove_widths": [ 17.686, null, 15.334, null ], "simple_Rise": 3.308, "simple_Twist": 26.575, "simple_hRise": 2.116, "simple_hTwist": 30.463 }, { "index": 14, "nt1": "///R/15", "nt2": "///R/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.012, 0.031, -0.624, 5.998, -14.560, -3.969 ], "step_params": [ 0.454, -1.763, 3.350, -6.846, 12.018, 37.003 ], "heli_params": [ -3.942, -1.429, 2.558, 18.175, 10.354, 39.418 ], "bp2_params": [ 0.459, -0.163, 0.306, 1.983, -10.718, -0.681 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.350, "simple_Twist": 34.255, "simple_hRise": 2.481, "simple_hTwist": 36.864 }, { "index": 15, "nt1": "///R/16", "nt2": "///R/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.459, -0.163, 0.306, 1.983, -10.718, -0.681 ], "step_params": [ 0.332, -2.139, 3.294, 1.232, 4.944, 29.984 ], "heli_params": [ -5.026, -0.397, 2.923, 9.470, -2.360, 30.404 ], "bp2_params": [ 0.102, 0.188, 0.332, -4.467, -7.475, 4.861 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.294, "simple_Twist": 31.994, "simple_hRise": 2.949, "simple_hTwist": 32.387 }, { "index": 16, "nt1": "///R/17", "nt2": "///R/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 12, "num_stems": 1, "strand1": "UCGA", "strand2": "AGCU", "bp_type": "|||.", "helix_form": "AAx", "helical_rise": 3.667, "helical_rise_std": 0.284, "helical_radius": 8.895, "helical_radius_std": 0.560, "helical_axis": [ -0.140, 0.649, -0.748 ], "point1": [ 14.505, 19.714, 65.748 ], "point2": [ 12.952, 26.942, 57.424 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///R/43", "nt2": "///R/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.119, -0.120, -0.503, 11.447, -10.772, -3.216 ], "step_params": [ 0.609, -2.210, 3.545, -2.176, 7.595, 35.759 ], "heli_params": [ -4.576, -1.273, 2.988, 12.186, 3.491, 36.593 ], "bp2_params": [ 0.035, -0.240, 0.235, -2.622, -8.265, -5.091 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.545, "simple_Twist": 35.989, "simple_hRise": 2.992, "simple_hTwist": 36.818 }, { "index": 2, "nt1": "///R/44", "nt2": "///R/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.035, -0.240, 0.235, -2.622, -8.265, -5.091 ], "step_params": [ 0.450, -1.222, 3.057, -3.018, -0.257, 21.593 ], "heli_params": [ -3.138, -2.286, 2.981, -0.682, 8.005, 21.802 ], "bp2_params": [ -0.228, -0.092, 0.510, 14.762, 8.419, 2.312 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.057, "simple_Twist": 22.367, "simple_hRise": 2.984, "simple_hTwist": 22.569 }, { "index": 3, "nt1": "///R/45", "nt2": "///R/29", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.228, -0.092, 0.510, 14.762, 8.419, 2.312 ], "step_params": [ 1.239, -2.318, 3.093, -1.338, -2.688, -47.799 ], "heli_params": [ 3.054, 1.428, 2.997, 3.314, -1.649, -47.888 ], "bp2_params": [ 0.046, 1.024, 0.371, 0.362, 19.227, 170.663 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.093, "simple_Twist": 61.947, "simple_hRise": 3.156, "simple_hTwist": 62.013 }, { "index": 4, "nt1": "///R/46", "nt2": "///R/51", "bp": "A+U", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W" } ] }, { "index": 13, "num_stems": 3, "strand1": "GACUCCCGGUUGUGAUGA", "strand2": "UUGGGGGCCAACACUACU", "bp_type": "||||||||||||||||||", "helix_form": ".A..AxA.AAAxAAA..", "helical_rise": 2.704, "helical_rise_std": 0.407, "helical_radius": 8.963, "helical_radius_std": 1.065, "helical_axis": [ -0.518, -0.846, 0.123 ], "point1": [ 27.678, 8.617, 65.379 ], "point2": [ 3.944, -30.123, 71.015 ], "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///R/60", "nt2": "///R/40", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.812, -0.738, 0.232, 3.523, -9.650, -6.070 ], "step_params": [ 0.019, -0.692, 2.939, -1.870, 4.113, 47.391 ], "heli_params": [ -1.151, -0.157, 2.870, 5.104, 2.320, 47.594 ], "bp2_params": [ 0.314, 0.012, 0.211, 15.304, -20.710, 1.009 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.939, "simple_Twist": 31.098, "simple_hRise": 2.821, "simple_hTwist": 31.417 }, { "index": 2, "nt1": "///R/61", "nt2": "///R/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.314, 0.012, 0.211, 15.304, -20.710, 1.009 ], "step_params": [ -0.049, -1.094, 3.363, 0.851, 8.233, 33.794 ], "heli_params": [ -3.075, 0.211, 3.019, 13.905, -1.437, 34.764 ], "bp2_params": [ 0.217, -0.303, -0.066, 10.284, -17.737, -1.734 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.363, "simple_Twist": 34.087, "simple_hRise": 3.023, "simple_hTwist": 35.048 }, { "index": 3, "nt1": "///R/62", "nt2": "///R/38", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.217, -0.303, -0.066, 10.284, -17.737, -1.734 ], "step_params": [ 0.123, -1.447, 3.508, 1.808, 8.729, 40.453 ], "heli_params": [ -3.010, 0.025, 3.146, 12.441, -2.577, 41.383 ], "bp2_params": [ 2.308, -0.506, 0.016, 2.066, -16.395, 0.296 ], "groove_widths": [ 16.832, null, 14.015, null ], "simple_Rise": 3.508, "simple_Twist": 28.887, "simple_hRise": 2.957, "simple_hTwist": 30.203 }, { "index": 4, "nt1": "///R/63", "nt2": "///R/37", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.308, -0.506, 0.016, 2.066, -16.395, 0.296 ], "step_params": [ -0.106, -1.625, 2.790, 3.513, 10.698, 25.152 ], "heli_params": [ -5.392, 0.871, 1.920, 23.143, -7.600, 27.521 ], "bp2_params": [ 0.173, 0.029, -0.107, 7.134, -14.941, -1.479 ], "groove_widths": [ 16.783, 15.432, 14.094, 10.408 ], "simple_Rise": 2.790, "simple_Twist": 36.757, "simple_hRise": 2.230, "simple_hTwist": 38.386 }, { "index": 5, "nt1": "///R/64", "nt2": "///R/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.173, 0.029, -0.107, 7.134, -14.941, -1.479 ], "step_params": [ 0.514, -1.886, 3.481, 1.475, 6.885, 34.605 ], "heli_params": [ -4.143, -0.627, 3.079, 11.428, -2.448, 35.292 ], "bp2_params": [ 0.208, -0.362, 0.042, -1.648, -10.305, -4.635 ], "groove_widths": [ 16.720, 15.324, 15.298, 13.306 ], "simple_Rise": 3.481, "simple_Twist": 34.228, "simple_hRise": 3.074, "simple_hTwist": 34.923 }, { "index": 6, "nt1": "///R/65", "nt2": "///R/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.208, -0.362, 0.042, -1.648, -10.305, -4.635 ], "step_params": [ -0.024, -1.420, 3.390, -0.632, 7.461, 36.436 ], "heli_params": [ -3.217, -0.046, 3.050, 11.779, 0.998, 37.172 ], "bp2_params": [ 0.361, -0.220, 0.387, -7.269, -7.498, -9.769 ], "groove_widths": [ 17.331, 16.098, 14.787, 11.311 ], "simple_Rise": 3.390, "simple_Twist": 35.010, "simple_hRise": 3.033, "simple_hTwist": 35.777 }, { "index": 7, "nt1": "///R/66", "nt2": "///R/84", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.361, -0.220, 0.387, -7.269, -7.498, -9.769 ], "step_params": [ 0.855, -0.957, 2.993, 3.624, 15.113, 25.551 ], "heli_params": [ -4.558, -1.013, 2.196, 30.806, -7.388, 29.839 ], "bp2_params": [ -0.703, -0.239, -0.167, 1.676, -13.093, 0.676 ], "groove_widths": [ 18.115, 16.763, 15.161, 12.017 ], "simple_Rise": 2.993, "simple_Twist": 31.897, "simple_hRise": 2.392, "simple_hTwist": 35.393 }, { "index": 8, "nt1": "///R/67", "nt2": "///R/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.703, -0.239, -0.167, 1.676, -13.093, 0.676 ], "step_params": [ 0.733, -1.734, 3.521, -0.279, 5.200, 33.981 ], "heli_params": [ -3.778, -1.286, 3.223, 8.832, 0.473, 34.366 ], "bp2_params": [ -0.185, -0.106, 0.173, -5.876, -22.331, 4.717 ], "groove_widths": [ 16.849, 15.043, 16.801, 14.251 ], "simple_Rise": 3.521, "simple_Twist": 30.819, "simple_hRise": 3.186, "simple_hTwist": 31.245 }, { "index": 9, "nt1": "///R/68", "nt2": "///R/82", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.185, -0.106, 0.173, -5.876, -22.331, 4.717 ], "step_params": [ -1.232, -1.925, 3.142, 1.593, 1.294, 30.993 ], "heli_params": [ -3.828, 2.588, 2.996, 2.418, -2.977, 31.059 ], "bp2_params": [ -0.327, -0.174, -0.260, -3.302, -20.608, -3.916 ], "groove_widths": [ 15.905, 14.742, 17.223, 15.581 ], "simple_Rise": 3.142, "simple_Twist": 31.895, "simple_hRise": 3.001, "simple_hTwist": 31.959 }, { "index": 10, "nt1": "///R/69", "nt2": "///R/81", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.327, -0.174, -0.260, -3.302, -20.608, -3.916 ], "step_params": [ 0.503, -0.979, 3.375, -1.994, 9.488, 33.911 ], "heli_params": [ -3.013, -1.125, 2.968, 15.868, 3.335, 35.230 ], "bp2_params": [ 0.258, -0.060, 0.226, -5.901, -12.260, 1.617 ], "groove_widths": [ 16.998, 15.727, 16.519, 14.869 ], "simple_Rise": 3.375, "simple_Twist": 30.922, "simple_hRise": 2.917, "simple_hTwist": 32.371 }, { "index": 11, "nt1": "///R/70", "nt2": "///R/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.258, -0.060, 0.226, -5.901, -12.260, 1.617 ], "step_params": [ 0.481, -1.364, 2.958, 0.306, 12.594, 26.255 ], "heli_params": [ -4.968, -0.904, 2.101, 25.913, -0.630, 29.073 ], "bp2_params": [ -0.132, -0.038, 0.314, 1.535, -7.519, 3.580 ], "groove_widths": [ 17.180, 15.300, 14.603, 11.698 ], "simple_Rise": 2.958, "simple_Twist": 28.361, "simple_hRise": 2.174, "simple_hTwist": 30.980 }, { "index": 12, "nt1": "///R/71", "nt2": "///R/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.132, -0.038, 0.314, 1.535, -7.519, 3.580 ], "step_params": [ -2.045, -1.516, 3.234, -4.747, 4.081, 47.213 ], "heli_params": [ -2.205, 2.153, 3.279, 5.069, 5.896, 47.603 ], "bp2_params": [ -0.225, -0.083, 0.245, -1.201, -10.971, -10.349 ], "groove_widths": [ 17.015, 15.392, 14.863, 12.056 ], "simple_Rise": 3.234, "simple_Twist": 47.820, "simple_hRise": 3.279, "simple_hTwist": 48.204 }, { "index": 13, "nt1": "///R/136", "nt2": "///R/78", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.225, -0.083, 0.245, -1.201, -10.971, -10.349 ], "step_params": [ -0.019, -1.676, 3.221, 1.310, 13.126, 29.375 ], "heli_params": [ -5.098, 0.241, 2.280, 24.394, -2.434, 32.141 ], "bp2_params": [ -0.166, 0.027, -0.157, -5.303, -14.968, -9.804 ], "groove_widths": [ 17.076, 15.584, 13.392, 9.737 ], "simple_Rise": 3.221, "simple_Twist": 28.647, "simple_hRise": 2.253, "simple_hTwist": 31.481 }, { "index": 14, "nt1": "///R/137", "nt2": "///R/77", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.166, 0.027, -0.157, -5.303, -14.968, -9.804 ], "step_params": [ -0.332, -1.496, 3.281, -2.779, 3.549, 37.218 ], "heli_params": [ -2.786, 0.158, 3.146, 5.535, 4.334, 37.480 ], "bp2_params": [ 0.916, -0.015, -0.031, -7.968, -12.221, -5.659 ], "groove_widths": [ 17.224, 15.935, 18.433, 11.488 ], "simple_Rise": 3.281, "simple_Twist": 31.595, "simple_hRise": 3.116, "simple_hTwist": 31.907 }, { "index": 15, "nt1": "///R/138", "nt2": "///R/76", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.916, -0.015, -0.031, -7.968, -12.221, -5.659 ], "step_params": [ 0.522, -1.642, 3.074, 0.230, 9.096, 29.035 ], "heli_params": [ -4.712, -0.956, 2.462, 17.605, -0.445, 30.398 ], "bp2_params": [ 0.342, 0.192, 0.315, -4.273, -14.349, 3.296 ], "groove_widths": [ 17.412, null, 15.810, null ], "simple_Rise": 3.074, "simple_Twist": 32.147, "simple_hRise": 2.531, "simple_hTwist": 33.377 }, { "index": 16, "nt1": "///R/139", "nt2": "///R/75", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.342, 0.192, 0.315, -4.273, -14.349, 3.296 ], "step_params": [ 0.546, -1.367, 3.084, 2.551, 12.373, 35.091 ], "heli_params": [ -3.591, -0.556, 2.509, 19.748, -4.071, 37.228 ], "bp2_params": [ 0.522, 0.113, 0.228, -6.381, -19.087, 7.568 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.084, "simple_Twist": 33.842, "simple_hRise": 2.482, "simple_hTwist": 36.058 }, { "index": 17, "nt1": "///R/140", "nt2": "///R/74", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.522, 0.113, 0.228, -6.381, -19.087, 7.568 ], "step_params": [ -0.477, -1.361, 3.055, 5.654, 0.744, 35.841 ], "heli_params": [ -2.281, 1.493, 2.921, 1.200, -9.116, 36.278 ], "bp2_params": [ 1.288, 0.439, -0.040, 2.868, -11.049, 1.316 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.055, "simple_Twist": 32.165, "simple_hRise": 2.900, "simple_hTwist": 32.654 }, { "index": 18, "nt1": "///R/141", "nt2": "///R/73", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 14, "num_stems": 1, "strand1": "GCUUUUACU", "strand2": "UGAAAGUGG", "bp_type": "|||||||||", "helix_form": ".AAA..A.", "helical_rise": 2.745, "helical_rise_std": 0.178, "helical_radius": 9.020, "helical_radius_std": 0.390, "helical_axis": [ 0.119, 0.985, -0.123 ], "point1": [ -3.178, -8.519, 65.819 ], "point2": [ -0.571, 12.979, 63.141 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///R/88", "nt2": "///R/134", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.513, -0.395, -0.040, -5.850, -10.315, 5.977 ], "step_params": [ -0.761, -1.482, 3.328, -1.068, 1.771, 42.456 ], "heli_params": [ -2.225, 0.941, 3.283, 2.444, 1.474, 42.504 ], "bp2_params": [ 0.583, -0.031, 0.039, -5.493, -15.090, 2.634 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.328, "simple_Twist": 25.391, "simple_hRise": 3.247, "simple_hTwist": 25.474 }, { "index": 2, "nt1": "///R/89", "nt2": "///R/133", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.583, -0.031, 0.039, -5.493, -15.090, 2.634 ], "step_params": [ -0.331, -1.622, 3.002, 0.273, 9.192, 23.535 ], "heli_params": [ -5.927, 0.824, 2.216, 21.512, -0.640, 25.245 ], "bp2_params": [ -0.322, -0.129, -0.217, 5.784, -13.701, -2.169 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.002, "simple_Twist": 29.041, "simple_hRise": 2.385, "simple_hTwist": 30.433 }, { "index": 3, "nt1": "///R/90", "nt2": "///R/132", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.322, -0.129, -0.217, 5.784, -13.701, -2.169 ], "step_params": [ 0.153, -1.611, 3.421, -0.930, 9.190, 30.706 ], "heli_params": [ -4.537, -0.441, 2.827, 16.881, 1.709, 32.034 ], "bp2_params": [ -0.205, -0.009, -0.222, 0.091, -13.966, 1.507 ], "groove_widths": [ 17.061, null, 15.939, null ], "simple_Rise": 3.421, "simple_Twist": 29.877, "simple_hRise": 2.807, "simple_hTwist": 31.241 }, { "index": 4, "nt1": "///R/91", "nt2": "///R/131", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.205, -0.009, -0.222, 0.091, -13.966, 1.507 ], "step_params": [ 0.200, -1.432, 3.316, -0.565, 7.199, 35.217 ], "heli_params": [ -3.321, -0.403, 2.972, 11.747, 0.923, 35.926 ], "bp2_params": [ -0.137, -0.184, -0.139, -3.459, -15.490, -3.050 ], "groove_widths": [ 16.448, 15.139, 15.469, 12.932 ], "simple_Rise": 3.316, "simple_Twist": 34.627, "simple_hRise": 2.965, "simple_hTwist": 35.349 }, { "index": 5, "nt1": "///R/92", "nt2": "///R/130", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.137, -0.184, -0.139, -3.459, -15.490, -3.050 ], "step_params": [ 0.274, -1.235, 3.223, -1.778, 4.074, 42.255 ], "heli_params": [ -2.104, -0.553, 3.083, 5.632, 2.458, 42.478 ], "bp2_params": [ 2.536, -0.582, 0.321, -2.255, -9.389, 2.614 ], "groove_widths": [ 16.357, 15.026, 15.020, 12.212 ], "simple_Rise": 3.223, "simple_Twist": 27.378, "simple_hRise": 2.988, "simple_hTwist": 27.730 }, { "index": 6, "nt1": "///R/93", "nt2": "///R/129", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.536, -0.582, 0.321, -2.255, -9.389, 2.614 ], "step_params": [ -0.339, -1.530, 3.017, 5.232, 7.399, 26.100 ], "heli_params": [ -4.740, 1.794, 2.389, 15.790, -11.166, 27.603 ], "bp2_params": [ 0.110, -0.072, 0.100, -3.565, -18.325, 5.500 ], "groove_widths": [ 16.664, null, 15.056, null ], "simple_Rise": 3.017, "simple_Twist": 39.408, "simple_hRise": 2.635, "simple_hTwist": 40.396 }, { "index": 7, "nt1": "///R/94", "nt2": "///R/128", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.110, -0.072, 0.100, -3.565, -18.325, 5.500 ], "step_params": [ 0.424, -1.524, 3.149, 1.123, 4.544, 30.277 ], "heli_params": [ -3.721, -0.597, 2.908, 8.635, -2.134, 30.628 ], "bp2_params": [ 0.264, -0.265, 0.227, -0.021, -14.423, -2.240 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.149, "simple_Twist": 29.932, "simple_hRise": 2.905, "simple_hTwist": 30.288 }, { "index": 8, "nt1": "///R/95", "nt2": "///R/127", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.264, -0.265, 0.227, -0.021, -14.423, -2.240 ], "step_params": [ -0.254, -1.436, 3.290, 3.083, 7.337, 43.142 ], "heli_params": [ -2.599, 0.625, 2.995, 9.877, -4.150, 43.836 ], "bp2_params": [ 2.954, -0.703, 0.247, -0.924, -9.200, -0.683 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.290, "simple_Twist": 27.696, "simple_hRise": 2.782, "simple_hTwist": 28.795 }, { "index": 9, "nt1": "///R/96", "nt2": "///R/126", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 15, "num_stems": 1, "strand1": "AAUCAUUAAGG", "strand2": "CAGGUGAUUCA", "bp_type": "...|||||||.", "helix_form": "......AAA.", "helical_rise": 2.774, "helical_rise_std": 0.613, "helical_radius": 8.547, "helical_radius_std": 2.495, "helical_axis": [ 0.440, 0.898, 0.003 ], "point1": [ 1.547, 29.315, 67.392 ], "point2": [ 13.749, 54.221, 67.474 ], "num_pairs": 11, "pairs": [ { "index": 1, "nt1": "///R/99", "nt2": "///R/122", "bp": "A-C", "name": "~rHoogsteen", "Saenger": "25-XXV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -3.026, -0.253, -0.507, 2.712, -13.967, -93.970 ], "step_params": [ -0.134, -1.151, 2.969, 2.037, -4.187, 29.164 ], "heli_params": [ -1.430, 0.667, 3.084, -8.248, -4.012, 29.525 ], "bp2_params": [ -4.117, 1.072, -0.585, 17.507, -16.227, -103.834 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.969, "simple_Twist": 32.805, "simple_hRise": 3.074, "simple_hTwist": 33.125 }, { "index": 2, "nt1": "///R/100", "nt2": "///R/121", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.117, 1.072, -0.585, 17.507, -16.227, -103.834 ], "step_params": [ 1.607, -2.564, 3.283, -1.754, 0.782, 27.849 ], "heli_params": [ -5.497, -3.740, 3.106, 1.623, 3.638, 27.914 ], "bp2_params": [ -5.283, 0.274, -0.457, 14.676, -11.374, -64.035 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.283, "simple_Twist": 31.785, "simple_hRise": 3.130, "simple_hTwist": 31.841 }, { "index": 3, "nt1": "///R/101", "nt2": "///R/120", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -5.283, 0.274, -0.457, 14.676, -11.374, -64.035 ], "step_params": [ 3.261, -1.440, 3.425, -4.285, 12.694, 52.873 ], "heli_params": [ -2.319, -3.816, 2.784, 14.003, 4.726, 54.425 ], "bp2_params": [ -0.114, 0.155, -0.206, 18.996, -16.060, 3.986 ], "groove_widths": [ 18.621, null, 10.180, null ], "simple_Rise": 3.425, "simple_Twist": 29.878, "simple_hRise": 2.173, "simple_hTwist": 32.682 }, { "index": 4, "nt1": "///R/102", "nt2": "///R/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.114, 0.155, -0.206, 18.996, -16.060, 3.986 ], "step_params": [ 0.634, -1.573, 3.265, -2.920, 19.903, 34.983 ], "heli_params": [ -4.270, -1.213, 2.057, 30.223, 4.434, 40.197 ], "bp2_params": [ -0.240, -0.058, 0.312, 3.928, -25.994, 7.286 ], "groove_widths": [ 17.404, 15.888, 12.442, 10.088 ], "simple_Rise": 3.265, "simple_Twist": 35.099, "simple_hRise": 2.062, "simple_hTwist": 40.297 }, { "index": 5, "nt1": "///R/103", "nt2": "///R/118", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.240, -0.058, 0.312, 3.928, -25.994, 7.286 ], "step_params": [ 0.029, -1.427, 3.368, 4.320, 2.193, 42.588 ], "heli_params": [ -2.175, 0.399, 3.282, 3.008, -5.925, 42.850 ], "bp2_params": [ 2.324, -0.446, -0.028, 0.509, -23.623, 0.598 ], "groove_widths": [ 16.037, 14.185, 16.327, 11.463 ], "simple_Rise": 3.368, "simple_Twist": 28.830, "simple_hRise": 3.223, "simple_hTwist": 29.225 }, { "index": 6, "nt1": "///R/104", "nt2": "///R/117", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.324, -0.446, -0.028, 0.509, -23.623, 0.598 ], "step_params": [ -1.105, -2.597, 3.318, -2.055, 10.691, 18.744 ], "heli_params": [ -10.422, 2.267, 1.709, 29.790, 5.727, 21.652 ], "bp2_params": [ -0.207, -0.152, 0.241, -9.204, -8.249, -5.230 ], "groove_widths": [ 16.200, 14.704, 18.349, 14.073 ], "simple_Rise": 3.318, "simple_Twist": 32.300, "simple_hRise": 2.424, "simple_hTwist": 34.039 }, { "index": 7, "nt1": "///R/105", "nt2": "///R/116", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.152, 0.241, -9.204, -8.249, -5.230 ], "step_params": [ 0.331, -1.137, 3.066, 3.004, 4.893, 35.319 ], "heli_params": [ -2.499, -0.141, 2.905, 7.999, -4.911, 35.768 ], "bp2_params": [ 0.673, 0.215, -0.010, -1.105, -16.409, 5.926 ], "groove_widths": [ 17.028, 15.867, 16.772, 15.109 ], "simple_Rise": 3.066, "simple_Twist": 30.322, "simple_hRise": 2.870, "simple_hTwist": 30.849 }, { "index": 8, "nt1": "///R/106", "nt2": "///R/115", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.673, 0.215, -0.010, -1.105, -16.409, 5.926 ], "step_params": [ -0.101, -1.310, 2.784, -3.441, 0.655, 28.255 ], "heli_params": [ -2.791, -0.464, 2.747, 1.335, 7.014, 28.466 ], "bp2_params": [ -0.121, 0.041, 0.536, 14.262, -11.162, 0.533 ], "groove_widths": [ 17.337, null, 17.330, null ], "simple_Rise": 2.784, "simple_Twist": 32.963, "simple_hRise": 2.755, "simple_hTwist": 33.143 }, { "index": 9, "nt1": "///R/107", "nt2": "///R/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.121, 0.041, 0.536, 14.262, -11.162, 0.533 ], "step_params": [ 0.621, -2.117, 3.458, 3.489, 10.553, 32.138 ], "heli_params": [ -5.262, -0.522, 2.699, 18.388, -6.080, 33.958 ], "bp2_params": [ -0.126, 0.268, 0.100, 3.327, -3.476, 5.795 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.458, "simple_Twist": 31.826, "simple_hRise": 2.690, "simple_hTwist": 33.664 }, { "index": 10, "nt1": "///R/108", "nt2": "///R/113", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.126, 0.268, 0.100, 3.327, -3.476, 5.795 ], "step_params": [ -4.022, -1.350, 3.317, 2.762, 16.338, 56.820 ], "heli_params": [ -2.158, 4.218, 2.690, 16.779, -2.837, 58.993 ], "bp2_params": [ 7.638, -5.613, 0.914, 5.876, -17.512, -39.233 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.317, "simple_Twist": 5.292, "simple_hRise": -0.893, "simple_hTwist": 17.389 }, { "index": 11, "nt1": "///R/109", "nt2": "///R/112", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] }, { "index": 16, "num_stems": 3, "strand1": "aCGCCGAACUgGCACC", "strand2": "GGCGGCUUGACCGUGG", "bp_type": ".|||||||||||||||", "helix_form": "xAAAxxA.AxA...A", "helical_rise": 3.104, "helical_rise_std": 0.866, "helical_radius": 9.410, "helical_radius_std": 2.398, "helical_axis": [ 0.150, 0.982, 0.113 ], "point1": [ 13.048, 23.213, 89.403 ], "point2": [ 20.005, 68.926, 94.655 ], "num_pairs": 16, "pairs": [ { "index": 1, "nt1": "///H/0", "nt2": "///S/57", "bp": "a+G", "name": "Linker", "Saenger": "--", "LW": "tSS", "DSSR": "tm+m", "bp1_params": [ 2.826, 7.612, -0.500, 25.128, -6.827, 157.404 ], "step_params": [ 1.296, -3.082, 3.541, 10.157, 10.674, -70.641 ], "heli_params": [ 2.221, 1.485, 3.723, -9.132, 8.690, -71.965 ], "bp2_params": [ -0.058, -0.072, -0.060, 5.630, -10.195, 2.102 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.541, "simple_Twist": -1.486, "simple_hRise": 1.689, "simple_hTwist": -14.809 }, { "index": 2, "nt1": "///H/2", "nt2": "///S/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.058, -0.072, -0.060, 5.630, -10.195, 2.102 ], "step_params": [ -0.925, -1.752, 3.292, -3.803, 7.641, 29.917 ], "heli_params": [ -4.674, 1.026, 2.861, 14.436, 7.185, 31.084 ], "bp2_params": [ -0.493, -0.277, -0.215, 3.301, -8.565, 2.114 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.292, "simple_Twist": 32.310, "simple_hRise": 2.900, "simple_hTwist": 33.389 }, { "index": 3, "nt1": "///H/3", "nt2": "///S/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.493, -0.277, -0.215, 3.301, -8.565, 2.114 ], "step_params": [ -0.290, -1.472, 3.202, -1.865, 3.922, 33.528 ], "heli_params": [ -3.138, 0.211, 3.027, 6.763, 3.217, 33.800 ], "bp2_params": [ 0.471, -0.352, -0.234, 5.633, -17.089, 1.798 ], "groove_widths": [ 16.884, null, 18.557, null ], "simple_Rise": 3.202, "simple_Twist": 28.498, "simple_hRise": 2.989, "simple_hTwist": 28.820 }, { "index": 4, "nt1": "///H/4", "nt2": "///S/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.471, -0.352, -0.234, 5.633, -17.089, 1.798 ], "step_params": [ -0.433, -1.577, 3.214, 4.614, 11.417, 25.456 ], "heli_params": [ -5.554, 1.826, 2.206, 24.187, -9.775, 28.234 ], "bp2_params": [ 0.175, -0.203, -0.842, 16.706, -8.533, -3.772 ], "groove_widths": [ 16.588, 13.437, 13.935, 11.651 ], "simple_Rise": 3.214, "simple_Twist": 27.336, "simple_hRise": 2.285, "simple_hTwist": 29.934 }, { "index": 5, "nt1": "///H/5", "nt2": "///S/53", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.175, -0.203, -0.842, 16.706, -8.533, -3.772 ], "step_params": [ -2.360, -1.545, 4.452, -8.545, 9.396, 59.151 ], "heli_params": [ -2.169, 1.771, 4.455, 9.401, 8.549, 60.379 ], "bp2_params": [ -0.550, 0.084, -0.279, -30.514, -15.612, 5.016 ], "groove_widths": [ 15.928, 13.225, 9.809, 9.249 ], "simple_Rise": 4.452, "simple_Twist": 61.845, "simple_hRise": 4.459, "simple_hTwist": 63.009 }, { "index": 6, "nt1": "///H/7", "nt2": "///S/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.550, 0.084, -0.279, -30.514, -15.612, 5.016 ], "step_params": [ 2.880, -0.349, 2.885, -22.882, 5.395, 66.143 ], "heli_params": [ -0.452, -3.139, 1.892, 4.790, 20.317, 69.747 ], "bp2_params": [ -0.130, -0.005, 0.265, 14.458, -16.646, -5.759 ], "groove_widths": [ 17.203, 14.884, 8.537, 8.496 ], "simple_Rise": 2.885, "simple_Twist": 64.724, "simple_hRise": 1.864, "simple_hTwist": 68.423 }, { "index": 7, "nt1": "///H/8", "nt2": "///S/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.130, -0.005, 0.265, 14.458, -16.646, -5.759 ], "step_params": [ 0.324, -1.171, 3.209, -1.216, 7.497, 29.317 ], "heli_params": [ -3.662, -0.851, 2.814, 14.508, 2.353, 30.264 ], "bp2_params": [ -0.276, 0.186, 0.228, 17.325, -20.219, 1.600 ], "groove_widths": [ 20.260, null, 11.840, 9.107 ], "simple_Rise": 3.209, "simple_Twist": 30.913, "simple_hRise": 2.839, "simple_hTwist": 31.810 }, { "index": 8, "nt1": "///H/9", "nt2": "///S/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.276, 0.186, 0.228, 17.325, -20.219, 1.600 ], "step_params": [ 0.246, -1.497, 3.574, -2.545, 9.491, 41.473 ], "heli_params": [ -3.061, -0.607, 3.153, 13.180, 3.535, 42.571 ], "bp2_params": [ 0.483, -0.160, 0.456, -1.657, -19.944, 3.852 ], "groove_widths": [ null, null, 14.032, 9.585 ], "simple_Rise": 3.574, "simple_Twist": 36.434, "simple_hRise": 3.079, "simple_hTwist": 37.692 }, { "index": 9, "nt1": "///H/10", "nt2": "///S/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.483, -0.160, 0.456, -1.657, -19.944, 3.852 ], "step_params": [ -0.708, -1.919, 3.183, -0.043, 6.472, 26.214 ], "heli_params": [ -5.604, 1.507, 2.642, 13.999, 0.093, 26.987 ], "bp2_params": [ -0.530, 0.100, 0.413, -7.408, -13.546, -2.895 ], "groove_widths": [ null, null, 15.416, 11.689 ], "simple_Rise": 3.183, "simple_Twist": 31.595, "simple_hRise": 2.747, "simple_hTwist": 32.234 }, { "index": 10, "nt1": "///H/11", "nt2": "///S/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.530, 0.100, 0.413, -7.408, -13.546, -2.895 ], "step_params": [ -0.338, -2.122, 3.112, 2.858, 7.552, 29.627 ], "heli_params": [ -5.301, 1.127, 2.465, 14.434, -5.463, 30.684 ], "bp2_params": [ -1.113, -0.171, -0.001, -9.192, -16.452, -2.909 ], "groove_widths": [ 16.013, null, 17.120, 14.292 ], "simple_Rise": 3.112, "simple_Twist": 32.706, "simple_hRise": 2.535, "simple_hTwist": 33.661 }, { "index": 11, "nt1": "///S/12", "nt2": "///S/22", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.113, -0.171, -0.001, -9.192, -16.452, -2.909 ], "step_params": [ 0.114, -1.621, 2.880, -3.472, 1.201, 34.015 ], "heli_params": [ -2.920, -0.671, 2.798, 2.045, 5.913, 34.206 ], "bp2_params": [ -1.310, 0.330, 0.517, -0.520, -20.165, 8.919 ], "groove_widths": [ 16.205, 15.056, 16.846, null ], "simple_Rise": 2.880, "simple_Twist": 35.010, "simple_hRise": 2.801, "simple_hTwist": 35.197 }, { "index": 12, "nt1": "///S/13", "nt2": "///S/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.310, 0.330, 0.517, -0.520, -20.165, 8.919 ], "step_params": [ 0.229, -1.132, 3.022, 3.721, -4.929, 39.615 ], "heli_params": [ -1.117, 0.068, 3.143, -7.219, -5.449, 40.075 ], "bp2_params": [ 0.752, 0.321, 0.381, 12.340, -24.417, 5.919 ], "groove_widths": [ 16.806, 15.503, null, null ], "simple_Rise": 3.022, "simple_Twist": 29.600, "simple_hRise": 3.169, "simple_hTwist": 30.223 }, { "index": 13, "nt1": "///S/14", "nt2": "///S/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.752, 0.321, 0.381, 12.340, -24.417, 5.919 ], "step_params": [ -0.498, -1.328, 2.531, 0.881, 11.994, 22.022 ], "heli_params": [ -5.445, 1.323, 1.583, 28.799, -2.114, 25.056 ], "bp2_params": [ -1.701, 0.140, 0.474, 26.880, -18.977, -8.063 ], "groove_widths": [ 17.254, null, 15.256, null ], "simple_Rise": 2.531, "simple_Twist": 34.977, "simple_hRise": 1.972, "simple_hTwist": 36.926 }, { "index": 14, "nt1": "///S/15", "nt2": "///S/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.701, 0.140, 0.474, 26.880, -18.977, -8.063 ], "step_params": [ -0.449, -2.205, 3.663, 1.914, 12.281, 46.397 ], "heli_params": [ -3.721, 0.709, 3.001, 15.269, -2.380, 47.944 ], "bp2_params": [ 0.772, -0.283, -0.239, 8.838, -9.757, -13.643 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.663, "simple_Twist": 32.780, "simple_hRise": 2.661, "simple_hTwist": 34.997 }, { "index": 15, "nt1": "///S/16", "nt2": "///S/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.772, -0.283, -0.239, 8.838, -9.757, -13.643 ], "step_params": [ 0.692, -2.003, 3.410, -3.131, 9.994, 28.844 ], "heli_params": [ -5.629, -1.885, 2.505, 19.279, 6.040, 30.649 ], "bp2_params": [ 0.592, -0.218, 0.344, 3.489, 0.399, 2.461 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.410, "simple_Twist": 29.835, "simple_hRise": 2.539, "simple_hTwist": 31.581 }, { "index": 16, "nt1": "///S/17", "nt2": "///S/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 17, "num_stems": 1, "strand1": "UCGA", "strand2": "AGCU", "bp_type": "|||.", "helix_form": "AAx", "helical_rise": 3.731, "helical_rise_std": 0.260, "helical_radius": 9.004, "helical_radius_std": 0.578, "helical_axis": [ 0.361, 0.673, 0.646 ], "point1": [ 25.745, 19.511, 90.119 ], "point2": [ 29.842, 27.147, 97.447 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///S/43", "nt2": "///S/31", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.013, -0.095, -0.019, 0.777, -8.776, 0.429 ], "step_params": [ 0.433, -2.147, 3.203, 2.515, 1.104, 37.282 ], "heli_params": [ -3.492, -0.353, 3.162, 1.725, -3.927, 37.380 ], "bp2_params": [ 0.416, -0.177, 0.206, -0.631, -9.106, -4.744 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.203, "simple_Twist": 35.386, "simple_hRise": 3.159, "simple_hTwist": 35.489 }, { "index": 2, "nt1": "///S/44", "nt2": "///S/30", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.416, -0.177, 0.206, -0.631, -9.106, -4.744 ], "step_params": [ 0.448, -1.286, 2.954, -3.980, 3.283, 19.320 ], "heli_params": [ -5.019, -2.883, 2.558, 9.563, 11.594, 19.991 ], "bp2_params": [ -0.224, 0.003, 0.833, 15.872, 4.747, 2.590 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.954, "simple_Twist": 22.301, "simple_hRise": 2.621, "simple_hTwist": 22.883 }, { "index": 3, "nt1": "///S/45", "nt2": "///S/29", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.224, 0.003, 0.833, 15.872, 4.747, 2.590 ], "step_params": [ 1.397, -2.861, 3.246, -1.862, -1.138, -48.114 ], "heli_params": [ 3.594, 1.568, 3.230, 1.396, -2.283, -48.161 ], "bp2_params": [ 0.023, 1.211, 0.411, -5.222, 12.484, 168.064 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.246, "simple_Twist": 60.363, "simple_hRise": 3.254, "simple_hTwist": 60.399 }, { "index": 4, "nt1": "///S/46", "nt2": "///S/51", "bp": "A+U", "name": "rWC", "Saenger": "21-XXI", "LW": "tWW", "DSSR": "tW+W" } ] }, { "index": 18, "num_stems": 3, "strand1": "GACUCCCGGUUGUGAUGA", "strand2": "UUGGGGGCCAACACUACU", "bp_type": "||||||||||||||||||", "helix_form": ".AAAAx...AAx.....", "helical_rise": 2.656, "helical_rise_std": 0.519, "helical_radius": 9.000, "helical_radius_std": 1.362, "helical_axis": [ 0.184, -0.983, 0.007 ], "point1": [ 9.688, 14.180, 93.317 ], "point2": [ 18.011, -30.155, 93.616 ], "num_pairs": 18, "pairs": [ { "index": 1, "nt1": "///S/60", "nt2": "///S/40", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.438, -0.412, 0.850, 10.172, -8.204, -7.086 ], "step_params": [ 0.349, -0.846, 3.234, 2.331, 5.650, 44.938 ], "heli_params": [ -1.588, -0.251, 3.124, 7.351, -3.033, 45.330 ], "bp2_params": [ 0.009, 0.136, 0.251, 11.147, -22.492, 6.122 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.234, "simple_Twist": 32.197, "simple_hRise": 3.062, "simple_hTwist": 32.757 }, { "index": 2, "nt1": "///S/61", "nt2": "///S/39", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.009, 0.136, 0.251, 11.147, -22.492, 6.122 ], "step_params": [ -0.103, -0.992, 3.057, 2.150, 9.236, 31.721 ], "heli_params": [ -3.136, 0.506, 2.659, 16.443, -3.828, 33.073 ], "bp2_params": [ -0.306, 0.082, -0.110, 12.123, -22.933, 4.160 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.057, "simple_Twist": 33.580, "simple_hRise": 2.687, "simple_hTwist": 34.857 }, { "index": 3, "nt1": "///S/62", "nt2": "///S/38", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.306, 0.082, -0.110, 12.123, -22.933, 4.160 ], "step_params": [ -0.265, -1.138, 3.654, -1.306, 12.216, 39.540 ], "heli_params": [ -3.017, 0.225, 3.188, 17.550, 1.876, 41.332 ], "bp2_params": [ 1.679, -0.225, 0.282, -1.548, -15.104, -3.516 ], "groove_widths": [ 17.076, null, 14.196, null ], "simple_Rise": 3.654, "simple_Twist": 28.601, "simple_hRise": 2.942, "simple_hTwist": 31.077 }, { "index": 4, "nt1": "///S/63", "nt2": "///S/37", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.679, -0.225, 0.282, -1.548, -15.104, -3.516 ], "step_params": [ -0.053, -1.590, 2.891, 4.013, 6.850, 32.017 ], "heli_params": [ -3.774, 0.663, 2.483, 12.187, -7.140, 32.962 ], "bp2_params": [ 1.028, -0.344, 0.060, 2.052, -15.460, -0.622 ], "groove_widths": [ 17.062, 15.607, 13.991, 10.209 ], "simple_Rise": 2.891, "simple_Twist": 35.145, "simple_hRise": 2.526, "simple_hTwist": 36.003 }, { "index": 5, "nt1": "///S/64", "nt2": "///S/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.028, -0.344, 0.060, 2.052, -15.460, -0.622 ], "step_params": [ -0.035, -2.036, 3.374, 1.025, 9.434, 25.773 ], "heli_params": [ -6.445, 0.307, 2.484, 20.294, -2.206, 27.437 ], "bp2_params": [ -0.665, 0.107, 0.153, -8.454, -11.125, -14.111 ], "groove_widths": [ 16.935, 15.472, 14.738, 12.521 ], "simple_Rise": 3.374, "simple_Twist": 34.400, "simple_hRise": 2.736, "simple_hTwist": 35.647 }, { "index": 6, "nt1": "///S/65", "nt2": "///S/35", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.665, 0.107, 0.153, -8.454, -11.125, -14.111 ], "step_params": [ 1.324, -1.326, 3.332, -1.495, 11.746, 41.594 ], "heli_params": [ -2.910, -1.940, 2.827, 16.151, 2.056, 43.175 ], "bp2_params": [ 0.355, 0.061, 0.314, -10.305, -19.643, 7.756 ], "groove_widths": [ 17.306, 15.820, 14.874, 10.598 ], "simple_Rise": 3.332, "simple_Twist": 36.384, "simple_hRise": 2.735, "simple_hTwist": 38.200 }, { "index": 7, "nt1": "///S/66", "nt2": "///S/84", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.355, 0.061, 0.314, -10.305, -19.643, 7.756 ], "step_params": [ 0.259, -1.416, 2.844, -7.993, 5.390, 29.599 ], "heli_params": [ -3.491, -1.743, 2.405, 10.215, 15.147, 31.096 ], "bp2_params": [ -0.901, -0.111, 0.821, 4.479, -2.029, 2.350 ], "groove_widths": [ 17.982, 16.178, 15.717, 12.997 ], "simple_Rise": 2.844, "simple_Twist": 36.721, "simple_hRise": 2.510, "simple_hTwist": 37.924 }, { "index": 8, "nt1": "///S/67", "nt2": "///S/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.901, -0.111, 0.821, 4.479, -2.029, 2.350 ], "step_params": [ 0.894, -2.017, 3.394, 9.207, 2.745, 35.598 ], "heli_params": [ -3.583, -0.102, 3.355, 4.393, -14.731, 36.831 ], "bp2_params": [ 0.310, 0.454, 0.296, -4.230, -17.988, 7.973 ], "groove_widths": [ 16.762, 14.692, 17.993, 16.203 ], "simple_Rise": 3.394, "simple_Twist": 28.834, "simple_hRise": 3.314, "simple_hTwist": 30.360 }, { "index": 9, "nt1": "///S/68", "nt2": "///S/82", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.310, 0.454, 0.296, -4.230, -17.988, 7.973 ], "step_params": [ -1.649, -2.802, 3.337, -1.984, 3.712, 23.465 ], "heli_params": [ -7.970, 3.360, 2.992, 9.035, 4.829, 23.835 ], "bp2_params": [ -0.987, 0.567, 0.091, -13.351, -5.051, -7.912 ], "groove_widths": [ 15.868, 14.615, 18.533, 15.931 ], "simple_Rise": 3.337, "simple_Twist": 30.202, "simple_hRise": 3.079, "simple_hTwist": 30.488 }, { "index": 10, "nt1": "///S/69", "nt2": "///S/81", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.987, 0.567, 0.091, -13.351, -5.051, -7.912 ], "step_params": [ 0.251, -1.476, 2.794, -3.577, 3.148, 34.987 ], "heli_params": [ -2.822, -0.853, 2.618, 5.206, 5.916, 35.300 ], "bp2_params": [ 0.055, 0.276, 0.159, 3.460, -2.642, 0.325 ], "groove_widths": [ 16.877, 15.474, 16.813, 14.638 ], "simple_Rise": 2.794, "simple_Twist": 29.963, "simple_hRise": 2.583, "simple_hTwist": 30.331 }, { "index": 11, "nt1": "///S/70", "nt2": "///S/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.055, 0.276, 0.159, 3.460, -2.642, 0.325 ], "step_params": [ 0.988, -1.617, 2.866, 4.176, 18.503, 35.659 ], "heli_params": [ -3.991, -1.066, 1.930, 27.916, -6.301, 40.245 ], "bp2_params": [ 0.194, 0.493, 0.027, -1.556, -13.961, 8.060 ], "groove_widths": [ 16.672, 14.713, 15.410, 12.656 ], "simple_Rise": 2.866, "simple_Twist": 34.685, "simple_hRise": 1.900, "simple_hTwist": 39.392 }, { "index": 12, "nt1": "///S/71", "nt2": "///S/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.194, 0.493, 0.027, -1.556, -13.961, 8.060 ], "step_params": [ -1.956, -1.616, 3.377, -2.479, 2.950, 38.305 ], "heli_params": [ -2.829, 2.649, 3.363, 4.483, 3.766, 38.492 ], "bp2_params": [ -0.361, 0.439, -0.200, -15.538, -14.451, -13.532 ], "groove_widths": [ 16.155, 14.762, 15.667, 12.210 ], "simple_Rise": 3.377, "simple_Twist": 40.869, "simple_hRise": 3.365, "simple_hTwist": 41.043 }, { "index": 13, "nt1": "///S/136", "nt2": "///S/78", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.361, 0.439, -0.200, -15.538, -14.451, -13.532 ], "step_params": [ 0.334, -1.468, 2.989, -8.112, 9.337, 22.414 ], "heli_params": [ -5.479, -2.632, 1.992, 21.999, 19.112, 25.562 ], "bp2_params": [ -0.837, -0.023, 0.943, -9.399, -17.070, -0.320 ], "groove_widths": [ 17.120, 15.817, 15.546, 10.098 ], "simple_Rise": 2.989, "simple_Twist": 24.961, "simple_hRise": 2.106, "simple_hTwist": 27.814 }, { "index": 14, "nt1": "///S/137", "nt2": "///S/77", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.837, -0.023, 0.943, -9.399, -17.070, -0.320 ], "step_params": [ 0.517, -1.361, 2.779, 0.846, 2.951, 31.808 ], "heli_params": [ -2.918, -0.812, 2.658, 5.368, -1.538, 31.952 ], "bp2_params": [ -1.125, 0.282, 1.021, 6.381, -19.291, 13.467 ], "groove_widths": [ 18.089, 16.313, 19.396, 11.418 ], "simple_Rise": 2.779, "simple_Twist": 34.106, "simple_hRise": 2.667, "simple_hTwist": 34.240 }, { "index": 15, "nt1": "///S/138", "nt2": "///S/76", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.125, 0.282, 1.021, 6.381, -19.291, 13.467 ], "step_params": [ -0.693, -1.557, 3.563, -2.606, 15.246, 47.955 ], "heli_params": [ -2.961, 0.623, 3.000, 18.214, 3.113, 50.247 ], "bp2_params": [ 1.502, -0.143, 1.151, -1.630, -7.312, -15.872 ], "groove_widths": [ 18.379, null, 16.401, null ], "simple_Rise": 3.563, "simple_Twist": 34.383, "simple_hRise": 2.702, "simple_hTwist": 37.605 }, { "index": 16, "nt1": "///S/139", "nt2": "///S/75", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.502, -0.143, 1.151, -1.630, -7.312, -15.872 ], "step_params": [ 1.260, -1.422, 3.118, 10.039, 13.949, 31.276 ], "heli_params": [ -4.211, -0.705, 2.553, 23.761, -17.101, 35.583 ], "bp2_params": [ 0.990, 0.593, 0.907, -3.636, -23.723, 20.728 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.118, "simple_Twist": 32.732, "simple_hRise": 2.589, "simple_hTwist": 36.860 }, { "index": 17, "nt1": "///S/140", "nt2": "///S/74", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.990, 0.593, 0.907, -3.636, -23.723, 20.728 ], "step_params": [ -1.185, -1.275, 2.279, 2.375, 5.752, 24.181 ], "heli_params": [ -4.040, 3.193, 1.808, 13.447, -5.553, 24.957 ], "bp2_params": [ -0.409, 0.725, 0.875, 29.932, -14.999, 7.124 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.279, "simple_Twist": 32.797, "simple_hRise": 1.945, "simple_hTwist": 33.367 }, { "index": 18, "nt1": "///S/141", "nt2": "///S/73", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 19, "num_stems": 1, "strand1": "GCUUUUACU", "strand2": "UGAAAGUGG", "bp_type": "|||||||||", "helix_form": "......A.", "helical_rise": 2.619, "helical_rise_std": 0.303, "helical_radius": 9.321, "helical_radius_std": 0.539, "helical_axis": [ 0.224, 0.974, -0.021 ], "point1": [ 33.114, -11.909, 95.612 ], "point2": [ 37.762, 8.343, 95.181 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///S/88", "nt2": "///S/134", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.285, -0.473, 1.589, 16.749, -0.883, -8.465 ], "step_params": [ 0.403, -1.760, 3.395, 12.428, 3.923, 43.802 ], "heli_params": [ -2.627, 0.607, 3.228, 5.126, -16.236, 45.608 ], "bp2_params": [ 1.168, 0.052, -0.033, 11.198, -13.166, -6.496 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.395, "simple_Twist": 31.448, "simple_hRise": 3.094, "simple_hTwist": 33.979 }, { "index": 2, "nt1": "///S/89", "nt2": "///S/133", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.168, 0.052, -0.033, 11.198, -13.166, -6.496 ], "step_params": [ -0.987, -2.277, 3.168, 4.884, 9.967, 30.938 ], "heli_params": [ -5.470, 2.452, 2.173, 17.973, -8.807, 32.823 ], "bp2_params": [ 1.510, -0.030, -0.763, 12.659, -8.801, -5.767 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.168, "simple_Twist": 29.024, "simple_hRise": 2.100, "simple_hTwist": 31.031 }, { "index": 3, "nt1": "///S/90", "nt2": "///S/132", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.510, -0.030, -0.763, 12.659, -8.801, -5.767 ], "step_params": [ 1.890, -1.923, 3.213, -3.570, 4.904, 20.919 ], "heli_params": [ -6.765, -6.222, 2.354, 13.154, 9.577, 21.771 ], "bp2_params": [ -1.165, 0.787, 0.021, 14.456, -5.975, 13.838 ], "groove_widths": [ 16.918, null, 17.108, null ], "simple_Rise": 3.213, "simple_Twist": 34.883, "simple_hRise": 2.726, "simple_hTwist": 35.391 }, { "index": 4, "nt1": "///S/91", "nt2": "///S/131", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.165, 0.787, 0.021, 14.456, -5.975, 13.838 ], "step_params": [ -0.619, -2.137, 3.460, 11.939, 8.817, 35.773 ], "heli_params": [ -4.271, 2.345, 2.555, 13.651, -18.486, 38.636 ], "bp2_params": [ 0.574, 0.247, -1.602, 5.750, -21.549, -22.418 ], "groove_widths": [ 16.363, 14.837, 16.853, 13.466 ], "simple_Rise": 3.460, "simple_Twist": 26.884, "simple_hRise": 2.203, "simple_hTwist": 30.642 }, { "index": 5, "nt1": "///S/92", "nt2": "///S/130", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.574, 0.247, -1.602, 5.750, -21.549, -22.418 ], "step_params": [ 2.100, -2.012, 3.869, -9.140, 9.145, 36.956 ], "heli_params": [ -4.154, -4.284, 2.738, 13.915, 13.906, 39.078 ], "bp2_params": [ 1.917, 0.341, 1.094, -21.826, -9.953, 15.216 ], "groove_widths": [ 16.620, 14.845, 16.653, 12.754 ], "simple_Rise": 3.869, "simple_Twist": 28.464, "simple_hRise": 2.356, "simple_hTwist": 31.208 }, { "index": 6, "nt1": "///S/93", "nt2": "///S/129", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.917, 0.341, 1.094, -21.826, -9.953, 15.216 ], "step_params": [ -0.889, -1.395, 2.124, 11.465, 16.550, 24.909 ], "heli_params": [ -3.973, 2.612, 0.640, 32.438, -22.470, 31.928 ], "bp2_params": [ -0.905, 0.069, -0.172, -0.486, -15.188, -2.029 ], "groove_widths": [ 17.448, null, 17.317, null ], "simple_Rise": 2.124, "simple_Twist": 40.455, "simple_hRise": 1.211, "simple_hTwist": 44.999 }, { "index": 7, "nt1": "///S/94", "nt2": "///S/128", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.905, 0.069, -0.172, -0.486, -15.188, -2.029 ], "step_params": [ 0.565, -1.134, 3.132, 4.164, -0.479, 36.807 ], "heli_params": [ -1.723, -0.348, 3.189, -0.756, -6.569, 37.036 ], "bp2_params": [ 0.152, 0.039, -0.628, 13.253, -18.039, 5.391 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.132, "simple_Twist": 31.836, "simple_hRise": 3.194, "simple_hTwist": 32.104 }, { "index": 8, "nt1": "///S/95", "nt2": "///S/127", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.152, 0.039, -0.628, 13.253, -18.039, 5.391 ], "step_params": [ -0.075, -1.251, 3.854, -2.579, 9.183, 36.855 ], "heli_params": [ -3.246, -0.258, 3.452, 14.234, 3.998, 38.028 ], "bp2_params": [ 2.089, -0.331, -0.050, -2.503, -9.815, -1.210 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.854, "simple_Twist": 26.324, "simple_hRise": 3.234, "simple_hTwist": 27.970 }, { "index": 9, "nt1": "///S/96", "nt2": "///S/126", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 20, "num_stems": 1, "strand1": "AAUCAUUAAGG", "strand2": "CAGGUGAUUCA", "bp_type": "...|||||||.", "helix_form": "...A...AA.", "helical_rise": 2.779, "helical_rise_std": 0.653, "helical_radius": 8.824, "helical_radius_std": 2.764, "helical_axis": [ -0.100, 0.986, -0.137 ], "point1": [ 40.730, 23.617, 87.387 ], "point2": [ 37.954, 51.025, 83.579 ], "num_pairs": 11, "pairs": [ { "index": 1, "nt1": "///S/99", "nt2": "///S/122", "bp": "A-C", "name": "~rHoogsteen", "Saenger": "25-XXV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -3.024, -0.575, 0.096, -2.651, -11.326, -88.901 ], "step_params": [ -0.024, -1.164, 3.194, 3.366, 1.320, 27.265 ], "heli_params": [ -2.763, 0.850, 3.110, 2.785, -7.102, 27.499 ], "bp2_params": [ -4.474, 0.921, -0.539, 16.776, -17.754, -102.729 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.194, "simple_Twist": 33.281, "simple_hRise": 3.130, "simple_hTwist": 33.471 }, { "index": 2, "nt1": "///S/100", "nt2": "///S/121", "bp": "A-A", "name": "--", "Saenger": "05-V", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.474, 0.921, -0.539, 16.776, -17.754, -102.729 ], "step_params": [ 1.970, -2.397, 3.115, -2.653, 0.797, 30.806 ], "heli_params": [ -4.636, -4.166, 2.878, 1.497, 4.981, 30.927 ], "bp2_params": [ -5.400, 0.241, -0.087, 18.124, -5.580, -62.258 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.115, "simple_Twist": 33.349, "simple_hRise": 2.898, "simple_hTwist": 33.461 }, { "index": 3, "nt1": "///S/101", "nt2": "///S/120", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -5.400, 0.241, -0.087, 18.124, -5.580, -62.258 ], "step_params": [ 2.926, -1.954, 3.506, -4.865, 13.467, 55.935 ], "heli_params": [ -2.737, -3.293, 2.766, 14.103, 5.095, 57.595 ], "bp2_params": [ 0.270, -0.086, -0.077, 11.849, -13.545, -2.520 ], "groove_widths": [ 18.120, null, 10.443, null ], "simple_Rise": 3.506, "simple_Twist": 30.216, "simple_hRise": 1.996, "simple_hTwist": 33.366 }, { "index": 4, "nt1": "///S/102", "nt2": "///S/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.270, -0.086, -0.077, 11.849, -13.545, -2.520 ], "step_params": [ 0.420, -1.666, 3.354, -0.843, 18.506, 32.452 ], "heli_params": [ -4.818, -0.759, 2.121, 30.238, 1.378, 37.244 ], "bp2_params": [ -0.196, -0.103, -0.025, 0.355, -23.691, 2.172 ], "groove_widths": [ 16.997, 15.587, 12.266, 9.649 ], "simple_Rise": 3.354, "simple_Twist": 34.661, "simple_hRise": 2.210, "simple_hTwist": 39.167 }, { "index": 5, "nt1": "///S/103", "nt2": "///S/118", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.196, -0.103, -0.025, 0.355, -23.691, 2.172 ], "step_params": [ 0.476, -1.247, 3.520, 1.972, 4.213, 46.493 ], "heli_params": [ -1.946, -0.425, 3.417, 5.321, -2.491, 46.712 ], "bp2_params": [ 2.987, -0.449, 0.081, -7.396, -23.923, 12.552 ], "groove_widths": [ 15.804, 14.003, 16.454, 11.276 ], "simple_Rise": 3.520, "simple_Twist": 28.203, "simple_hRise": 3.327, "simple_hTwist": 28.576 }, { "index": 6, "nt1": "///S/104", "nt2": "///S/117", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.987, -0.449, 0.081, -7.396, -23.923, 12.552 ], "step_params": [ -1.091, -2.139, 2.865, 4.670, 10.900, 14.740 ], "heli_params": [ -10.053, 4.840, 0.744, 35.843, -15.357, 18.897 ], "bp2_params": [ 0.047, -0.128, -0.491, 2.480, 2.770, -3.581 ], "groove_widths": [ 16.015, 14.254, 18.433, 14.193 ], "simple_Rise": 2.865, "simple_Twist": 31.682, "simple_hRise": 1.873, "simple_hTwist": 33.775 }, { "index": 7, "nt1": "///S/105", "nt2": "///S/116", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.047, -0.128, -0.491, 2.480, 2.770, -3.581 ], "step_params": [ -0.536, -1.266, 3.445, -3.842, 3.939, 32.203 ], "heli_params": [ -2.962, 0.260, 3.311, 7.037, 6.864, 32.658 ], "bp2_params": [ 0.167, 0.081, -0.273, -1.445, -9.348, -0.591 ], "groove_widths": [ 17.008, 15.638, 18.065, 16.846 ], "simple_Rise": 3.445, "simple_Twist": 31.093, "simple_hRise": 3.304, "simple_hTwist": 31.564 }, { "index": 8, "nt1": "///S/106", "nt2": "///S/115", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.167, 0.081, -0.273, -1.445, -9.348, -0.591 ], "step_params": [ 0.337, -1.458, 3.001, -1.138, 3.531, 28.928 ], "heli_params": [ -3.581, -0.891, 2.792, 7.032, 2.267, 29.160 ], "bp2_params": [ -0.572, 0.001, 0.229, 10.171, -13.734, 8.159 ], "groove_widths": [ 17.218, null, 18.924, null ], "simple_Rise": 3.001, "simple_Twist": 33.734, "simple_hRise": 2.826, "simple_hTwist": 33.931 }, { "index": 9, "nt1": "///S/107", "nt2": "///S/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.572, 0.001, 0.229, 10.171, -13.734, 8.159 ], "step_params": [ 0.104, -1.949, 3.461, -0.293, 6.768, 30.107 ], "heli_params": [ -4.974, -0.252, 2.962, 12.826, 0.555, 30.842 ], "bp2_params": [ -0.682, -0.126, -0.085, 2.196, -3.860, -1.924 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.461, "simple_Twist": 30.166, "simple_hRise": 2.963, "simple_hTwist": 30.900 }, { "index": 10, "nt1": "///S/108", "nt2": "///S/113", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.682, -0.126, -0.085, 2.196, -3.860, -1.924 ], "step_params": [ -4.262, -1.552, 3.288, 0.225, 18.623, 58.595 ], "heli_params": [ -2.357, 4.195, 2.715, 18.524, -0.224, 61.233 ], "bp2_params": [ 7.867, -5.610, 1.160, 1.717, -20.091, -42.244 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.288, "simple_Twist": 3.451, "simple_hRise": -0.975, "simple_hTwist": 18.939 }, { "index": 11, "nt1": "///S/109", "nt2": "///S/112", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] } ], "num_stems": 37, "stems": [ { "index": 1, "helix_index": 1, "strand1": "CGCC", "strand2": "GCGG", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.176, "helical_rise_std": 0.287, "helical_radius": 9.370, "helical_radius_std": 0.944, "helical_axis": [ 0.541, -0.774, 0.330 ], "point1": [ 18.151, 32.421, 8.060 ], "point2": [ 21.628, 27.449, 10.180 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///E/2", "nt2": "///P/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.652, -0.044, 0.265, 3.640, -7.157, 5.436 ], "step_params": [ -0.996, -1.808, 2.992, -1.498, 7.272, 27.224 ], "heli_params": [ -5.158, 1.745, 2.484, 15.096, 3.109, 28.200 ], "bp2_params": [ -0.405, -0.220, -0.129, 6.427, -9.859, 4.387 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.992, "simple_Twist": 32.667, "simple_hRise": 2.582, "simple_hTwist": 33.478 }, { "index": 2, "nt1": "///E/3", "nt2": "///P/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.405, -0.220, -0.129, 6.427, -9.859, 4.387 ], "step_params": [ -0.157, -1.615, 3.252, -0.811, 1.149, 31.450 ], "heli_params": [ -3.187, 0.139, 3.196, 2.118, 1.495, 31.481 ], "bp2_params": [ 0.199, -0.124, -0.233, 8.911, -15.875, 1.868 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.252, "simple_Twist": 28.715, "simple_hRise": 3.190, "simple_hTwist": 28.749 }, { "index": 3, "nt1": "///E/4", "nt2": "///P/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.199, -0.124, -0.233, 8.911, -15.875, 1.868 ], "step_params": [ -0.162, -1.843, 3.217, 2.405, 17.066, 26.513 ], "heli_params": [ -6.010, 0.666, 1.723, 33.132, -4.668, 31.538 ], "bp2_params": [ -0.035, -0.136, -0.513, 10.525, -1.882, -2.006 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.217, "simple_Twist": 27.372, "simple_hRise": 1.771, "simple_hTwist": 32.258 }, { "index": 4, "nt1": "///E/5", "nt2": "///P/53", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "AACU", "strand2": "UUGA", "bp_type": "||||", "helix_form": "..A", "helical_rise": 2.452, "helical_rise_std": 0.305, "helical_radius": 8.857, "helical_radius_std": 0.810, "helical_axis": [ 0.128, -0.963, -0.235 ], "point1": [ 17.120, 16.208, 11.255 ], "point2": [ 18.050, 9.221, 9.549 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///E/8", "nt2": "///P/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.110, 0.009, 0.423, 16.140, -17.400, -3.437 ], "step_params": [ 0.609, -1.067, 3.070, -2.260, 8.212, 29.938 ], "heli_params": [ -3.389, -1.520, 2.639, 15.505, 4.266, 31.100 ], "bp2_params": [ -0.601, 0.067, 0.618, 19.863, -18.684, 6.622 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.070, "simple_Twist": 34.173, "simple_hRise": 2.704, "simple_hTwist": 35.188 }, { "index": 2, "nt1": "///E/9", "nt2": "///P/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.601, 0.067, 0.618, 19.863, -18.684, 6.622 ], "step_params": [ -0.023, -1.366, 3.532, 4.753, 6.374, 37.823 ], "heli_params": [ -2.887, 0.648, 3.242, 9.703, -7.235, 38.620 ], "bp2_params": [ 0.044, 0.006, 0.002, 4.532, -28.084, 5.691 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.532, "simple_Twist": 33.795, "simple_hRise": 3.197, "simple_hTwist": 34.691 }, { "index": 3, "nt1": "///E/10", "nt2": "///P/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.044, 0.006, 0.002, 4.532, -28.084, 5.691 ], "step_params": [ -0.258, -1.688, 3.349, -2.764, 13.447, 28.520 ], "heli_params": [ -5.390, 0.003, 2.349, 25.511, 5.243, 31.590 ], "bp2_params": [ -0.495, 0.282, 0.194, -3.886, -13.099, 1.951 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.349, "simple_Twist": 31.139, "simple_hRise": 2.446, "simple_hTwist": 33.962 }, { "index": 4, "nt1": "///E/11", "nt2": "///P/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "gGCACC", "strand2": "CCGUGG", "bp_type": "||||||", "helix_form": "A.AAA", "helical_rise": 2.664, "helical_rise_std": 0.151, "helical_radius": 9.131, "helical_radius_std": 0.182, "helical_axis": [ 0.058, -0.998, -0.011 ], "point1": [ 17.609, 5.360, 10.114 ], "point2": [ 18.380, -7.897, 9.973 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///P/12", "nt2": "///P/22", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.239, 0.161, -0.094, -7.786, -16.719, -1.578 ], "step_params": [ 0.099, -1.764, 3.358, -1.343, 6.272, 30.487 ], "heli_params": [ -4.452, -0.434, 2.938, 11.765, 2.519, 31.139 ], "bp2_params": [ -0.676, 0.206, -0.193, -13.427, -18.119, 8.089 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.358, "simple_Twist": 32.707, "simple_hRise": 2.971, "simple_hTwist": 33.313 }, { "index": 2, "nt1": "///P/13", "nt2": "///P/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.676, 0.206, -0.193, -13.427, -18.119, 8.089 ], "step_params": [ -0.183, -1.123, 2.882, -0.636, 2.116, 38.252 ], "heli_params": [ -1.943, 0.209, 2.821, 3.226, 0.970, 38.313 ], "bp2_params": [ 0.444, 0.228, 0.209, 0.497, -17.788, 10.537 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.882, "simple_Twist": 32.841, "simple_hRise": 2.809, "simple_hTwist": 32.913 }, { "index": 3, "nt1": "///P/14", "nt2": "///P/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.444, 0.228, 0.209, 0.497, -17.788, 10.537 ], "step_params": [ -0.908, -1.235, 2.805, -0.896, 13.357, 27.245 ], "heli_params": [ -4.463, 1.597, 2.020, 26.427, 1.773, 30.301 ], "bp2_params": [ -0.670, -0.022, 0.277, 5.416, -16.407, -3.245 ], "groove_widths": [ 17.442, null, 15.411, null ], "simple_Rise": 2.805, "simple_Twist": 33.023, "simple_hRise": 2.182, "simple_hTwist": 35.563 }, { "index": 4, "nt1": "///P/15", "nt2": "///P/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.670, -0.022, 0.277, 5.416, -16.407, -3.245 ], "step_params": [ -0.068, -1.669, 3.085, 0.266, 4.515, 33.527 ], "heli_params": [ -3.532, 0.156, 2.842, 7.782, -0.459, 33.822 ], "bp2_params": [ 0.186, -0.130, -0.028, 12.677, -11.029, -8.695 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.085, "simple_Twist": 29.212, "simple_hRise": 2.800, "simple_hTwist": 29.552 }, { "index": 5, "nt1": "///P/16", "nt2": "///P/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, -0.130, -0.028, 12.677, -11.029, -8.695 ], "step_params": [ 0.323, -1.706, 3.383, 4.749, 9.017, 33.670 ], "heli_params": [ -4.142, 0.159, 2.864, 15.141, -7.975, 35.136 ], "bp2_params": [ 0.858, -0.132, -0.724, 8.850, -9.939, -3.017 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.383, "simple_Twist": 30.163, "simple_hRise": 2.788, "simple_hTwist": 31.801 }, { "index": 6, "nt1": "///P/17", "nt2": "///P/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 2, "strand1": "CGA", "strand2": "GCU", "bp_type": "|||", "helix_form": "AA", "helical_rise": 3.998, "helical_rise_std": 0.216, "helical_radius": 9.017, "helical_radius_std": 0.260, "helical_axis": [ -0.488, 0.701, 0.520 ], "point1": [ 29.929, 36.319, 6.897 ], "point2": [ 25.907, 42.093, 11.178 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///P/29", "nt2": "///P/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.304, 0.027, 0.431, -9.804, 2.946, 2.144 ], "step_params": [ -0.480, -1.279, 2.985, 1.221, 2.442, 18.204 ], "heli_params": [ -5.184, 2.094, 2.753, 7.663, -3.833, 18.406 ], "bp2_params": [ -0.327, -0.301, 0.344, 6.209, -5.375, -2.026 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.985, "simple_Twist": 21.428, "simple_hRise": 2.792, "simple_hTwist": 21.599 }, { "index": 2, "nt1": "///P/30", "nt2": "///P/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.327, -0.301, 0.344, 6.209, -5.375, -2.026 ], "step_params": [ -0.606, -2.133, 3.316, 0.997, 4.151, 38.263 ], "heli_params": [ -3.738, 1.040, 3.060, 6.309, -1.516, 38.491 ], "bp2_params": [ -0.108, -0.166, -0.295, 0.134, -12.026, -4.335 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.316, "simple_Twist": 37.177, "simple_hRise": 3.052, "simple_hTwist": 37.413 }, { "index": 3, "nt1": "///P/31", "nt2": "///P/43", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 5, "helix_index": 3, "strand1": "GGGGUU", "strand2": "CCUCAG", "bp_type": "||||||", "helix_form": "A.A..", "helical_rise": 2.496, "helical_rise_std": 0.221, "helical_radius": 8.535, "helical_radius_std": 0.634, "helical_axis": [ -0.152, -0.988, 0.028 ], "point1": [ 12.191, 58.942, 9.205 ], "point2": [ 10.323, 46.769, 9.556 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///P/35", "nt2": "///P/65", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.550, -0.075, -0.075, -3.066, -11.725, -8.823 ], "step_params": [ 0.044, -1.738, 3.071, -3.892, 4.635, 33.790 ], "heli_params": [ -3.603, -0.626, 2.793, 7.896, 6.630, 34.312 ], "bp2_params": [ -0.639, -0.196, 0.397, -4.971, -13.791, 2.180 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.071, "simple_Twist": 34.215, "simple_hRise": 2.797, "simple_hTwist": 34.730 }, { "index": 2, "nt1": "///P/36", "nt2": "///P/64", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.639, -0.196, 0.397, -4.971, -13.791, 2.180 ], "step_params": [ -0.449, -1.732, 2.720, -0.900, 7.376, 30.151 ], "heli_params": [ -4.332, 0.706, 2.256, 13.915, 1.698, 31.033 ], "bp2_params": [ -1.884, -0.238, 0.216, 1.643, -17.033, -4.183 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.720, "simple_Twist": 36.617, "simple_hRise": 2.350, "simple_hTwist": 37.338 }, { "index": 3, "nt1": "///P/37", "nt2": "///P/63", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.884, -0.238, 0.216, 1.643, -17.033, -4.183 ], "step_params": [ 0.326, -1.254, 3.448, -2.262, 9.577, 39.685 ], "heli_params": [ -2.861, -0.719, 3.055, 13.850, 3.271, 40.839 ], "bp2_params": [ 0.277, -0.140, 0.432, -8.261, -19.449, 1.777 ], "groove_widths": [ 17.067, null, 14.100, null ], "simple_Rise": 3.448, "simple_Twist": 27.994, "simple_hRise": 2.839, "simple_hTwist": 29.641 }, { "index": 4, "nt1": "///P/38", "nt2": "///P/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.277, -0.140, 0.432, -8.261, -19.449, 1.777 ], "step_params": [ 0.169, -1.081, 3.294, 1.942, 10.753, 33.080 ], "heli_params": [ -3.382, 0.001, 2.821, 18.275, -3.301, 34.790 ], "bp2_params": [ 0.217, -0.002, 0.201, -12.858, -21.830, 7.008 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.294, "simple_Twist": 33.232, "simple_hRise": 2.824, "simple_hTwist": 34.934 }, { "index": 5, "nt1": "///P/39", "nt2": "///P/61", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.217, -0.002, 0.201, -12.858, -21.830, 7.008 ], "step_params": [ 0.100, -0.566, 2.832, 1.279, 4.764, 42.802 ], "heli_params": [ -1.173, -0.028, 2.759, 6.502, -1.745, 43.072 ], "bp2_params": [ 2.395, -0.045, 0.215, 2.205, -10.529, 4.053 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.832, "simple_Twist": 31.984, "simple_hRise": 2.724, "simple_hTwist": 32.352 }, { "index": 6, "nt1": "///P/40", "nt2": "///P/60", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 6, "helix_index": 3, "strand1": "CGGUUG", "strand2": "GCCAAC", "bp_type": "||||||", "helix_form": "...AA", "helical_rise": 3.092, "helical_rise_std": 0.471, "helical_radius": 9.594, "helical_radius_std": 0.664, "helical_axis": [ 0.199, 0.979, -0.032 ], "point1": [ 12.694, 61.819, 7.800 ], "point2": [ 15.823, 77.203, 7.298 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///P/66", "nt2": "///P/84", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.331, 0.178, 0.518, -8.953, -9.853, 1.612 ], "step_params": [ 0.669, -1.329, 2.820, -2.692, 6.871, 34.406 ], "heli_params": [ -3.036, -1.435, 2.460, 11.453, 4.487, 35.165 ], "bp2_params": [ -0.563, 0.109, 0.663, 4.819, -9.064, 6.477 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.820, "simple_Twist": 35.886, "simple_hRise": 2.477, "simple_hTwist": 36.613 }, { "index": 2, "nt1": "///P/67", "nt2": "///P/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.563, 0.109, 0.663, 4.819, -9.064, 6.477 ], "step_params": [ 0.532, -1.977, 3.403, 5.460, -0.710, 34.752 ], "heli_params": [ -3.159, -0.019, 3.483, -1.180, -9.071, 35.172 ], "bp2_params": [ 0.782, 0.339, 0.401, -0.438, -14.013, 6.438 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.403, "simple_Twist": 27.287, "simple_hRise": 3.490, "simple_hTwist": 27.827 }, { "index": 3, "nt1": "///P/68", "nt2": "///P/82", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.782, 0.339, 0.401, -0.438, -14.013, 6.438 ], "step_params": [ -1.766, -2.840, 3.286, 0.400, 7.220, 26.253 ], "heli_params": [ -7.641, 3.841, 2.407, 15.526, -0.859, 27.214 ], "bp2_params": [ -0.501, 0.371, -0.062, -7.970, -13.965, -17.369 ], "groove_widths": [ 15.817, null, 18.601, null ], "simple_Rise": 3.286, "simple_Twist": 33.001, "simple_hRise": 2.603, "simple_hTwist": 33.762 }, { "index": 4, "nt1": "///P/69", "nt2": "///P/81", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.501, 0.371, -0.062, -7.970, -13.965, -17.369 ], "step_params": [ 0.510, -1.437, 3.141, -5.738, 6.683, 34.293 ], "heli_params": [ -3.259, -1.608, 2.705, 11.108, 9.537, 35.373 ], "bp2_params": [ 0.512, 0.355, 0.320, -0.652, -9.048, 0.585 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.141, "simple_Twist": 29.396, "simple_hRise": 2.615, "simple_hTwist": 30.659 }, { "index": 5, "nt1": "///P/70", "nt2": "///P/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.512, 0.355, 0.320, -0.652, -9.048, 0.585 ], "step_params": [ 0.490, -1.650, 3.010, 3.583, 20.345, 32.738 ], "heli_params": [ -4.500, -0.389, 1.767, 32.393, -5.705, 38.560 ], "bp2_params": [ 0.389, 0.237, 0.108, -5.385, -21.104, 9.017 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.010, "simple_Twist": 32.726, "simple_hRise": 1.766, "simple_hTwist": 38.550 }, { "index": 6, "nt1": "///P/71", "nt2": "///P/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 7, "helix_index": 3, "strand1": "UCAUCA", "strand2": "AGUAGU", "bp_type": "||||||", "helix_form": ".....", "helical_rise": 2.238, "helical_rise_std": 0.187, "helical_radius": 9.446, "helical_radius_std": 1.141, "helical_axis": [ -0.274, -0.958, 0.090 ], "point1": [ 19.933, 89.885, 7.027 ], "point2": [ 16.903, 79.276, 8.019 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///P/73", "nt2": "///P/141", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.844, -0.029, 1.011, -27.229, 4.145, -0.995 ], "step_params": [ 1.079, -1.651, 2.150, 2.845, -5.936, 24.752 ], "heli_params": [ -2.488, -1.843, 2.575, -13.545, -6.492, 25.599 ], "bp2_params": [ -0.908, 0.345, 0.645, 17.016, -17.375, 11.910 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.150, "simple_Twist": 34.604, "simple_hRise": 2.469, "simple_hTwist": 35.206 }, { "index": 2, "nt1": "///P/74", "nt2": "///P/140", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.908, 0.345, 0.645, 17.016, -17.375, 11.910 ], "step_params": [ -1.111, -1.442, 3.318, -1.975, 22.285, 31.796 ], "heli_params": [ -4.633, 1.458, 1.989, 35.687, 3.162, 38.712 ], "bp2_params": [ -1.306, 0.159, -0.110, 6.116, -16.844, -10.487 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.318, "simple_Twist": 32.755, "simple_hRise": 2.032, "simple_hTwist": 39.493 }, { "index": 3, "nt1": "///P/75", "nt2": "///P/139", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.306, 0.159, -0.110, 6.116, -16.844, -10.487 ], "step_params": [ 0.357, -1.268, 3.762, -6.512, 17.991, 45.259 ], "heli_params": [ -3.006, -0.965, 3.008, 22.243, 8.050, 48.941 ], "bp2_params": [ 1.141, 0.319, 0.919, -11.550, -13.223, 13.878 ], "groove_widths": [ 18.060, null, 17.176, null ], "simple_Rise": 3.762, "simple_Twist": 32.247, "simple_hRise": 2.607, "simple_hTwist": 37.366 }, { "index": 4, "nt1": "///P/76", "nt2": "///P/138", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.141, 0.319, 0.919, -11.550, -13.223, 13.878 ], "step_params": [ -0.737, -1.571, 2.663, 5.027, 4.208, 32.429 ], "heli_params": [ -3.306, 1.947, 2.310, 7.440, -8.888, 33.067 ], "bp2_params": [ 0.881, 0.464, 0.187, 5.535, -19.974, -0.066 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.663, "simple_Twist": 34.676, "simple_hRise": 2.336, "simple_hTwist": 35.271 }, { "index": 5, "nt1": "///P/77", "nt2": "///P/137", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.881, 0.464, 0.187, 5.535, -19.974, -0.066 ], "step_params": [ -0.782, -1.253, 3.199, 3.315, 11.529, 26.981 ], "heli_params": [ -4.652, 2.166, 2.366, 23.302, -6.700, 29.483 ], "bp2_params": [ 1.043, 0.181, -0.429, 7.992, -11.965, -13.558 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.199, "simple_Twist": 25.951, "simple_hRise": 2.327, "simple_hTwist": 28.546 }, { "index": 6, "nt1": "///P/78", "nt2": "///P/136", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 8, "helix_index": 4, "strand1": "CU", "strand2": "GA", "bp_type": "||", "helix_form": ".", "helical_rise": 3.618, "helical_rise_std": 0.061, "helical_radius": 9.897, "helical_radius_std": 1.021, "helical_axis": [ 0.514, -0.858, 0.016 ], "point1": [ 34.130, 71.136, 6.452 ], "point2": [ 35.990, 68.030, 6.510 ], "num_pairs": 2, "pairs": [ { "index": 1, "nt1": "///P/89", "nt2": "///P/133", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.960, 0.090, 0.666, 14.778, -18.838, -2.336 ], "step_params": [ -0.853, -2.038, 3.768, 11.122, 1.989, 29.070 ], "heli_params": [ -4.209, 3.898, 3.097, 3.787, -21.175, 31.145 ], "bp2_params": [ 0.801, -0.144, -1.090, 9.779, -26.291, -6.378 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.768, "simple_Twist": 29.770, "simple_hRise": 3.117, "simple_hTwist": 31.796 }, { "index": 2, "nt1": "///P/90", "nt2": "///P/132", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 9, "helix_index": 4, "strand1": "UUACU", "strand2": "AGUGG", "bp_type": "|||||", "helix_form": "..A.", "helical_rise": 2.925, "helical_rise_std": 0.406, "helical_radius": 9.105, "helical_radius_std": 0.345, "helical_axis": [ 0.134, -0.988, 0.078 ], "point1": [ 36.740, 63.703, 7.484 ], "point2": [ 38.307, 52.144, 8.394 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///P/92", "nt2": "///P/130", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.591, 0.228, -1.868, 6.527, -24.151, -19.692 ], "step_params": [ 0.934, -2.264, 4.239, -18.806, 12.485, 35.481 ], "heli_params": [ -4.651, -3.539, 2.557, 18.375, 27.679, 41.857 ], "bp2_params": [ 2.162, -0.261, 1.709, -31.291, 2.618, 5.175 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.239, "simple_Twist": 30.845, "simple_hRise": 2.283, "simple_hTwist": 38.060 }, { "index": 2, "nt1": "///P/93", "nt2": "///P/129", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.162, -0.261, 1.709, -31.291, 2.618, 5.175 ], "step_params": [ -0.682, -1.616, 1.694, 13.861, 2.229, 23.355 ], "heli_params": [ -3.684, 2.988, 0.985, 4.972, -30.917, 27.199 ], "bp2_params": [ -0.470, -0.205, 0.425, 11.924, -20.015, -6.948 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 1.694, "simple_Twist": 38.138, "simple_hRise": 1.287, "simple_hTwist": 40.549 }, { "index": 3, "nt1": "///P/94", "nt2": "///P/128", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.470, -0.205, 0.425, 11.924, -20.015, -6.948 ], "step_params": [ 0.722, -1.320, 3.312, 3.937, 2.033, 39.709 ], "heli_params": [ -2.169, -0.597, 3.297, 2.981, -5.774, 39.946 ], "bp2_params": [ 0.537, -0.189, -0.151, 9.005, -21.756, 0.662 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.312, "simple_Twist": 34.351, "simple_hRise": 3.290, "simple_hTwist": 34.627 }, { "index": 4, "nt1": "///P/95", "nt2": "///P/127", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.537, -0.189, -0.151, 9.005, -21.756, 0.662 ], "step_params": [ 0.006, -1.074, 3.770, 1.221, 11.042, 40.479 ], "heli_params": [ -2.783, 0.133, 3.376, 15.606, -1.726, 41.914 ], "bp2_params": [ 3.306, -0.640, 0.149, -7.705, -11.544, 7.237 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.770, "simple_Twist": 24.109, "simple_hRise": 2.994, "simple_hTwist": 26.511 }, { "index": 5, "nt1": "///P/96", "nt2": "///P/126", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 10, "helix_index": 5, "strand1": "CAUUAAG", "strand2": "GUGAUUC", "bp_type": "|||||||", "helix_form": "A...AA", "helical_rise": 2.855, "helical_rise_std": 0.452, "helical_radius": 9.657, "helical_radius_std": 0.821, "helical_axis": [ -0.190, -0.973, 0.129 ], "point1": [ 40.911, 29.781, 16.960 ], "point2": [ 37.658, 13.090, 19.180 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///P/102", "nt2": "///P/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.146, 0.005, -0.028, 15.461, -19.291, -3.239 ], "step_params": [ 0.550, -1.765, 3.223, -2.216, 12.563, 32.274 ], "heli_params": [ -4.674, -1.225, 2.352, 21.577, 3.806, 34.641 ], "bp2_params": [ -0.140, -0.057, 0.506, 6.430, -21.801, 2.717 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.223, "simple_Twist": 33.602, "simple_hRise": 2.392, "simple_hTwist": 35.876 }, { "index": 2, "nt1": "///P/103", "nt2": "///P/118", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.140, -0.057, 0.506, 6.430, -21.801, 2.717 ], "step_params": [ 0.447, -1.596, 3.398, 8.237, 8.343, 41.362 ], "heli_params": [ -3.017, 0.214, 3.065, 11.535, -11.388, 42.922 ], "bp2_params": [ 2.276, -0.130, -0.074, -3.998, -20.308, 10.027 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.398, "simple_Twist": 27.457, "simple_hRise": 2.818, "simple_hTwist": 29.811 }, { "index": 3, "nt1": "///P/104", "nt2": "///P/117", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.276, -0.130, -0.074, -3.998, -20.308, 10.027 ], "step_params": [ -0.648, -1.940, 2.878, 4.119, 11.603, 19.130 ], "heli_params": [ -7.857, 2.687, 1.330, 31.088, -11.035, 22.719 ], "bp2_params": [ -0.068, 0.044, -0.379, 9.033, 3.895, 1.132 ], "groove_widths": [ 16.173, null, 18.212, null ], "simple_Rise": 2.878, "simple_Twist": 32.354, "simple_hRise": 1.991, "simple_hTwist": 34.559 }, { "index": 4, "nt1": "///P/105", "nt2": "///P/116", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.068, 0.044, -0.379, 9.033, 3.895, 1.132 ], "step_params": [ -0.749, -1.618, 3.346, -5.688, 1.318, 28.152 ], "heli_params": [ -3.567, 0.188, 3.352, 2.674, 11.537, 28.739 ], "bp2_params": [ -0.356, -0.043, 0.130, 5.804, -5.696, -4.426 ], "groove_widths": [ 16.966, null, 17.956, null ], "simple_Rise": 3.346, "simple_Twist": 29.628, "simple_hRise": 3.355, "simple_hTwist": 30.185 }, { "index": 5, "nt1": "///P/106", "nt2": "///P/115", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.356, -0.043, 0.130, 5.804, -5.696, -4.426 ], "step_params": [ 0.472, -1.284, 3.304, 2.058, 4.689, 36.123 ], "heli_params": [ -2.694, -0.472, 3.140, 7.515, -3.299, 36.472 ], "bp2_params": [ 0.144, -0.040, 0.071, 6.560, -13.946, 4.865 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.304, "simple_Twist": 33.507, "simple_hRise": 3.124, "simple_hTwist": 33.885 }, { "index": 6, "nt1": "///P/107", "nt2": "///P/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.144, -0.040, 0.071, 6.560, -13.946, 4.865 ], "step_params": [ 0.160, -1.997, 3.353, -0.881, 4.318, 27.904 ], "heli_params": [ -5.076, -0.528, 3.010, 8.883, 1.813, 28.243 ], "bp2_params": [ -0.513, -0.032, 0.059, 3.566, -2.419, 0.468 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.353, "simple_Twist": 31.224, "simple_hRise": 3.051, "simple_hTwist": 31.526 }, { "index": 7, "nt1": "///P/108", "nt2": "///P/113", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 11, "helix_index": 6, "strand1": "CGCC", "strand2": "GCGG", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.386, "helical_rise_std": 0.240, "helical_radius": 9.391, "helical_radius_std": 0.931, "helical_axis": [ -0.225, -0.969, -0.104 ], "point1": [ 25.652, 36.438, 39.593 ], "point2": [ 24.066, 29.596, 38.857 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///F/2", "nt2": "///Q/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.172, -0.284, 0.101, 6.077, -6.803, -1.306 ], "step_params": [ -0.845, -1.797, 3.342, -2.703, 6.067, 31.819 ], "heli_params": [ -4.256, 1.044, 3.017, 10.917, 4.865, 32.487 ], "bp2_params": [ -0.219, -0.323, -0.082, 2.295, -10.187, -0.476 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.342, "simple_Twist": 33.656, "simple_hRise": 3.038, "simple_hTwist": 34.286 }, { "index": 2, "nt1": "///F/3", "nt2": "///Q/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.219, -0.323, -0.082, 2.295, -10.187, -0.476 ], "step_params": [ -0.491, -1.632, 3.170, -1.087, 4.598, 30.157 ], "heli_params": [ -3.955, 0.730, 2.910, 8.770, 2.073, 30.516 ], "bp2_params": [ 0.296, -0.287, -0.233, 5.222, -16.854, -2.801 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.170, "simple_Twist": 27.971, "simple_hRise": 2.886, "simple_hTwist": 28.359 }, { "index": 3, "nt1": "///F/4", "nt2": "///Q/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.296, -0.287, -0.233, 5.222, -16.854, -2.801 ], "step_params": [ -0.008, -1.795, 3.402, 0.543, 12.896, 28.903 ], "heli_params": [ -5.517, 0.109, 2.401, 24.363, -1.026, 31.598 ], "bp2_params": [ 0.493, -0.151, -0.253, 6.526, -7.115, -0.200 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.402, "simple_Twist": 27.542, "simple_hRise": 2.345, "simple_hTwist": 30.364 }, { "index": 4, "nt1": "///F/5", "nt2": "///Q/53", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 12, "helix_index": 6, "strand1": "AACU", "strand2": "UUGA", "bp_type": "||||", "helix_form": "..A", "helical_rise": 2.391, "helical_rise_std": 0.274, "helical_radius": 8.763, "helical_radius_std": 0.762, "helical_axis": [ 0.113, -0.882, 0.457 ], "point1": [ 31.392, 20.265, 39.785 ], "point2": [ 32.180, 14.117, 42.973 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///F/8", "nt2": "///Q/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.308, 0.238, 0.181, 16.461, -9.971, 0.066 ], "step_params": [ 0.204, -0.820, 3.259, -0.052, 6.177, 34.412 ], "heli_params": [ -2.276, -0.348, 3.070, 10.338, 0.087, 34.945 ], "bp2_params": [ -0.254, 0.048, 0.207, 18.286, -25.826, 5.119 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.259, "simple_Twist": 34.892, "simple_hRise": 3.073, "simple_hTwist": 35.418 }, { "index": 2, "nt1": "///F/9", "nt2": "///Q/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.254, 0.048, 0.207, 18.286, -25.826, 5.119 ], "step_params": [ -0.139, -1.204, 3.283, 1.985, 7.299, 36.200 ], "heli_params": [ -2.853, 0.478, 2.981, 11.591, -3.153, 36.955 ], "bp2_params": [ -0.006, -0.066, -0.400, 10.167, -27.093, 2.886 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.283, "simple_Twist": 34.283, "simple_hRise": 2.960, "simple_hTwist": 35.083 }, { "index": 3, "nt1": "///F/10", "nt2": "///Q/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.006, -0.066, -0.400, 10.167, -27.093, 2.886 ], "step_params": [ -0.331, -1.549, 3.699, -5.530, 10.165, 32.111 ], "heli_params": [ -4.375, -0.378, 3.094, 17.676, 9.615, 34.081 ], "bp2_params": [ -0.213, -0.169, 0.491, -4.846, -9.612, -4.382 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.699, "simple_Twist": 32.613, "simple_hRise": 3.106, "simple_hTwist": 34.552 }, { "index": 4, "nt1": "///F/11", "nt2": "///Q/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 13, "helix_index": 6, "strand1": "gGCACC", "strand2": "CCGUGG", "bp_type": "||||||", "helix_form": "AAAAA", "helical_rise": 2.370, "helical_rise_std": 0.270, "helical_radius": 9.112, "helical_radius_std": 0.456, "helical_axis": [ 0.065, -0.986, 0.151 ], "point1": [ 33.547, 9.750, 44.420 ], "point2": [ 34.305, -1.789, 46.181 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///Q/12", "nt2": "///Q/22", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.401, -0.085, 0.126, 1.794, -13.525, -3.216 ], "step_params": [ -0.347, -1.873, 3.294, -1.717, 4.706, 36.088 ], "heli_params": [ -3.633, 0.323, 3.047, 7.552, 2.755, 36.422 ], "bp2_params": [ -0.070, -0.070, 0.248, -2.679, -15.930, -1.120 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.294, "simple_Twist": 33.971, "simple_hRise": 3.028, "simple_hTwist": 34.327 }, { "index": 2, "nt1": "///Q/13", "nt2": "///Q/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.070, -0.070, 0.248, -2.679, -15.930, -1.120 ], "step_params": [ 0.242, -1.453, 3.093, -0.477, 5.672, 33.185 ], "heli_params": [ -3.351, -0.489, 2.809, 9.841, 0.828, 33.656 ], "bp2_params": [ 0.185, -0.025, 0.227, 2.422, -12.101, 2.472 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.093, "simple_Twist": 32.015, "simple_hRise": 2.797, "simple_hTwist": 32.504 }, { "index": 3, "nt1": "///Q/14", "nt2": "///Q/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.185, -0.025, 0.227, 2.422, -12.101, 2.472 ], "step_params": [ -0.122, -1.466, 2.739, -2.699, 10.413, 28.491 ], "heli_params": [ -4.387, -0.180, 2.088, 20.268, 5.254, 30.415 ], "bp2_params": [ 0.111, 0.074, 0.574, 13.065, -2.286, 4.495 ], "groove_widths": [ 17.870, null, 15.336, null ], "simple_Rise": 2.739, "simple_Twist": 28.965, "simple_hRise": 2.101, "simple_hTwist": 30.858 }, { "index": 4, "nt1": "///Q/15", "nt2": "///Q/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.111, 0.074, 0.574, 13.065, -2.286, 4.495 ], "step_params": [ 0.134, -1.345, 3.303, 6.229, 10.673, 33.584 ], "heli_params": [ -3.665, 0.641, 2.743, 17.742, -10.354, 35.724 ], "bp2_params": [ 0.236, -0.062, -0.154, 10.440, -17.380, 1.989 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.303, "simple_Twist": 33.130, "simple_hRise": 2.733, "simple_hTwist": 35.299 }, { "index": 5, "nt1": "///Q/16", "nt2": "///Q/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.236, -0.062, -0.154, 10.440, -17.380, 1.989 ], "step_params": [ 0.093, -2.073, 3.514, -2.697, 10.170, 32.292 ], "heli_params": [ -5.155, -0.584, 2.738, 17.709, 4.697, 33.919 ], "bp2_params": [ 0.362, -0.109, 0.163, -2.648, -6.049, 0.558 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.514, "simple_Twist": 31.276, "simple_hRise": 2.708, "simple_hTwist": 32.956 }, { "index": 6, "nt1": "///Q/17", "nt2": "///Q/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 14, "helix_index": 7, "strand1": "CGA", "strand2": "GCU", "bp_type": "|||", "helix_form": "AA", "helical_rise": 3.967, "helical_rise_std": 0.224, "helical_radius": 8.996, "helical_radius_std": 0.252, "helical_axis": [ 0.180, 0.719, -0.671 ], "point1": [ 13.361, 35.829, 41.384 ], "point2": [ 14.825, 41.677, 35.928 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///Q/29", "nt2": "///Q/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.468, -0.081, 0.540, -13.706, 5.829, 0.767 ], "step_params": [ -0.245, -1.273, 2.995, 3.989, 0.833, 19.362 ], "heli_params": [ -4.064, 2.425, 2.830, 2.442, -11.692, 19.783 ], "bp2_params": [ -0.275, -0.069, 0.214, 3.982, -7.197, -1.183 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.995, "simple_Twist": 23.017, "simple_hRise": 2.865, "simple_hTwist": 23.370 }, { "index": 2, "nt1": "///Q/30", "nt2": "///Q/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.275, -0.069, 0.214, 3.982, -7.197, -1.183 ], "step_params": [ -0.665, -2.109, 3.423, -0.360, 5.944, 37.665 ], "heli_params": [ -3.981, 0.972, 3.073, 9.136, 0.553, 38.116 ], "bp2_params": [ 0.013, -0.148, -0.234, -4.512, -7.802, -2.953 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.423, "simple_Twist": 36.333, "simple_hRise": 3.058, "simple_hTwist": 36.802 }, { "index": 3, "nt1": "///Q/31", "nt2": "///Q/43", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 15, "helix_index": 8, "strand1": "GGGGUU", "strand2": "CCUCAG", "bp_type": "||||||", "helix_form": "A..A.", "helical_rise": 2.465, "helical_rise_std": 0.192, "helical_radius": 8.562, "helical_radius_std": 0.633, "helical_axis": [ 0.495, -0.863, 0.105 ], "point1": [ 21.581, 62.376, 33.703 ], "point2": [ 27.565, 51.945, 34.977 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///Q/35", "nt2": "///Q/65", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.481, -0.080, 0.677, 9.699, -11.211, -0.143 ], "step_params": [ -0.346, -1.724, 3.367, 0.522, 6.192, 36.723 ], "heli_params": [ -3.513, 0.610, 3.041, 9.743, -0.821, 37.227 ], "bp2_params": [ -0.405, -0.285, 0.151, -0.901, -12.076, 0.035 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.367, "simple_Twist": 36.282, "simple_hRise": 3.036, "simple_hTwist": 36.793 }, { "index": 2, "nt1": "///Q/36", "nt2": "///Q/64", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.405, -0.285, 0.151, -0.901, -12.076, 0.035 ], "step_params": [ -0.261, -1.868, 2.869, -2.961, 8.714, 27.369 ], "heli_params": [ -5.295, -0.002, 2.197, 17.791, 6.044, 28.847 ], "bp2_params": [ -2.021, -0.501, 0.206, 0.062, -15.737, -3.144 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.869, "simple_Twist": 35.991, "simple_hRise": 2.381, "simple_hTwist": 37.111 }, { "index": 3, "nt1": "///Q/37", "nt2": "///Q/63", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.021, -0.501, 0.206, 0.062, -15.737, -3.144 ], "step_params": [ 0.023, -1.734, 3.512, -0.992, 9.624, 36.853 ], "heli_params": [ -3.893, -0.163, 2.981, 14.911, 1.536, 38.060 ], "bp2_params": [ -0.762, -0.376, -0.079, -10.607, -18.069, -2.232 ], "groove_widths": [ 16.709, null, 14.192, null ], "simple_Rise": 3.512, "simple_Twist": 29.864, "simple_hRise": 2.828, "simple_hTwist": 31.359 }, { "index": 4, "nt1": "///Q/38", "nt2": "///Q/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.762, -0.376, -0.079, -10.607, -18.069, -2.232 ], "step_params": [ 0.132, -1.017, 3.432, -2.383, 7.768, 37.545 ], "heli_params": [ -2.535, -0.504, 3.154, 11.898, 3.651, 38.384 ], "bp2_params": [ -0.197, -0.067, 0.346, -15.543, -16.292, 0.246 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.432, "simple_Twist": 34.355, "simple_hRise": 3.119, "simple_hTwist": 35.275 }, { "index": 5, "nt1": "///Q/39", "nt2": "///Q/61", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.197, -0.067, 0.346, -15.543, -16.292, 0.246 ], "step_params": [ -0.021, -0.932, 2.805, 4.350, 2.607, 48.386 ], "heli_params": [ -1.301, 0.309, 2.742, 3.171, -5.290, 48.635 ], "bp2_params": [ 3.084, -0.955, 0.096, -0.586, -8.188, -7.581 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.805, "simple_Twist": 30.664, "simple_hRise": 2.690, "simple_hTwist": 31.071 }, { "index": 6, "nt1": "///Q/40", "nt2": "///Q/60", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 16, "helix_index": 8, "strand1": "CGGUUG", "strand2": "GCCAAC", "bp_type": "||||||", "helix_form": ".AAAA", "helical_rise": 3.209, "helical_rise_std": 0.469, "helical_radius": 9.189, "helical_radius_std": 0.492, "helical_axis": [ -0.516, 0.857, -0.006 ], "point1": [ 20.514, 64.401, 32.704 ], "point2": [ 12.116, 78.355, 32.598 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///Q/66", "nt2": "///Q/84", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.554, -0.126, 0.443, -10.144, -9.147, -0.105 ], "step_params": [ 0.524, -0.832, 2.835, 1.251, 11.993, 28.597 ], "heli_params": [ -3.460, -0.783, 2.327, 23.030, -2.401, 30.986 ], "bp2_params": [ -0.514, -0.231, 0.257, 4.760, -15.306, -0.613 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.835, "simple_Twist": 34.823, "simple_hRise": 2.443, "simple_hTwist": 36.790 }, { "index": 2, "nt1": "///Q/67", "nt2": "///Q/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.514, -0.231, 0.257, 4.760, -15.306, -0.613 ], "step_params": [ 0.790, -1.845, 3.384, 2.395, 6.616, 31.737 ], "heli_params": [ -4.443, -0.998, 2.998, 11.915, -4.313, 32.488 ], "bp2_params": [ -0.152, -0.029, 0.364, -3.350, -20.648, 4.524 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.384, "simple_Twist": 29.404, "simple_hRise": 2.961, "simple_hTwist": 30.216 }, { "index": 3, "nt1": "///Q/68", "nt2": "///Q/82", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.152, -0.029, 0.364, -3.350, -20.648, 4.524 ], "step_params": [ -1.178, -1.785, 3.317, 5.457, 3.485, 32.412 ], "heli_params": [ -3.703, 2.956, 2.884, 6.166, -9.656, 33.036 ], "bp2_params": [ -0.194, 0.002, -0.524, -8.865, -17.996, -0.135 ], "groove_widths": [ 15.982, null, 17.101, null ], "simple_Rise": 3.317, "simple_Twist": 32.430, "simple_hRise": 2.884, "simple_hTwist": 33.053 }, { "index": 4, "nt1": "///Q/69", "nt2": "///Q/81", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.194, 0.002, -0.524, -8.865, -17.996, -0.135 ], "step_params": [ 0.643, -0.768, 3.233, -4.319, 6.110, 33.571 ], "heli_params": [ -2.213, -1.734, 2.949, 10.417, 7.363, 34.371 ], "bp2_params": [ 0.058, 0.084, 0.195, -2.760, -10.394, 3.503 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.233, "simple_Twist": 32.649, "simple_hRise": 2.939, "simple_hTwist": 33.473 }, { "index": 5, "nt1": "///Q/70", "nt2": "///Q/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.058, 0.084, 0.195, -2.760, -10.394, 3.503 ], "step_params": [ 0.423, -1.314, 2.719, -1.330, 9.619, 28.147 ], "heli_params": [ -4.101, -1.037, 2.141, 19.074, 2.638, 29.743 ], "bp2_params": [ 0.100, 0.054, 0.788, 11.847, -8.211, 4.188 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.719, "simple_Twist": 28.112, "simple_hRise": 2.140, "simple_hTwist": 29.710 }, { "index": 6, "nt1": "///Q/71", "nt2": "///Q/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 17, "helix_index": 8, "strand1": "UCAUCA", "strand2": "AGUAGU", "bp_type": "||||||", "helix_form": "AA...", "helical_rise": 2.468, "helical_rise_std": 0.311, "helical_radius": 9.225, "helical_radius_std": 0.860, "helical_axis": [ 0.567, -0.820, -0.078 ], "point1": [ 3.100, 90.540, 33.934 ], "point2": [ 10.057, 80.491, 32.976 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///Q/73", "nt2": "///Q/141", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.673, 0.308, -0.455, -5.951, 1.697, -4.078 ], "step_params": [ 0.972, -1.633, 3.043, -6.627, 9.601, 30.543 ], "heli_params": [ -4.286, -2.682, 2.191, 17.446, 12.042, 32.645 ], "bp2_params": [ -1.061, 0.246, 0.211, 3.844, -13.670, 7.754 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.043, "simple_Twist": 32.694, "simple_hRise": 2.255, "simple_hTwist": 34.660 }, { "index": 2, "nt1": "///Q/74", "nt2": "///Q/140", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.061, 0.246, 0.211, 3.844, -13.670, 7.754 ], "step_params": [ -0.491, -1.204, 3.431, 0.951, 20.515, 33.572 ], "heli_params": [ -4.139, 0.841, 2.331, 32.066, -1.486, 39.200 ], "bp2_params": [ -0.520, 0.507, -0.426, -11.070, -17.548, 0.835 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.431, "simple_Twist": 29.867, "simple_hRise": 2.172, "simple_hTwist": 36.114 }, { "index": 3, "nt1": "///Q/75", "nt2": "///Q/139", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.520, 0.507, -0.426, -11.070, -17.548, 0.835 ], "step_params": [ -0.263, -1.013, 2.941, -2.940, 4.783, 36.206 ], "heli_params": [ -2.192, 0.063, 2.801, 7.639, 4.697, 36.624 ], "bp2_params": [ -0.125, 0.313, -0.319, -1.666, -13.764, 9.816 ], "groove_widths": [ 17.162, null, 15.387, null ], "simple_Rise": 2.941, "simple_Twist": 34.922, "simple_hRise": 2.794, "simple_hTwist": 35.357 }, { "index": 4, "nt1": "///Q/76", "nt2": "///Q/138", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.125, 0.313, -0.319, -1.666, -13.764, 9.816 ], "step_params": [ 0.517, -1.439, 3.163, -3.966, 4.464, 36.866 ], "heli_params": [ -2.798, -1.297, 2.906, 7.003, 6.221, 37.330 ], "bp2_params": [ 0.858, 0.091, 0.205, -1.614, -5.416, 7.789 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.163, "simple_Twist": 31.508, "simple_hRise": 2.853, "simple_hTwist": 32.054 }, { "index": 5, "nt1": "///Q/77", "nt2": "///Q/137", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.858, 0.091, 0.205, -1.614, -5.416, 7.789 ], "step_params": [ -0.761, -1.630, 3.310, 6.404, 15.541, 27.008 ], "heli_params": [ -5.449, 2.408, 1.893, 29.884, -12.314, 31.729 ], "bp2_params": [ 0.183, -0.028, -0.521, -8.442, -17.238, -13.188 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.310, "simple_Twist": 30.014, "simple_hRise": 2.046, "simple_hTwist": 34.306 }, { "index": 6, "nt1": "///Q/78", "nt2": "///Q/136", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 18, "helix_index": 9, "strand1": "GCUUUUACU", "strand2": "UGAAAGUGG", "bp_type": "|||||||||", "helix_form": ".AAA..A.", "helical_rise": 2.722, "helical_rise_std": 0.113, "helical_radius": 9.011, "helical_radius_std": 0.312, "helical_axis": [ 0.109, -0.985, 0.132 ], "point1": [ -2.680, 69.327, 35.773 ], "point2": [ -0.323, 48.029, 38.620 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///Q/88", "nt2": "///Q/134", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.041, -0.186, -0.070, -10.014, -8.777, 0.086 ], "step_params": [ -0.933, -1.665, 3.206, -0.913, -0.359, 41.506 ], "heli_params": [ -2.311, 1.220, 3.239, -0.506, 1.288, 41.517 ], "bp2_params": [ 1.039, -0.066, -0.037, -3.192, -10.816, 0.233 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.206, "simple_Twist": 25.363, "simple_hRise": 3.260, "simple_hTwist": 25.382 }, { "index": 2, "nt1": "///Q/89", "nt2": "///Q/133", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.039, -0.066, -0.037, -3.192, -10.816, 0.233 ], "step_params": [ 0.013, -1.775, 2.931, -1.908, 4.634, 21.326 ], "heli_params": [ -6.182, -0.656, 2.482, 12.303, 5.067, 21.900 ], "bp2_params": [ -0.599, 0.097, 0.171, 8.951, -11.058, 5.539 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.931, "simple_Twist": 30.822, "simple_hRise": 2.637, "simple_hTwist": 31.217 }, { "index": 3, "nt1": "///Q/90", "nt2": "///Q/132", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.599, 0.097, 0.171, 8.951, -11.058, 5.539 ], "step_params": [ 0.021, -1.407, 3.423, 2.851, 10.263, 34.280 ], "heli_params": [ -3.741, 0.369, 2.888, 16.913, -4.699, 35.849 ], "bp2_params": [ -0.184, 0.070, -0.264, 1.137, -17.683, 4.567 ], "groove_widths": [ 17.026, null, 15.903, null ], "simple_Rise": 3.423, "simple_Twist": 31.548, "simple_hRise": 2.830, "simple_hTwist": 33.254 }, { "index": 4, "nt1": "///Q/91", "nt2": "///Q/131", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.184, 0.070, -0.264, 1.137, -17.683, 4.567 ], "step_params": [ 0.321, -1.418, 3.307, -4.076, 8.657, 32.490 ], "heli_params": [ -3.766, -1.178, 2.789, 15.070, 7.096, 33.833 ], "bp2_params": [ -0.348, -0.008, 0.187, -4.902, -13.743, 2.426 ], "groove_widths": [ 16.567, 15.277, 15.425, 12.364 ], "simple_Rise": 3.307, "simple_Twist": 33.371, "simple_hRise": 2.805, "simple_hTwist": 34.678 }, { "index": 5, "nt1": "///Q/92", "nt2": "///Q/130", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.348, -0.008, 0.187, -4.902, -13.743, 2.426 ], "step_params": [ -0.176, -1.516, 3.254, -3.103, 3.328, 41.849 ], "heli_params": [ -2.448, -0.069, 3.135, 4.642, 4.329, 42.085 ], "bp2_params": [ 2.426, -0.655, 0.722, -6.529, -8.143, -3.562 ], "groove_widths": [ 16.531, 15.214, 15.174, 12.011 ], "simple_Rise": 3.254, "simple_Twist": 26.535, "simple_hRise": 3.045, "simple_hTwist": 26.915 }, { "index": 6, "nt1": "///Q/93", "nt2": "///Q/129", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.426, -0.655, 0.722, -6.529, -8.143, -3.562 ], "step_params": [ -0.292, -1.624, 2.876, 10.092, 7.062, 26.356 ], "heli_params": [ -4.487, 2.365, 2.128, 14.521, -20.753, 29.046 ], "bp2_params": [ -0.100, -0.151, -0.199, -1.838, -17.572, 2.531 ], "groove_widths": [ 16.798, null, 15.021, null ], "simple_Rise": 2.876, "simple_Twist": 40.199, "simple_hRise": 2.431, "simple_hTwist": 41.969 }, { "index": 7, "nt1": "///Q/94", "nt2": "///Q/128", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.100, -0.151, -0.199, -1.838, -17.572, 2.531 ], "step_params": [ 0.558, -1.329, 3.195, -0.709, 4.428, 33.518 ], "heli_params": [ -2.965, -1.069, 2.988, 7.636, 1.222, 33.808 ], "bp2_params": [ 0.591, -0.243, 0.165, 0.373, -13.798, 1.064 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.195, "simple_Twist": 29.909, "simple_hRise": 2.958, "simple_hTwist": 30.235 }, { "index": 8, "nt1": "///Q/95", "nt2": "///Q/127", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.591, -0.243, 0.165, 0.373, -13.798, 1.064 ], "step_params": [ -0.605, -1.660, 3.240, 1.898, 6.783, 34.667 ], "heli_params": [ -3.673, 1.259, 2.839, 11.239, -3.145, 35.353 ], "bp2_params": [ 2.012, -0.621, 0.068, 1.741, -9.813, -8.486 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.240, "simple_Twist": 27.266, "simple_hRise": 2.708, "simple_hTwist": 28.144 }, { "index": 9, "nt1": "///Q/96", "nt2": "///Q/126", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 19, "helix_index": 10, "strand1": "CAUUAAG", "strand2": "GUGAUUC", "bp_type": "|||||||", "helix_form": "A..AAA", "helical_rise": 2.753, "helical_rise_std": 0.325, "helical_radius": 9.431, "helical_radius_std": 0.557, "helical_axis": [ 0.474, -0.881, 0.006 ], "point1": [ 5.385, 23.971, 33.391 ], "point2": [ 13.217, 9.412, 33.490 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///Q/102", "nt2": "///Q/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.116, -0.058, 0.034, 15.293, -14.171, 0.351 ], "step_params": [ 0.581, -1.721, 3.222, -2.191, 17.067, 35.060 ], "heli_params": [ -4.378, -1.102, 2.150, 26.453, 3.395, 38.936 ], "bp2_params": [ -0.145, -0.050, 0.271, 4.032, -24.601, 4.460 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.222, "simple_Twist": 36.405, "simple_hRise": 2.195, "simple_hTwist": 40.142 }, { "index": 2, "nt1": "///Q/103", "nt2": "///Q/118", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.145, -0.050, 0.271, 4.032, -24.601, 4.460 ], "step_params": [ 0.384, -1.545, 3.441, 2.512, 2.514, 41.622 ], "heli_params": [ -2.443, -0.264, 3.363, 3.531, -3.527, 41.767 ], "bp2_params": [ 2.139, -0.206, 0.161, -2.411, -15.587, 4.708 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.441, "simple_Twist": 29.119, "simple_hRise": 3.319, "simple_hTwist": 29.331 }, { "index": 3, "nt1": "///Q/104", "nt2": "///Q/117", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.139, -0.206, 0.161, -2.411, -15.587, 4.708 ], "step_params": [ -1.411, -2.760, 3.251, -1.376, 8.456, 18.529 ], "heli_params": [ -10.933, 3.472, 1.916, 24.627, 4.008, 20.398 ], "bp2_params": [ -0.038, 0.052, 0.398, -9.365, -8.763, -3.419 ], "groove_widths": [ 16.364, null, 18.224, null ], "simple_Rise": 3.251, "simple_Twist": 30.243, "simple_hRise": 2.468, "simple_hTwist": 31.406 }, { "index": 4, "nt1": "///Q/105", "nt2": "///Q/116", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.038, 0.052, 0.398, -9.365, -8.763, -3.419 ], "step_params": [ 0.430, -1.043, 3.131, 5.838, 8.606, 34.314 ], "heli_params": [ -2.850, 0.082, 2.829, 14.187, -9.624, 35.810 ], "bp2_params": [ 0.440, 0.242, -0.424, -3.861, -12.161, 9.494 ], "groove_widths": [ 17.204, null, 16.886, null ], "simple_Rise": 3.131, "simple_Twist": 31.507, "simple_hRise": 2.791, "simple_hTwist": 33.138 }, { "index": 5, "nt1": "///Q/106", "nt2": "///Q/115", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.440, 0.242, -0.424, -3.861, -12.161, 9.494 ], "step_params": [ -0.258, -1.043, 2.983, -4.461, 1.704, 29.997 ], "heli_params": [ -2.302, -0.323, 2.928, 3.266, 8.551, 30.366 ], "bp2_params": [ -0.081, -0.006, 0.185, 6.492, -12.118, 2.800 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.983, "simple_Twist": 33.163, "simple_hRise": 2.936, "simple_hTwist": 33.496 }, { "index": 6, "nt1": "///Q/107", "nt2": "///Q/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.081, -0.006, 0.185, 6.492, -12.118, 2.800 ], "step_params": [ 0.325, -2.003, 3.209, 1.732, 10.506, 30.022 ], "heli_params": [ -5.353, -0.312, 2.404, 19.525, -3.219, 31.814 ], "bp2_params": [ -0.333, -0.080, 0.055, 8.341, -0.335, -0.739 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.209, "simple_Twist": 31.314, "simple_hRise": 2.442, "simple_hTwist": 33.032 }, { "index": 7, "nt1": "///Q/108", "nt2": "///Q/113", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 20, "helix_index": 11, "strand1": "CGCC", "strand2": "GCGG", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.267, "helical_rise_std": 0.233, "helical_radius": 9.411, "helical_radius_std": 0.977, "helical_axis": [ -0.238, 0.962, 0.134 ], "point1": [ 25.346, 24.574, 61.819 ], "point2": [ 23.765, 30.967, 62.709 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///G/2", "nt2": "///R/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.025, -0.258, -0.016, 4.816, -2.339, -1.784 ], "step_params": [ -0.760, -1.910, 3.301, -2.397, 7.800, 29.458 ], "heli_params": [ -5.089, 0.994, 2.768, 14.981, 4.604, 30.543 ], "bp2_params": [ -0.666, -0.364, -0.307, 2.333, -10.814, -1.167 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.301, "simple_Twist": 33.060, "simple_hRise": 2.837, "simple_hTwist": 34.025 }, { "index": 2, "nt1": "///G/3", "nt2": "///R/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.666, -0.364, -0.307, 2.333, -10.814, -1.167 ], "step_params": [ -0.242, -1.619, 3.314, -6.151, 2.811, 32.060 ], "heli_params": [ -3.356, -0.631, 3.155, 5.021, 10.984, 32.748 ], "bp2_params": [ -0.022, -0.200, 0.187, 3.646, -13.382, 0.802 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.314, "simple_Twist": 29.200, "simple_hRise": 3.132, "simple_hTwist": 29.956 }, { "index": 3, "nt1": "///G/4", "nt2": "///R/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.022, -0.200, 0.187, 3.646, -13.382, 0.802 ], "step_params": [ -0.079, -1.887, 3.308, 2.085, 8.968, 30.026 ], "heli_params": [ -5.058, 0.511, 2.637, 16.819, -3.909, 31.375 ], "bp2_params": [ 0.363, -0.155, -0.094, 4.634, -0.767, -1.313 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.308, "simple_Twist": 27.448, "simple_hRise": 2.563, "simple_hTwist": 28.923 }, { "index": 4, "nt1": "///G/5", "nt2": "///R/53", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 21, "helix_index": 11, "strand1": "AACU", "strand2": "UUGA", "bp_type": "||||", "helix_form": ".AA", "helical_rise": 2.479, "helical_rise_std": 0.256, "helical_radius": 8.945, "helical_radius_std": 0.801, "helical_axis": [ 0.135, 0.896, -0.423 ], "point1": [ 31.271, 40.424, 62.125 ], "point2": [ 32.253, 46.943, 59.050 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///G/8", "nt2": "///R/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.023, -0.083, 0.228, 15.926, -10.397, -3.016 ], "step_params": [ 0.121, -0.676, 3.357, 2.417, 5.504, 34.283 ], "heli_params": [ -1.979, 0.171, 3.214, 9.248, -4.061, 34.790 ], "bp2_params": [ -0.197, 0.031, 0.031, 16.532, -28.263, 3.557 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.357, "simple_Twist": 35.800, "simple_hRise": 3.223, "simple_hTwist": 36.285 }, { "index": 2, "nt1": "///G/9", "nt2": "///R/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.197, 0.031, 0.031, 16.532, -28.263, 3.557 ], "step_params": [ -0.199, -1.321, 3.264, 0.547, 12.483, 34.848 ], "heli_params": [ -3.654, 0.382, 2.649, 20.063, -0.879, 36.955 ], "bp2_params": [ 0.045, -0.076, -0.390, 8.107, -30.563, -0.494 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.264, "simple_Twist": 33.062, "simple_hRise": 2.608, "simple_hTwist": 35.282 }, { "index": 3, "nt1": "///G/10", "nt2": "///R/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.045, -0.076, -0.390, 8.107, -30.563, -0.494 ], "step_params": [ -0.340, -1.685, 3.688, -5.698, 8.236, 31.028 ], "heli_params": [ -4.546, -0.460, 3.160, 14.917, 10.319, 32.566 ], "bp2_params": [ 0.006, -0.199, 0.325, -4.387, -9.684, -4.580 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.688, "simple_Twist": 31.060, "simple_hRise": 3.161, "simple_hTwist": 32.597 }, { "index": 4, "nt1": "///G/11", "nt2": "///R/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 22, "helix_index": 11, "strand1": "gGCACC", "strand2": "CCGUGG", "bp_type": "||||||", "helix_form": "AAAAA", "helical_rise": 2.350, "helical_rise_std": 0.225, "helical_radius": 9.212, "helical_radius_std": 0.507, "helical_axis": [ 0.079, 0.989, -0.125 ], "point1": [ 33.596, 51.185, 57.528 ], "point2": [ 34.515, 62.618, 56.083 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///R/12", "nt2": "///R/22", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.178, -0.162, -0.026, -5.132, -11.607, -9.815 ], "step_params": [ -0.642, -1.767, 3.868, 4.322, 17.161, 37.601 ], "heli_params": [ -4.454, 1.400, 2.755, 25.002, -6.296, 41.421 ], "bp2_params": [ -0.027, -0.092, -1.373, -24.844, -34.278, -2.614 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.868, "simple_Twist": 34.988, "simple_hRise": 2.656, "simple_hTwist": 39.084 }, { "index": 2, "nt1": "///R/13", "nt2": "///R/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.027, -0.092, -1.373, -24.844, -34.278, -2.614 ], "step_params": [ 0.448, -0.689, 2.576, -12.574, -1.442, 29.436 ], "heli_params": [ -1.050, -2.559, 2.234, -2.688, 23.429, 31.986 ], "bp2_params": [ -0.167, 0.268, -0.087, 5.781, -18.339, 7.833 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.576, "simple_Twist": 32.441, "simple_hRise": 2.279, "simple_hTwist": 34.761 }, { "index": 3, "nt1": "///R/14", "nt2": "///R/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.167, 0.268, -0.087, 5.781, -18.339, 7.833 ], "step_params": [ -0.809, -1.517, 3.308, 1.872, 14.912, 27.407 ], "heli_params": [ -5.356, 1.823, 2.156, 28.883, -3.627, 31.188 ], "bp2_params": [ -0.012, 0.031, -0.624, 5.998, -14.560, -3.969 ], "groove_widths": [ 17.686, null, 15.334, null ], "simple_Rise": 3.308, "simple_Twist": 26.575, "simple_hRise": 2.116, "simple_hTwist": 30.463 }, { "index": 4, "nt1": "///R/15", "nt2": "///R/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.012, 0.031, -0.624, 5.998, -14.560, -3.969 ], "step_params": [ 0.454, -1.763, 3.350, -6.846, 12.018, 37.003 ], "heli_params": [ -3.942, -1.429, 2.558, 18.175, 10.354, 39.418 ], "bp2_params": [ 0.459, -0.163, 0.306, 1.983, -10.718, -0.681 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.350, "simple_Twist": 34.255, "simple_hRise": 2.481, "simple_hTwist": 36.864 }, { "index": 5, "nt1": "///R/16", "nt2": "///R/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.459, -0.163, 0.306, 1.983, -10.718, -0.681 ], "step_params": [ 0.332, -2.139, 3.294, 1.232, 4.944, 29.984 ], "heli_params": [ -5.026, -0.397, 2.923, 9.470, -2.360, 30.404 ], "bp2_params": [ 0.102, 0.188, 0.332, -4.467, -7.475, 4.861 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.294, "simple_Twist": 31.994, "simple_hRise": 2.949, "simple_hTwist": 32.387 }, { "index": 6, "nt1": "///R/17", "nt2": "///R/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 23, "helix_index": 12, "strand1": "CGA", "strand2": "GCU", "bp_type": "|||", "helix_form": "AA", "helical_rise": 3.949, "helical_rise_std": 0.301, "helical_radius": 8.992, "helical_radius_std": 0.357, "helical_axis": [ 0.191, -0.725, 0.662 ], "point1": [ 13.224, 25.015, 60.022 ], "point2": [ 14.766, 19.144, 65.381 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///R/29", "nt2": "///R/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.228, -0.092, 0.510, -14.762, 8.419, 2.312 ], "step_params": [ -0.450, -1.222, 3.057, 3.018, -0.257, 21.593 ], "heli_params": [ -3.138, 2.286, 2.981, -0.682, -8.005, 21.802 ], "bp2_params": [ -0.035, -0.240, 0.235, 2.622, -8.265, -5.091 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.057, "simple_Twist": 22.367, "simple_hRise": 2.984, "simple_hTwist": 22.569 }, { "index": 2, "nt1": "///R/30", "nt2": "///R/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.035, -0.240, 0.235, 2.622, -8.265, -5.091 ], "step_params": [ -0.609, -2.210, 3.545, 2.176, 7.595, 35.759 ], "heli_params": [ -4.576, 1.273, 2.988, 12.186, -3.491, 36.593 ], "bp2_params": [ -0.119, -0.120, -0.503, -11.447, -10.772, -3.216 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.545, "simple_Twist": 35.989, "simple_hRise": 2.992, "simple_hTwist": 36.818 }, { "index": 3, "nt1": "///R/31", "nt2": "///R/43", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 24, "helix_index": 13, "strand1": "GGGGUU", "strand2": "CCUCAG", "bp_type": "||||||", "helix_form": "A..A.", "helical_rise": 2.514, "helical_rise_std": 0.165, "helical_radius": 8.516, "helical_radius_std": 0.592, "helical_axis": [ 0.493, 0.864, -0.096 ], "point1": [ 21.261, -1.769, 67.695 ], "point2": [ 27.363, 8.920, 66.506 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///R/35", "nt2": "///R/65", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.208, -0.362, 0.042, 1.648, -10.305, -4.635 ], "step_params": [ -0.514, -1.886, 3.481, -1.475, 6.885, 34.605 ], "heli_params": [ -4.143, 0.627, 3.079, 11.428, 2.448, 35.292 ], "bp2_params": [ -0.173, 0.029, -0.107, -7.134, -14.941, -1.479 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.481, "simple_Twist": 34.228, "simple_hRise": 3.074, "simple_hTwist": 34.923 }, { "index": 2, "nt1": "///R/36", "nt2": "///R/64", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.173, 0.029, -0.107, -7.134, -14.941, -1.479 ], "step_params": [ 0.106, -1.625, 2.790, -3.513, 10.698, 25.152 ], "heli_params": [ -5.392, -0.871, 1.920, 23.143, 7.600, 27.521 ], "bp2_params": [ -2.308, -0.506, 0.016, -2.066, -16.395, 0.296 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.790, "simple_Twist": 36.757, "simple_hRise": 2.230, "simple_hTwist": 38.386 }, { "index": 3, "nt1": "///R/37", "nt2": "///R/63", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.308, -0.506, 0.016, -2.066, -16.395, 0.296 ], "step_params": [ -0.123, -1.447, 3.508, -1.808, 8.729, 40.453 ], "heli_params": [ -3.010, -0.025, 3.146, 12.441, 2.577, 41.383 ], "bp2_params": [ -0.217, -0.303, -0.066, -10.284, -17.737, -1.734 ], "groove_widths": [ 16.832, null, 14.015, null ], "simple_Rise": 3.508, "simple_Twist": 28.887, "simple_hRise": 2.957, "simple_hTwist": 30.203 }, { "index": 4, "nt1": "///R/38", "nt2": "///R/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.217, -0.303, -0.066, -10.284, -17.737, -1.734 ], "step_params": [ 0.049, -1.094, 3.363, -0.851, 8.233, 33.794 ], "heli_params": [ -3.075, -0.211, 3.019, 13.905, 1.437, 34.764 ], "bp2_params": [ -0.314, 0.012, 0.211, -15.304, -20.710, 1.009 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.363, "simple_Twist": 34.087, "simple_hRise": 3.023, "simple_hTwist": 35.048 }, { "index": 5, "nt1": "///R/39", "nt2": "///R/61", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.314, 0.012, 0.211, -15.304, -20.710, 1.009 ], "step_params": [ -0.019, -0.692, 2.939, 1.870, 4.113, 47.391 ], "heli_params": [ -1.151, 0.157, 2.870, 5.104, -2.320, 47.594 ], "bp2_params": [ 2.812, -0.738, 0.232, -3.523, -9.650, -6.070 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.939, "simple_Twist": 31.098, "simple_hRise": 2.821, "simple_hTwist": 31.417 }, { "index": 6, "nt1": "///R/40", "nt2": "///R/60", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 25, "helix_index": 13, "strand1": "CGGUUG", "strand2": "GCCAAC", "bp_type": "||||||", "helix_form": "A.AAA", "helical_rise": 3.132, "helical_rise_std": 0.419, "helical_radius": 9.315, "helical_radius_std": 0.515, "helical_axis": [ -0.517, -0.854, 0.058 ], "point1": [ 20.034, -3.981, 68.239 ], "point2": [ 11.814, -17.546, 69.162 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///R/66", "nt2": "///R/84", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.361, -0.220, 0.387, -7.269, -7.498, -9.769 ], "step_params": [ 0.855, -0.957, 2.993, 3.624, 15.113, 25.551 ], "heli_params": [ -4.558, -1.013, 2.196, 30.806, -7.388, 29.839 ], "bp2_params": [ -0.703, -0.239, -0.167, 1.676, -13.093, 0.676 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.993, "simple_Twist": 31.897, "simple_hRise": 2.392, "simple_hTwist": 35.393 }, { "index": 2, "nt1": "///R/67", "nt2": "///R/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.703, -0.239, -0.167, 1.676, -13.093, 0.676 ], "step_params": [ 0.733, -1.734, 3.521, -0.279, 5.200, 33.981 ], "heli_params": [ -3.778, -1.286, 3.223, 8.832, 0.473, 34.366 ], "bp2_params": [ -0.185, -0.106, 0.173, -5.876, -22.331, 4.717 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.521, "simple_Twist": 30.819, "simple_hRise": 3.186, "simple_hTwist": 31.245 }, { "index": 3, "nt1": "///R/68", "nt2": "///R/82", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.185, -0.106, 0.173, -5.876, -22.331, 4.717 ], "step_params": [ -1.232, -1.925, 3.142, 1.593, 1.294, 30.993 ], "heli_params": [ -3.828, 2.588, 2.996, 2.418, -2.977, 31.059 ], "bp2_params": [ -0.327, -0.174, -0.260, -3.302, -20.608, -3.916 ], "groove_widths": [ 15.905, null, 17.223, null ], "simple_Rise": 3.142, "simple_Twist": 31.895, "simple_hRise": 3.001, "simple_hTwist": 31.959 }, { "index": 4, "nt1": "///R/69", "nt2": "///R/81", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.327, -0.174, -0.260, -3.302, -20.608, -3.916 ], "step_params": [ 0.503, -0.979, 3.375, -1.994, 9.488, 33.911 ], "heli_params": [ -3.013, -1.125, 2.968, 15.868, 3.335, 35.230 ], "bp2_params": [ 0.258, -0.060, 0.226, -5.901, -12.260, 1.617 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.375, "simple_Twist": 30.922, "simple_hRise": 2.917, "simple_hTwist": 32.371 }, { "index": 5, "nt1": "///R/70", "nt2": "///R/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.258, -0.060, 0.226, -5.901, -12.260, 1.617 ], "step_params": [ 0.481, -1.364, 2.958, 0.306, 12.594, 26.255 ], "heli_params": [ -4.968, -0.904, 2.101, 25.913, -0.630, 29.073 ], "bp2_params": [ -0.132, -0.038, 0.314, 1.535, -7.519, 3.580 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.958, "simple_Twist": 28.361, "simple_hRise": 2.174, "simple_hTwist": 30.980 }, { "index": 6, "nt1": "///R/71", "nt2": "///R/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 26, "helix_index": 13, "strand1": "UCAUCA", "strand2": "AGUAGU", "bp_type": "||||||", "helix_form": "..AAA", "helical_rise": 2.343, "helical_rise_std": 0.224, "helical_radius": 9.313, "helical_radius_std": 0.754, "helical_axis": [ 0.568, 0.823, -0.003 ], "point1": [ 2.892, -28.877, 69.143 ], "point2": [ 9.437, -19.397, 69.114 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///R/73", "nt2": "///R/141", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.288, 0.439, -0.040, -2.868, -11.049, 1.316 ], "step_params": [ 0.477, -1.361, 3.055, -5.654, 0.744, 35.841 ], "heli_params": [ -2.281, -1.493, 2.921, 1.200, 9.116, 36.278 ], "bp2_params": [ -0.522, 0.113, 0.228, 6.381, -19.087, 7.568 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.055, "simple_Twist": 32.165, "simple_hRise": 2.900, "simple_hTwist": 32.654 }, { "index": 2, "nt1": "///R/74", "nt2": "///R/140", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.522, 0.113, 0.228, 6.381, -19.087, 7.568 ], "step_params": [ -0.546, -1.367, 3.084, -2.551, 12.373, 35.091 ], "heli_params": [ -3.591, 0.556, 2.509, 19.748, 4.071, 37.228 ], "bp2_params": [ -0.342, 0.192, 0.315, 4.273, -14.349, 3.296 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.084, "simple_Twist": 33.842, "simple_hRise": 2.482, "simple_hTwist": 36.058 }, { "index": 3, "nt1": "///R/75", "nt2": "///R/139", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.342, 0.192, 0.315, 4.273, -14.349, 3.296 ], "step_params": [ -0.522, -1.642, 3.074, -0.230, 9.096, 29.035 ], "heli_params": [ -4.712, 0.956, 2.462, 17.605, 0.445, 30.398 ], "bp2_params": [ -0.916, -0.015, -0.031, 7.968, -12.221, -5.659 ], "groove_widths": [ 17.412, null, 15.810, null ], "simple_Rise": 3.074, "simple_Twist": 32.147, "simple_hRise": 2.531, "simple_hTwist": 33.377 }, { "index": 4, "nt1": "///R/76", "nt2": "///R/138", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.916, -0.015, -0.031, 7.968, -12.221, -5.659 ], "step_params": [ 0.332, -1.496, 3.281, 2.779, 3.549, 37.218 ], "heli_params": [ -2.786, -0.158, 3.146, 5.535, -4.334, 37.480 ], "bp2_params": [ 0.166, 0.027, -0.157, 5.303, -14.968, -9.804 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.281, "simple_Twist": 31.595, "simple_hRise": 3.116, "simple_hTwist": 31.907 }, { "index": 5, "nt1": "///R/77", "nt2": "///R/137", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.166, 0.027, -0.157, 5.303, -14.968, -9.804 ], "step_params": [ 0.019, -1.676, 3.221, -1.310, 13.126, 29.375 ], "heli_params": [ -5.098, -0.241, 2.280, 24.394, 2.434, 32.141 ], "bp2_params": [ 0.225, -0.083, 0.245, 1.201, -10.971, -10.349 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.221, "simple_Twist": 28.647, "simple_hRise": 2.253, "simple_hTwist": 31.481 }, { "index": 6, "nt1": "///R/78", "nt2": "///R/136", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 27, "helix_index": 14, "strand1": "GCUUUUACU", "strand2": "UGAAAGUGG", "bp_type": "|||||||||", "helix_form": ".AAA..A.", "helical_rise": 2.745, "helical_rise_std": 0.178, "helical_radius": 9.020, "helical_radius_std": 0.390, "helical_axis": [ 0.119, 0.985, -0.123 ], "point1": [ -3.178, -8.519, 65.819 ], "point2": [ -0.571, 12.979, 63.141 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///R/88", "nt2": "///R/134", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.513, -0.395, -0.040, -5.850, -10.315, 5.977 ], "step_params": [ -0.761, -1.482, 3.328, -1.068, 1.771, 42.456 ], "heli_params": [ -2.225, 0.941, 3.283, 2.444, 1.474, 42.504 ], "bp2_params": [ 0.583, -0.031, 0.039, -5.493, -15.090, 2.634 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.328, "simple_Twist": 25.391, "simple_hRise": 3.247, "simple_hTwist": 25.474 }, { "index": 2, "nt1": "///R/89", "nt2": "///R/133", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.583, -0.031, 0.039, -5.493, -15.090, 2.634 ], "step_params": [ -0.331, -1.622, 3.002, 0.273, 9.192, 23.535 ], "heli_params": [ -5.927, 0.824, 2.216, 21.512, -0.640, 25.245 ], "bp2_params": [ -0.322, -0.129, -0.217, 5.784, -13.701, -2.169 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.002, "simple_Twist": 29.041, "simple_hRise": 2.385, "simple_hTwist": 30.433 }, { "index": 3, "nt1": "///R/90", "nt2": "///R/132", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.322, -0.129, -0.217, 5.784, -13.701, -2.169 ], "step_params": [ 0.153, -1.611, 3.421, -0.930, 9.190, 30.706 ], "heli_params": [ -4.537, -0.441, 2.827, 16.881, 1.709, 32.034 ], "bp2_params": [ -0.205, -0.009, -0.222, 0.091, -13.966, 1.507 ], "groove_widths": [ 17.061, null, 15.939, null ], "simple_Rise": 3.421, "simple_Twist": 29.877, "simple_hRise": 2.807, "simple_hTwist": 31.241 }, { "index": 4, "nt1": "///R/91", "nt2": "///R/131", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.205, -0.009, -0.222, 0.091, -13.966, 1.507 ], "step_params": [ 0.200, -1.432, 3.316, -0.565, 7.199, 35.217 ], "heli_params": [ -3.321, -0.403, 2.972, 11.747, 0.923, 35.926 ], "bp2_params": [ -0.137, -0.184, -0.139, -3.459, -15.490, -3.050 ], "groove_widths": [ 16.448, 15.139, 15.469, 12.932 ], "simple_Rise": 3.316, "simple_Twist": 34.627, "simple_hRise": 2.965, "simple_hTwist": 35.349 }, { "index": 5, "nt1": "///R/92", "nt2": "///R/130", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.137, -0.184, -0.139, -3.459, -15.490, -3.050 ], "step_params": [ 0.274, -1.235, 3.223, -1.778, 4.074, 42.255 ], "heli_params": [ -2.104, -0.553, 3.083, 5.632, 2.458, 42.478 ], "bp2_params": [ 2.536, -0.582, 0.321, -2.255, -9.389, 2.614 ], "groove_widths": [ 16.357, 15.026, 15.020, 12.212 ], "simple_Rise": 3.223, "simple_Twist": 27.378, "simple_hRise": 2.988, "simple_hTwist": 27.730 }, { "index": 6, "nt1": "///R/93", "nt2": "///R/129", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.536, -0.582, 0.321, -2.255, -9.389, 2.614 ], "step_params": [ -0.339, -1.530, 3.017, 5.232, 7.399, 26.100 ], "heli_params": [ -4.740, 1.794, 2.389, 15.790, -11.166, 27.603 ], "bp2_params": [ 0.110, -0.072, 0.100, -3.565, -18.325, 5.500 ], "groove_widths": [ 16.664, null, 15.056, null ], "simple_Rise": 3.017, "simple_Twist": 39.408, "simple_hRise": 2.635, "simple_hTwist": 40.396 }, { "index": 7, "nt1": "///R/94", "nt2": "///R/128", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.110, -0.072, 0.100, -3.565, -18.325, 5.500 ], "step_params": [ 0.424, -1.524, 3.149, 1.123, 4.544, 30.277 ], "heli_params": [ -3.721, -0.597, 2.908, 8.635, -2.134, 30.628 ], "bp2_params": [ 0.264, -0.265, 0.227, -0.021, -14.423, -2.240 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.149, "simple_Twist": 29.932, "simple_hRise": 2.905, "simple_hTwist": 30.288 }, { "index": 8, "nt1": "///R/95", "nt2": "///R/127", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.264, -0.265, 0.227, -0.021, -14.423, -2.240 ], "step_params": [ -0.254, -1.436, 3.290, 3.083, 7.337, 43.142 ], "heli_params": [ -2.599, 0.625, 2.995, 9.877, -4.150, 43.836 ], "bp2_params": [ 2.954, -0.703, 0.247, -0.924, -9.200, -0.683 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.290, "simple_Twist": 27.696, "simple_hRise": 2.782, "simple_hTwist": 28.795 }, { "index": 9, "nt1": "///R/96", "nt2": "///R/126", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 28, "helix_index": 15, "strand1": "CAUUAAG", "strand2": "GUGAUUC", "bp_type": "|||||||", "helix_form": "...AAA", "helical_rise": 2.758, "helical_rise_std": 0.300, "helical_radius": 9.441, "helical_radius_std": 0.586, "helical_axis": [ 0.494, 0.869, 0.017 ], "point1": [ 5.022, 36.863, 68.076 ], "point2": [ 13.205, 51.263, 68.362 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///R/102", "nt2": "///R/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.114, 0.155, -0.206, 18.996, -16.060, 3.986 ], "step_params": [ 0.634, -1.573, 3.265, -2.920, 19.903, 34.983 ], "heli_params": [ -4.270, -1.213, 2.057, 30.223, 4.434, 40.197 ], "bp2_params": [ -0.240, -0.058, 0.312, 3.928, -25.994, 7.286 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.265, "simple_Twist": 35.099, "simple_hRise": 2.062, "simple_hTwist": 40.297 }, { "index": 2, "nt1": "///R/103", "nt2": "///R/118", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.240, -0.058, 0.312, 3.928, -25.994, 7.286 ], "step_params": [ 0.029, -1.427, 3.368, 4.320, 2.193, 42.588 ], "heli_params": [ -2.175, 0.399, 3.282, 3.008, -5.925, 42.850 ], "bp2_params": [ 2.324, -0.446, -0.028, 0.509, -23.623, 0.598 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.368, "simple_Twist": 28.830, "simple_hRise": 3.223, "simple_hTwist": 29.225 }, { "index": 3, "nt1": "///R/104", "nt2": "///R/117", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.324, -0.446, -0.028, 0.509, -23.623, 0.598 ], "step_params": [ -1.105, -2.597, 3.318, -2.055, 10.691, 18.744 ], "heli_params": [ -10.422, 2.267, 1.709, 29.790, 5.727, 21.652 ], "bp2_params": [ -0.207, -0.152, 0.241, -9.204, -8.249, -5.230 ], "groove_widths": [ 16.200, null, 18.349, null ], "simple_Rise": 3.318, "simple_Twist": 32.300, "simple_hRise": 2.424, "simple_hTwist": 34.039 }, { "index": 4, "nt1": "///R/105", "nt2": "///R/116", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.207, -0.152, 0.241, -9.204, -8.249, -5.230 ], "step_params": [ 0.331, -1.137, 3.066, 3.004, 4.893, 35.319 ], "heli_params": [ -2.499, -0.141, 2.905, 7.999, -4.911, 35.768 ], "bp2_params": [ 0.673, 0.215, -0.010, -1.105, -16.409, 5.926 ], "groove_widths": [ 17.028, null, 16.772, null ], "simple_Rise": 3.066, "simple_Twist": 30.322, "simple_hRise": 2.870, "simple_hTwist": 30.849 }, { "index": 5, "nt1": "///R/106", "nt2": "///R/115", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.673, 0.215, -0.010, -1.105, -16.409, 5.926 ], "step_params": [ -0.101, -1.310, 2.784, -3.441, 0.655, 28.255 ], "heli_params": [ -2.791, -0.464, 2.747, 1.335, 7.014, 28.466 ], "bp2_params": [ -0.121, 0.041, 0.536, 14.262, -11.162, 0.533 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.784, "simple_Twist": 32.963, "simple_hRise": 2.755, "simple_hTwist": 33.143 }, { "index": 6, "nt1": "///R/107", "nt2": "///R/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.121, 0.041, 0.536, 14.262, -11.162, 0.533 ], "step_params": [ 0.621, -2.117, 3.458, 3.489, 10.553, 32.138 ], "heli_params": [ -5.262, -0.522, 2.699, 18.388, -6.080, 33.958 ], "bp2_params": [ -0.126, 0.268, 0.100, 3.327, -3.476, 5.795 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.458, "simple_Twist": 31.826, "simple_hRise": 2.690, "simple_hTwist": 33.664 }, { "index": 7, "nt1": "///R/108", "nt2": "///R/113", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 29, "helix_index": 16, "strand1": "CGCC", "strand2": "GCGG", "bp_type": "||||", "helix_form": "AAA", "helical_rise": 2.333, "helical_rise_std": 0.323, "helical_radius": 9.466, "helical_radius_std": 0.925, "helical_axis": [ 0.527, 0.797, -0.295 ], "point1": [ 17.567, 28.482, 93.302 ], "point2": [ 21.184, 33.959, 91.279 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///H/2", "nt2": "///S/56", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.058, -0.072, -0.060, 5.630, -10.195, 2.102 ], "step_params": [ -0.925, -1.752, 3.292, -3.803, 7.641, 29.917 ], "heli_params": [ -4.674, 1.026, 2.861, 14.436, 7.185, 31.084 ], "bp2_params": [ -0.493, -0.277, -0.215, 3.301, -8.565, 2.114 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.292, "simple_Twist": 32.310, "simple_hRise": 2.900, "simple_hTwist": 33.389 }, { "index": 2, "nt1": "///H/3", "nt2": "///S/55", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.493, -0.277, -0.215, 3.301, -8.565, 2.114 ], "step_params": [ -0.290, -1.472, 3.202, -1.865, 3.922, 33.528 ], "heli_params": [ -3.138, 0.211, 3.027, 6.763, 3.217, 33.800 ], "bp2_params": [ 0.471, -0.352, -0.234, 5.633, -17.089, 1.798 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.202, "simple_Twist": 28.498, "simple_hRise": 2.989, "simple_hTwist": 28.820 }, { "index": 3, "nt1": "///H/4", "nt2": "///S/54", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.471, -0.352, -0.234, 5.633, -17.089, 1.798 ], "step_params": [ -0.433, -1.577, 3.214, 4.614, 11.417, 25.456 ], "heli_params": [ -5.554, 1.826, 2.206, 24.187, -9.775, 28.234 ], "bp2_params": [ 0.175, -0.203, -0.842, 16.706, -8.533, -3.772 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.214, "simple_Twist": 27.336, "simple_hRise": 2.285, "simple_hTwist": 29.934 }, { "index": 4, "nt1": "///H/5", "nt2": "///S/53", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 30, "helix_index": 16, "strand1": "AACU", "strand2": "UUGA", "bp_type": "||||", "helix_form": "A.A", "helical_rise": 2.401, "helical_rise_std": 0.288, "helical_radius": 8.903, "helical_radius_std": 0.782, "helical_axis": [ 0.102, 0.961, 0.255 ], "point1": [ 16.447, 44.824, 89.946 ], "point2": [ 17.166, 51.610, 91.748 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///H/8", "nt2": "///S/26", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.130, -0.005, 0.265, 14.458, -16.646, -5.759 ], "step_params": [ 0.324, -1.171, 3.209, -1.216, 7.497, 29.317 ], "heli_params": [ -3.662, -0.851, 2.814, 14.508, 2.353, 30.264 ], "bp2_params": [ -0.276, 0.186, 0.228, 17.325, -20.219, 1.600 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.209, "simple_Twist": 30.913, "simple_hRise": 2.839, "simple_hTwist": 31.810 }, { "index": 2, "nt1": "///H/9", "nt2": "///S/25", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.276, 0.186, 0.228, 17.325, -20.219, 1.600 ], "step_params": [ 0.246, -1.497, 3.574, -2.545, 9.491, 41.473 ], "heli_params": [ -3.061, -0.607, 3.153, 13.180, 3.535, 42.571 ], "bp2_params": [ 0.483, -0.160, 0.456, -1.657, -19.944, 3.852 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.574, "simple_Twist": 36.434, "simple_hRise": 3.079, "simple_hTwist": 37.692 }, { "index": 3, "nt1": "///H/10", "nt2": "///S/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.483, -0.160, 0.456, -1.657, -19.944, 3.852 ], "step_params": [ -0.708, -1.919, 3.183, -0.043, 6.472, 26.214 ], "heli_params": [ -5.604, 1.507, 2.642, 13.999, 0.093, 26.987 ], "bp2_params": [ -0.530, 0.100, 0.413, -7.408, -13.546, -2.895 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.183, "simple_Twist": 31.595, "simple_hRise": 2.747, "simple_hTwist": 32.234 }, { "index": 4, "nt1": "///H/11", "nt2": "///S/23", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 31, "helix_index": 16, "strand1": "gGCACC", "strand2": "CCGUGG", "bp_type": "||||||", "helix_form": "A...A", "helical_rise": 2.800, "helical_rise_std": 0.238, "helical_radius": 9.107, "helical_radius_std": 0.455, "helical_axis": [ 0.024, 0.998, 0.060 ], "point1": [ 16.882, 55.466, 90.867 ], "point2": [ 17.218, 69.453, 91.707 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///S/12", "nt2": "///S/22", "bp": "g-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.113, -0.171, -0.001, -9.192, -16.452, -2.909 ], "step_params": [ 0.114, -1.621, 2.880, -3.472, 1.201, 34.015 ], "heli_params": [ -2.920, -0.671, 2.798, 2.045, 5.913, 34.206 ], "bp2_params": [ -1.310, 0.330, 0.517, -0.520, -20.165, 8.919 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.880, "simple_Twist": 35.010, "simple_hRise": 2.801, "simple_hTwist": 35.197 }, { "index": 2, "nt1": "///S/13", "nt2": "///S/21", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.310, 0.330, 0.517, -0.520, -20.165, 8.919 ], "step_params": [ 0.229, -1.132, 3.022, 3.721, -4.929, 39.615 ], "heli_params": [ -1.117, 0.068, 3.143, -7.219, -5.449, 40.075 ], "bp2_params": [ 0.752, 0.321, 0.381, 12.340, -24.417, 5.919 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.022, "simple_Twist": 29.600, "simple_hRise": 3.169, "simple_hTwist": 30.223 }, { "index": 3, "nt1": "///S/14", "nt2": "///S/20", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.752, 0.321, 0.381, 12.340, -24.417, 5.919 ], "step_params": [ -0.498, -1.328, 2.531, 0.881, 11.994, 22.022 ], "heli_params": [ -5.445, 1.323, 1.583, 28.799, -2.114, 25.056 ], "bp2_params": [ -1.701, 0.140, 0.474, 26.880, -18.977, -8.063 ], "groove_widths": [ 17.254, null, 15.256, null ], "simple_Rise": 2.531, "simple_Twist": 34.977, "simple_hRise": 1.972, "simple_hTwist": 36.926 }, { "index": 4, "nt1": "///S/15", "nt2": "///S/19", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.701, 0.140, 0.474, 26.880, -18.977, -8.063 ], "step_params": [ -0.449, -2.205, 3.663, 1.914, 12.281, 46.397 ], "heli_params": [ -3.721, 0.709, 3.001, 15.269, -2.380, 47.944 ], "bp2_params": [ 0.772, -0.283, -0.239, 8.838, -9.757, -13.643 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.663, "simple_Twist": 32.780, "simple_hRise": 2.661, "simple_hTwist": 34.997 }, { "index": 5, "nt1": "///S/16", "nt2": "///S/18", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.772, -0.283, -0.239, 8.838, -9.757, -13.643 ], "step_params": [ 0.692, -2.003, 3.410, -3.131, 9.994, 28.844 ], "heli_params": [ -5.629, -1.885, 2.505, 19.279, 6.040, 30.649 ], "bp2_params": [ 0.592, -0.218, 0.344, 3.489, 0.399, 2.461 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.410, "simple_Twist": 29.835, "simple_hRise": 2.539, "simple_hTwist": 31.581 }, { "index": 6, "nt1": "///S/17", "nt2": "///S/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 32, "helix_index": 17, "strand1": "CGA", "strand2": "GCU", "bp_type": "|||", "helix_form": "AA", "helical_rise": 3.991, "helical_rise_std": 0.266, "helical_radius": 9.076, "helical_radius_std": 0.244, "helical_axis": [ -0.431, -0.711, -0.556 ], "point1": [ 28.989, 25.086, 94.891 ], "point2": [ 25.447, 19.252, 90.328 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///S/29", "nt2": "///S/45", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.224, 0.003, 0.833, -15.872, 4.747, 2.590 ], "step_params": [ -0.448, -1.286, 2.954, 3.980, 3.283, 19.320 ], "heli_params": [ -5.019, 2.883, 2.558, 9.563, -11.594, 19.991 ], "bp2_params": [ -0.416, -0.177, 0.206, 0.631, -9.106, -4.744 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.954, "simple_Twist": 22.301, "simple_hRise": 2.621, "simple_hTwist": 22.883 }, { "index": 2, "nt1": "///S/30", "nt2": "///S/44", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.416, -0.177, 0.206, 0.631, -9.106, -4.744 ], "step_params": [ -0.433, -2.147, 3.203, -2.515, 1.104, 37.282 ], "heli_params": [ -3.492, 0.353, 3.162, 1.725, 3.927, 37.380 ], "bp2_params": [ -0.013, -0.095, -0.019, -0.777, -8.776, 0.429 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.203, "simple_Twist": 35.386, "simple_hRise": 3.159, "simple_hTwist": 35.489 }, { "index": 3, "nt1": "///S/31", "nt2": "///S/43", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 33, "helix_index": 18, "strand1": "GGGGUU", "strand2": "CCUCAG", "bp_type": "||||||", "helix_form": "AAAA.", "helical_rise": 2.384, "helical_rise_std": 0.173, "helical_radius": 8.485, "helical_radius_std": 0.735, "helical_axis": [ -0.182, 0.981, -0.068 ], "point1": [ 11.888, 2.389, 91.885 ], "point2": [ 9.756, 13.865, 91.089 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///S/35", "nt2": "///S/65", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.665, 0.107, 0.153, 8.454, -11.125, -14.111 ], "step_params": [ 0.035, -2.036, 3.374, -1.025, 9.434, 25.773 ], "heli_params": [ -6.445, -0.307, 2.484, 20.294, 2.206, 27.437 ], "bp2_params": [ -1.028, -0.344, 0.060, -2.052, -15.460, -0.622 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.374, "simple_Twist": 34.400, "simple_hRise": 2.736, "simple_hTwist": 35.647 }, { "index": 2, "nt1": "///S/36", "nt2": "///S/64", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.028, -0.344, 0.060, -2.052, -15.460, -0.622 ], "step_params": [ 0.053, -1.590, 2.891, -4.013, 6.850, 32.017 ], "heli_params": [ -3.774, -0.663, 2.483, 12.187, 7.140, 32.962 ], "bp2_params": [ -1.679, -0.225, 0.282, 1.548, -15.104, -3.516 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.891, "simple_Twist": 35.145, "simple_hRise": 2.526, "simple_hTwist": 36.003 }, { "index": 3, "nt1": "///S/37", "nt2": "///S/63", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.679, -0.225, 0.282, 1.548, -15.104, -3.516 ], "step_params": [ 0.265, -1.138, 3.654, 1.306, 12.216, 39.540 ], "heli_params": [ -3.017, -0.225, 3.188, 17.550, -1.876, 41.332 ], "bp2_params": [ 0.306, 0.082, -0.110, -12.123, -22.933, 4.160 ], "groove_widths": [ 17.076, null, 14.196, null ], "simple_Rise": 3.654, "simple_Twist": 28.601, "simple_hRise": 2.942, "simple_hTwist": 31.077 }, { "index": 4, "nt1": "///S/38", "nt2": "///S/62", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.306, 0.082, -0.110, -12.123, -22.933, 4.160 ], "step_params": [ 0.103, -0.992, 3.057, -2.150, 9.236, 31.721 ], "heli_params": [ -3.136, -0.506, 2.659, 16.443, 3.828, 33.073 ], "bp2_params": [ -0.009, 0.136, 0.251, -11.147, -22.492, 6.122 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.057, "simple_Twist": 33.580, "simple_hRise": 2.687, "simple_hTwist": 34.857 }, { "index": 5, "nt1": "///S/39", "nt2": "///S/61", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.009, 0.136, 0.251, -11.147, -22.492, 6.122 ], "step_params": [ -0.349, -0.846, 3.234, -2.331, 5.650, 44.938 ], "heli_params": [ -1.588, 0.251, 3.124, 7.351, 3.033, 45.330 ], "bp2_params": [ 2.438, -0.412, 0.850, -10.172, -8.204, -7.086 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.234, "simple_Twist": 32.197, "simple_hRise": 3.062, "simple_hTwist": 32.757 }, { "index": 6, "nt1": "///S/40", "nt2": "///S/60", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 34, "helix_index": 18, "strand1": "CGGUUG", "strand2": "GCCAAC", "bp_type": "||||||", "helix_form": "...AA", "helical_rise": 3.031, "helical_rise_std": 0.493, "helical_radius": 9.449, "helical_radius_std": 0.750, "helical_axis": [ 0.167, -0.984, 0.068 ], "point1": [ 12.679, -0.545, 93.337 ], "point2": [ 15.243, -15.671, 94.383 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///S/66", "nt2": "///S/84", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.355, 0.061, 0.314, -10.305, -19.643, 7.756 ], "step_params": [ 0.259, -1.416, 2.844, -7.993, 5.390, 29.599 ], "heli_params": [ -3.491, -1.743, 2.405, 10.215, 15.147, 31.096 ], "bp2_params": [ -0.901, -0.111, 0.821, 4.479, -2.029, 2.350 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.844, "simple_Twist": 36.721, "simple_hRise": 2.510, "simple_hTwist": 37.924 }, { "index": 2, "nt1": "///S/67", "nt2": "///S/83", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.901, -0.111, 0.821, 4.479, -2.029, 2.350 ], "step_params": [ 0.894, -2.017, 3.394, 9.207, 2.745, 35.598 ], "heli_params": [ -3.583, -0.102, 3.355, 4.393, -14.731, 36.831 ], "bp2_params": [ 0.310, 0.454, 0.296, -4.230, -17.988, 7.973 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.394, "simple_Twist": 28.834, "simple_hRise": 3.314, "simple_hTwist": 30.360 }, { "index": 3, "nt1": "///S/68", "nt2": "///S/82", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.310, 0.454, 0.296, -4.230, -17.988, 7.973 ], "step_params": [ -1.649, -2.802, 3.337, -1.984, 3.712, 23.465 ], "heli_params": [ -7.970, 3.360, 2.992, 9.035, 4.829, 23.835 ], "bp2_params": [ -0.987, 0.567, 0.091, -13.351, -5.051, -7.912 ], "groove_widths": [ 15.868, null, 18.533, null ], "simple_Rise": 3.337, "simple_Twist": 30.202, "simple_hRise": 3.079, "simple_hTwist": 30.488 }, { "index": 4, "nt1": "///S/69", "nt2": "///S/81", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.987, 0.567, 0.091, -13.351, -5.051, -7.912 ], "step_params": [ 0.251, -1.476, 2.794, -3.577, 3.148, 34.987 ], "heli_params": [ -2.822, -0.853, 2.618, 5.206, 5.916, 35.300 ], "bp2_params": [ 0.055, 0.276, 0.159, 3.460, -2.642, 0.325 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.794, "simple_Twist": 29.963, "simple_hRise": 2.583, "simple_hTwist": 30.331 }, { "index": 5, "nt1": "///S/70", "nt2": "///S/80", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.055, 0.276, 0.159, 3.460, -2.642, 0.325 ], "step_params": [ 0.988, -1.617, 2.866, 4.176, 18.503, 35.659 ], "heli_params": [ -3.991, -1.066, 1.930, 27.916, -6.301, 40.245 ], "bp2_params": [ 0.194, 0.493, 0.027, -1.556, -13.961, 8.060 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.866, "simple_Twist": 34.685, "simple_hRise": 1.900, "simple_hTwist": 39.392 }, { "index": 6, "nt1": "///S/71", "nt2": "///S/79", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 35, "helix_index": 18, "strand1": "UCAUCA", "strand2": "AGUAGU", "bp_type": "||||||", "helix_form": ".....", "helical_rise": 2.298, "helical_rise_std": 0.143, "helical_radius": 9.411, "helical_radius_std": 1.311, "helical_axis": [ -0.311, 0.937, -0.157 ], "point1": [ 20.100, -28.648, 95.372 ], "point2": [ 16.547, -17.943, 93.576 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///S/73", "nt2": "///S/141", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.409, 0.725, 0.875, -29.932, -14.999, 7.124 ], "step_params": [ 1.185, -1.275, 2.279, -2.375, 5.752, 24.181 ], "heli_params": [ -4.040, -3.193, 1.808, 13.447, 5.553, 24.957 ], "bp2_params": [ -0.990, 0.593, 0.907, 3.636, -23.723, 20.728 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.279, "simple_Twist": 32.797, "simple_hRise": 1.945, "simple_hTwist": 33.367 }, { "index": 2, "nt1": "///S/74", "nt2": "///S/140", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.990, 0.593, 0.907, 3.636, -23.723, 20.728 ], "step_params": [ -1.260, -1.422, 3.118, -10.039, 13.949, 31.276 ], "heli_params": [ -4.211, 0.705, 2.553, 23.761, 17.101, 35.583 ], "bp2_params": [ -1.502, -0.143, 1.151, 1.630, -7.312, -15.872 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.118, "simple_Twist": 32.732, "simple_hRise": 2.589, "simple_hTwist": 36.860 }, { "index": 3, "nt1": "///S/75", "nt2": "///S/139", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.502, -0.143, 1.151, 1.630, -7.312, -15.872 ], "step_params": [ 0.693, -1.557, 3.563, 2.606, 15.246, 47.955 ], "heli_params": [ -2.961, -0.623, 3.000, 18.214, -3.113, 50.247 ], "bp2_params": [ 1.125, 0.282, 1.021, -6.381, -19.291, 13.467 ], "groove_widths": [ 18.379, null, 16.401, null ], "simple_Rise": 3.563, "simple_Twist": 34.383, "simple_hRise": 2.702, "simple_hTwist": 37.605 }, { "index": 4, "nt1": "///S/76", "nt2": "///S/138", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.125, 0.282, 1.021, -6.381, -19.291, 13.467 ], "step_params": [ -0.517, -1.361, 2.779, -0.846, 2.951, 31.808 ], "heli_params": [ -2.918, 0.812, 2.658, 5.368, 1.538, 31.952 ], "bp2_params": [ 0.837, -0.023, 0.943, 9.399, -17.070, -0.320 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.779, "simple_Twist": 34.106, "simple_hRise": 2.667, "simple_hTwist": 34.240 }, { "index": 5, "nt1": "///S/77", "nt2": "///S/137", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.837, -0.023, 0.943, 9.399, -17.070, -0.320 ], "step_params": [ -0.334, -1.468, 2.989, 8.112, 9.337, 22.414 ], "heli_params": [ -5.479, 2.632, 1.992, 21.999, -19.112, 25.562 ], "bp2_params": [ 0.361, 0.439, -0.200, 15.538, -14.451, -13.532 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.989, "simple_Twist": 24.961, "simple_hRise": 2.106, "simple_hTwist": 27.814 }, { "index": 6, "nt1": "///S/78", "nt2": "///S/136", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 36, "helix_index": 19, "strand1": "GCUUUUACU", "strand2": "UGAAAGUGG", "bp_type": "|||||||||", "helix_form": "......A.", "helical_rise": 2.619, "helical_rise_std": 0.303, "helical_radius": 9.321, "helical_radius_std": 0.539, "helical_axis": [ 0.224, 0.974, -0.021 ], "point1": [ 33.114, -11.909, 95.612 ], "point2": [ 37.762, 8.343, 95.181 ], "num_pairs": 9, "pairs": [ { "index": 1, "nt1": "///S/88", "nt2": "///S/134", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.285, -0.473, 1.589, 16.749, -0.883, -8.465 ], "step_params": [ 0.403, -1.760, 3.395, 12.428, 3.923, 43.802 ], "heli_params": [ -2.627, 0.607, 3.228, 5.126, -16.236, 45.608 ], "bp2_params": [ 1.168, 0.052, -0.033, 11.198, -13.166, -6.496 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.395, "simple_Twist": 31.448, "simple_hRise": 3.094, "simple_hTwist": 33.979 }, { "index": 2, "nt1": "///S/89", "nt2": "///S/133", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.168, 0.052, -0.033, 11.198, -13.166, -6.496 ], "step_params": [ -0.987, -2.277, 3.168, 4.884, 9.967, 30.938 ], "heli_params": [ -5.470, 2.452, 2.173, 17.973, -8.807, 32.823 ], "bp2_params": [ 1.510, -0.030, -0.763, 12.659, -8.801, -5.767 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.168, "simple_Twist": 29.024, "simple_hRise": 2.100, "simple_hTwist": 31.031 }, { "index": 3, "nt1": "///S/90", "nt2": "///S/132", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.510, -0.030, -0.763, 12.659, -8.801, -5.767 ], "step_params": [ 1.890, -1.923, 3.213, -3.570, 4.904, 20.919 ], "heli_params": [ -6.765, -6.222, 2.354, 13.154, 9.577, 21.771 ], "bp2_params": [ -1.165, 0.787, 0.021, 14.456, -5.975, 13.838 ], "groove_widths": [ 16.918, null, 17.108, null ], "simple_Rise": 3.213, "simple_Twist": 34.883, "simple_hRise": 2.726, "simple_hTwist": 35.391 }, { "index": 4, "nt1": "///S/91", "nt2": "///S/131", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.165, 0.787, 0.021, 14.456, -5.975, 13.838 ], "step_params": [ -0.619, -2.137, 3.460, 11.939, 8.817, 35.773 ], "heli_params": [ -4.271, 2.345, 2.555, 13.651, -18.486, 38.636 ], "bp2_params": [ 0.574, 0.247, -1.602, 5.750, -21.549, -22.418 ], "groove_widths": [ 16.363, 14.837, 16.853, 13.466 ], "simple_Rise": 3.460, "simple_Twist": 26.884, "simple_hRise": 2.203, "simple_hTwist": 30.642 }, { "index": 5, "nt1": "///S/92", "nt2": "///S/130", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.574, 0.247, -1.602, 5.750, -21.549, -22.418 ], "step_params": [ 2.100, -2.012, 3.869, -9.140, 9.145, 36.956 ], "heli_params": [ -4.154, -4.284, 2.738, 13.915, 13.906, 39.078 ], "bp2_params": [ 1.917, 0.341, 1.094, -21.826, -9.953, 15.216 ], "groove_widths": [ 16.620, 14.845, 16.653, 12.754 ], "simple_Rise": 3.869, "simple_Twist": 28.464, "simple_hRise": 2.356, "simple_hTwist": 31.208 }, { "index": 6, "nt1": "///S/93", "nt2": "///S/129", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.917, 0.341, 1.094, -21.826, -9.953, 15.216 ], "step_params": [ -0.889, -1.395, 2.124, 11.465, 16.550, 24.909 ], "heli_params": [ -3.973, 2.612, 0.640, 32.438, -22.470, 31.928 ], "bp2_params": [ -0.905, 0.069, -0.172, -0.486, -15.188, -2.029 ], "groove_widths": [ 17.448, null, 17.317, null ], "simple_Rise": 2.124, "simple_Twist": 40.455, "simple_hRise": 1.211, "simple_hTwist": 44.999 }, { "index": 7, "nt1": "///S/94", "nt2": "///S/128", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.905, 0.069, -0.172, -0.486, -15.188, -2.029 ], "step_params": [ 0.565, -1.134, 3.132, 4.164, -0.479, 36.807 ], "heli_params": [ -1.723, -0.348, 3.189, -0.756, -6.569, 37.036 ], "bp2_params": [ 0.152, 0.039, -0.628, 13.253, -18.039, 5.391 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.132, "simple_Twist": 31.836, "simple_hRise": 3.194, "simple_hTwist": 32.104 }, { "index": 8, "nt1": "///S/95", "nt2": "///S/127", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.152, 0.039, -0.628, 13.253, -18.039, 5.391 ], "step_params": [ -0.075, -1.251, 3.854, -2.579, 9.183, 36.855 ], "heli_params": [ -3.246, -0.258, 3.452, 14.234, 3.998, 38.028 ], "bp2_params": [ 2.089, -0.331, -0.050, -2.503, -9.815, -1.210 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.854, "simple_Twist": 26.324, "simple_hRise": 3.234, "simple_hTwist": 27.970 }, { "index": 9, "nt1": "///S/96", "nt2": "///S/126", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 37, "helix_index": 20, "strand1": "CAUUAAG", "strand2": "GUGAUUC", "bp_type": "|||||||", "helix_form": "A...AA", "helical_rise": 2.861, "helical_rise_std": 0.423, "helical_radius": 9.684, "helical_radius_std": 0.712, "helical_axis": [ -0.191, 0.971, -0.145 ], "point1": [ 40.725, 31.420, 85.368 ], "point2": [ 37.446, 48.124, 82.874 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///S/102", "nt2": "///S/119", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.270, -0.086, -0.077, 11.849, -13.545, -2.520 ], "step_params": [ 0.420, -1.666, 3.354, -0.843, 18.506, 32.452 ], "heli_params": [ -4.818, -0.759, 2.121, 30.238, 1.378, 37.244 ], "bp2_params": [ -0.196, -0.103, -0.025, 0.355, -23.691, 2.172 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.354, "simple_Twist": 34.661, "simple_hRise": 2.210, "simple_hTwist": 39.167 }, { "index": 2, "nt1": "///S/103", "nt2": "///S/118", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.196, -0.103, -0.025, 0.355, -23.691, 2.172 ], "step_params": [ 0.476, -1.247, 3.520, 1.972, 4.213, 46.493 ], "heli_params": [ -1.946, -0.425, 3.417, 5.321, -2.491, 46.712 ], "bp2_params": [ 2.987, -0.449, 0.081, -7.396, -23.923, 12.552 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.520, "simple_Twist": 28.203, "simple_hRise": 3.327, "simple_hTwist": 28.576 }, { "index": 3, "nt1": "///S/104", "nt2": "///S/117", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.987, -0.449, 0.081, -7.396, -23.923, 12.552 ], "step_params": [ -1.091, -2.139, 2.865, 4.670, 10.900, 14.740 ], "heli_params": [ -10.053, 4.840, 0.744, 35.843, -15.357, 18.897 ], "bp2_params": [ 0.047, -0.128, -0.491, 2.480, 2.770, -3.581 ], "groove_widths": [ 16.015, null, 18.433, null ], "simple_Rise": 2.865, "simple_Twist": 31.682, "simple_hRise": 1.873, "simple_hTwist": 33.775 }, { "index": 4, "nt1": "///S/105", "nt2": "///S/116", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.047, -0.128, -0.491, 2.480, 2.770, -3.581 ], "step_params": [ -0.536, -1.266, 3.445, -3.842, 3.939, 32.203 ], "heli_params": [ -2.962, 0.260, 3.311, 7.037, 6.864, 32.658 ], "bp2_params": [ 0.167, 0.081, -0.273, -1.445, -9.348, -0.591 ], "groove_widths": [ 17.008, null, 18.065, null ], "simple_Rise": 3.445, "simple_Twist": 31.093, "simple_hRise": 3.304, "simple_hTwist": 31.564 }, { "index": 5, "nt1": "///S/106", "nt2": "///S/115", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.167, 0.081, -0.273, -1.445, -9.348, -0.591 ], "step_params": [ 0.337, -1.458, 3.001, -1.138, 3.531, 28.928 ], "heli_params": [ -3.581, -0.891, 2.792, 7.032, 2.267, 29.160 ], "bp2_params": [ -0.572, 0.001, 0.229, 10.171, -13.734, 8.159 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.001, "simple_Twist": 33.734, "simple_hRise": 2.826, "simple_hTwist": 33.931 }, { "index": 6, "nt1": "///S/107", "nt2": "///S/114", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.572, 0.001, 0.229, 10.171, -13.734, 8.159 ], "step_params": [ 0.104, -1.949, 3.461, -0.293, 6.768, 30.107 ], "heli_params": [ -4.974, -0.252, 2.962, 12.826, 0.555, 30.842 ], "bp2_params": [ -0.682, -0.126, -0.085, 2.196, -3.860, -1.924 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.461, "simple_Twist": 30.166, "simple_hRise": 2.963, "simple_hTwist": 30.900 }, { "index": 7, "nt1": "///S/108", "nt2": "///S/113", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 4, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///E/7", "nt2": "///P/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -2, "helix_index": 6, "nt1": "///F/7", "nt2": "///Q/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -3, "helix_index": 11, "nt1": "///G/7", "nt2": "///R/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" }, { "index": -4, "helix_index": 16, "nt1": "///H/7", "nt2": "///S/52", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 9, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 3, "stem_indices": [ 1, 2, 3 ] }, { "index": 2, "helix_index": 3, "num_stems": 3, "stem_indices": [ 5, 6, 7 ] }, { "index": 3, "helix_index": 4, "num_stems": 2, "stem_indices": [ 8, 9 ] }, { "index": 4, "helix_index": 6, "num_stems": 3, "stem_indices": [ 11, 12, 13 ] }, { "index": 5, "helix_index": 8, "num_stems": 3, "stem_indices": [ 15, 16, 17 ] }, { "index": 6, "helix_index": 11, "num_stems": 3, "stem_indices": [ 20, 21, 22 ] }, { "index": 7, "helix_index": 13, "num_stems": 3, "stem_indices": [ 24, 25, 26 ] }, { "index": 8, "helix_index": 16, "num_stems": 3, "stem_indices": [ 29, 30, 31 ] }, { "index": 9, "helix_index": 18, "num_stems": 3, "stem_indices": [ 33, 34, 35 ] } ], "num_stacks": 94, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "Aa", "nts_long": "///E/-1,///F/0" }, { "index": 2, "num_nts": 2, "nts_short": "aA", "nts_long": "///E/0,///F/-1" }, { "index": 3, "num_nts": 2, "nts_short": "GA", "nts_long": "///E/7,///E/8" }, { "index": 4, "num_nts": 2, "nts_short": "gA", "nts_long": "///P/12,///P/23" }, { "index": 5, "num_nts": 2, "nts_short": "CY", "nts_long": "///P/17,///A/13" }, { "index": 6, "num_nts": 2, "nts_short": "GG", "nts_long": "///P/35,///P/84" }, { "index": 7, "num_nts": 2, "nts_short": "CC", "nts_long": "///P/65,///P/66" }, { "index": 8, "num_nts": 2, "nts_short": "GU", "nts_long": "///P/71,///P/136" }, { "index": 9, "num_nts": 2, "nts_short": "AC", "nts_long": "///P/78,///P/79" }, { "index": 10, "num_nts": 2, "nts_short": "AA", "nts_long": "///P/86,///P/87" }, { "index": 11, "num_nts": 2, "nts_short": "GG", "nts_long": "///P/108,///P/109" }, { "index": 12, "num_nts": 2, "nts_short": "AA", "nts_long": "///P/130,///P/131" }, { "index": 13, "num_nts": 2, "nts_short": "gA", "nts_long": "///Q/12,///Q/23" }, { "index": 14, "num_nts": 2, "nts_short": "CY", "nts_long": "///Q/17,///B/13" }, { "index": 15, "num_nts": 2, "nts_short": "CC", "nts_long": "///Q/17,///Q/17" }, { "index": 16, "num_nts": 2, "nts_short": "GG", "nts_long": "///Q/35,///Q/84" }, { "index": 17, "num_nts": 2, "nts_short": "GA", "nts_long": "///Q/45,///Q/46" }, { "index": 18, "num_nts": 2, "nts_short": "UC", "nts_long": "///Q/50,///Q/52" }, { "index": 19, "num_nts": 2, "nts_short": "CC", "nts_long": "///Q/65,///Q/66" }, { "index": 20, "num_nts": 2, "nts_short": "GU", "nts_long": "///Q/71,///Q/136" }, { "index": 21, "num_nts": 2, "nts_short": "AC", "nts_long": "///Q/78,///Q/79" }, { "index": 22, "num_nts": 2, "nts_short": "AA", "nts_long": "///Q/86,///Q/87" }, { "index": 23, "num_nts": 2, "nts_short": "GG", "nts_long": "///Q/88,///Q/135" }, { "index": 24, "num_nts": 2, "nts_short": "GG", "nts_long": "///Q/108,///Q/109" }, { "index": 25, "num_nts": 2, "nts_short": "Aa", "nts_long": "///G/-1,///H/0" }, { "index": 26, "num_nts": 2, "nts_short": "aA", "nts_long": "///G/0,///H/-1" }, { "index": 27, "num_nts": 2, "nts_short": "GA", "nts_long": "///G/1,///R/28" }, { "index": 28, "num_nts": 2, "nts_short": "gA", "nts_long": "///R/12,///R/23" }, { "index": 29, "num_nts": 2, "nts_short": "CY", "nts_long": "///R/17,///C/13" }, { "index": 30, "num_nts": 2, "nts_short": "CC", "nts_long": "///R/17,///R/17" }, { "index": 31, "num_nts": 2, "nts_short": "GG", "nts_long": "///R/35,///R/84" }, { "index": 32, "num_nts": 2, "nts_short": "UC", "nts_long": "///R/50,///R/52" }, { "index": 33, "num_nts": 2, "nts_short": "CC", "nts_long": "///R/65,///R/66" }, { "index": 34, "num_nts": 2, "nts_short": "GU", "nts_long": "///R/71,///R/136" }, { "index": 35, "num_nts": 2, "nts_short": "AC", "nts_long": "///R/78,///R/79" }, { "index": 36, "num_nts": 2, "nts_short": "AA", "nts_long": "///R/86,///R/87" }, { "index": 37, "num_nts": 2, "nts_short": "GG", "nts_long": "///R/88,///R/135" }, { "index": 38, "num_nts": 2, "nts_short": "GG", "nts_long": "///R/108,///R/109" }, { "index": 39, "num_nts": 2, "nts_short": "GA", "nts_long": "///H/1,///S/28" }, { "index": 40, "num_nts": 2, "nts_short": "gA", "nts_long": "///S/12,///S/23" }, { "index": 41, "num_nts": 2, "nts_short": "CY", "nts_long": "///S/17,///D/13" }, { "index": 42, "num_nts": 2, "nts_short": "CC", "nts_long": "///S/17,///S/17" }, { "index": 43, "num_nts": 2, "nts_short": "GG", "nts_long": "///S/35,///S/84" }, { "index": 44, "num_nts": 2, "nts_short": "UC", "nts_long": "///S/50,///S/52" }, { "index": 45, "num_nts": 2, "nts_short": "CC", "nts_long": "///S/65,///S/66" }, { "index": 46, "num_nts": 2, "nts_short": "GU", "nts_long": "///S/71,///S/136" }, { "index": 47, "num_nts": 2, "nts_short": "AC", "nts_long": "///S/78,///S/79" }, { "index": 48, "num_nts": 2, "nts_short": "GG", "nts_long": "///S/88,///S/135" }, { "index": 49, "num_nts": 2, "nts_short": "GG", "nts_long": "///S/108,///S/109" }, { "index": 50, "num_nts": 3, "nts_short": "CGU", "nts_long": "///E/5,///P/27,///P/26" }, { "index": 51, "num_nts": 3, "nts_short": "CAU", "nts_long": "///P/17,///P/17,///P/17" }, { "index": 52, "num_nts": 3, "nts_short": "UGQ", "nts_long": "///P/17,///P/17,///A/54" }, { "index": 53, "num_nts": 3, "nts_short": "UCG", "nts_long": "///P/50,///P/52,///P/53" }, { "index": 54, "num_nts": 3, "nts_short": "CGG", "nts_long": "///P/89,///P/88,///P/135" }, { "index": 55, "num_nts": 3, "nts_short": "UGA", "nts_long": "///P/110,///P/111,///P/112" }, { "index": 56, "num_nts": 3, "nts_short": "CGU", "nts_long": "///F/5,///Q/27,///Q/26" }, { "index": 57, "num_nts": 3, "nts_short": "AGG", "nts_long": "///F/8,///F/7,///Q/53" }, { "index": 58, "num_nts": 3, "nts_short": "CAU", "nts_long": "///Q/17,///Q/17,///Q/17" }, { "index": 59, "num_nts": 3, "nts_short": "UGQ", "nts_long": "///Q/17,///Q/17,///B/54" }, { "index": 60, "num_nts": 3, "nts_short": "UGA", "nts_long": "///Q/110,///Q/111,///Q/112" }, { "index": 61, "num_nts": 3, "nts_short": "CGU", "nts_long": "///G/5,///R/27,///R/26" }, { "index": 62, "num_nts": 3, "nts_short": "AGG", "nts_long": "///G/8,///G/7,///R/53" }, { "index": 63, "num_nts": 3, "nts_short": "CAU", "nts_long": "///R/17,///R/17,///R/17" }, { "index": 64, "num_nts": 3, "nts_short": "UGQ", "nts_long": "///R/17,///R/17,///C/54" }, { "index": 65, "num_nts": 3, "nts_short": "CAF", "nts_long": "///R/17,///R/17,///C/56" }, { "index": 66, "num_nts": 3, "nts_short": "UGA", "nts_long": "///R/110,///R/111,///R/112" }, { "index": 67, "num_nts": 3, "nts_short": "CGU", "nts_long": "///H/5,///S/27,///S/26" }, { "index": 68, "num_nts": 3, "nts_short": "AGG", "nts_long": "///H/8,///H/7,///S/53" }, { "index": 69, "num_nts": 3, "nts_short": "CAU", "nts_long": "///S/17,///S/17,///S/17" }, { "index": 70, "num_nts": 3, "nts_short": "UGQ", "nts_long": "///S/17,///S/17,///D/54" }, { "index": 71, "num_nts": 3, "nts_short": "CAF", "nts_long": "///S/17,///S/17,///D/56" }, { "index": 72, "num_nts": 3, "nts_short": "CAA", "nts_long": "///S/85,///S/86,///S/87" }, { "index": 73, "num_nts": 3, "nts_short": "UGA", "nts_long": "///S/110,///S/111,///S/112" }, { "index": 74, "num_nts": 4, "nts_short": "GAGA", "nts_long": "///P/45,///P/46,///P/47,///P/48" }, { "index": 75, "num_nts": 4, "nts_short": "GGAC", "nts_long": "///P/119,///P/120,///P/121,///P/122" }, { "index": 76, "num_nts": 4, "nts_short": "GGAC", "nts_long": "///Q/119,///Q/120,///Q/121,///Q/122" }, { "index": 77, "num_nts": 4, "nts_short": "GGAC", "nts_long": "///R/119,///R/120,///R/121,///R/122" }, { "index": 78, "num_nts": 4, "nts_short": "GAGA", "nts_long": "///S/45,///S/46,///S/47,///S/48" }, { "index": 79, "num_nts": 4, "nts_short": "GGAC", "nts_long": "///S/119,///S/120,///S/121,///S/122" }, { "index": 80, "num_nts": 4, "nts_short": "FACD", "nts_long": "///A/56,///P/17,///P/17,///A/92" }, { "index": 81, "num_nts": 4, "nts_short": "FACD", "nts_long": "///B/56,///Q/17,///Q/17,///B/92" }, { "index": 82, "num_nts": 5, "nts_short": "AGGUU", "nts_long": "///P/31,///P/32,///P/33,///P/59,///P/34" }, { "index": 83, "num_nts": 5, "nts_short": "GGAAG", "nts_long": "///P/56,///P/57,///P/58,///P/42,///P/60" }, { "index": 84, "num_nts": 5, "nts_short": "AGGUU", "nts_long": "///Q/31,///Q/32,///Q/33,///Q/59,///Q/34" }, { "index": 85, "num_nts": 5, "nts_short": "GGAAG", "nts_long": "///Q/56,///Q/57,///Q/58,///Q/42,///Q/60" }, { "index": 86, "num_nts": 5, "nts_short": "AGGUU", "nts_long": "///R/31,///R/32,///R/33,///R/59,///R/34" }, { "index": 87, "num_nts": 5, "nts_short": "GGAAG", "nts_long": "///R/56,///R/57,///R/58,///R/42,///R/60" }, { "index": 88, "num_nts": 5, "nts_short": "AGGUU", "nts_long": "///S/31,///S/32,///S/33,///S/59,///S/34" }, { "index": 89, "num_nts": 5, "nts_short": "GGAAG", "nts_long": "///S/56,///S/57,///S/58,///S/42,///S/60" }, { "index": 90, "num_nts": 9, "nts_short": "CUAAAAAAG", "nts_long": "///P/102,///P/101,///P/100,///P/99,///P/98,///P/123,///P/124,///P/125,///P/126" }, { "index": 91, "num_nts": 9, "nts_short": "GAUGAAGAG", "nts_long": "///F/1,///Q/28,///Q/51,///Q/47,///Q/48,///R/48,///R/47,///R/46,///R/45" }, { "index": 92, "num_nts": 9, "nts_short": "CUAAAAAAG", "nts_long": "///Q/102,///Q/101,///Q/100,///Q/99,///Q/98,///Q/123,///Q/124,///Q/125,///Q/126" }, { "index": 93, "num_nts": 9, "nts_short": "CUAAAAAAG", "nts_long": "///R/102,///R/101,///R/100,///R/99,///R/98,///R/123,///R/124,///R/125,///R/126" }, { "index": 94, "num_nts": 9, "nts_short": "CUAAAAAAG", "nts_long": "///S/102,///S/101,///S/100,///S/99,///S/98,///S/123,///S/124,///S/125,///S/126" } ], "nonStack": { "num_nts": 26, "nts_short": "CAUUUUUUAUUUUUAUUUUUUCUUUU", "nts_long": "///P/17,///P/28,///P/41,///P/43,///P/49,///P/72,///P/92,///P/97,///F/6,///Q/17,///Q/41,///Q/43,///Q/72,///Q/97,///G/6,///R/17,///R/41,///R/43,///R/49,///R/72,///R/97,///R/113,///S/41,///S/43,///S/72,///S/97" }, "num_atom2bases": 22, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///P/17/O4'", "nt": "///P/17", "vert_dist": 2.880 }, { "index": 2, "type": "sugar", "atom": "///P/69/O4'", "nt": "///P/87", "vert_dist": 2.875 }, { "index": 3, "type": "sugar", "atom": "///P/69/O2'", "nt": "///P/87", "vert_dist": 3.322 }, { "index": 4, "type": "phosphate", "atom": "///P/111/OP2", "nt": "///P/109", "vert_dist": 3.102 }, { "index": 5, "type": "sugar", "atom": "///Q/17/O4'", "nt": "///Q/17", "vert_dist": 2.852 }, { "index": 6, "type": "sugar", "atom": "///Q/51/O4'", "nt": "///Q/28", "vert_dist": 3.382 }, { "index": 7, "type": "sugar", "atom": "///Q/85/O4'", "nt": "///Q/86", "vert_dist": 3.307 }, { "index": 8, "type": "sugar", "atom": "///Q/69/O4'", "nt": "///Q/87", "vert_dist": 2.852 }, { "index": 9, "type": "phosphate", "atom": "///Q/111/OP2", "nt": "///Q/109", "vert_dist": 3.178 }, { "index": 10, "type": "sugar", "atom": "///R/17/O4'", "nt": "///R/17", "vert_dist": 2.797 }, { "index": 11, "type": "sugar", "atom": "///R/28/O4'", "nt": "///R/51", "vert_dist": 3.457 }, { "index": 12, "type": "sugar", "atom": "///R/50/O4'", "nt": "///R/52", "vert_dist": 2.816 }, { "index": 13, "type": "sugar", "atom": "///R/69/O4'", "nt": "///R/87", "vert_dist": 2.800 }, { "index": 14, "type": "sugar", "atom": "///R/69/O2'", "nt": "///R/87", "vert_dist": 3.311 }, { "index": 15, "type": "phosphate", "atom": "///R/111/OP2", "nt": "///R/109", "vert_dist": 3.131 }, { "index": 16, "type": "sugar", "atom": "///S/17/O4'", "nt": "///S/17", "vert_dist": 2.934 }, { "index": 17, "type": "sugar", "atom": "///S/28/O4'", "nt": "///S/51", "vert_dist": 3.415 }, { "index": 18, "type": "sugar", "atom": "///S/69/O4'", "nt": "///S/87", "vert_dist": 2.793 }, { "index": 19, "type": "sugar", "atom": "///S/69/O2'", "nt": "///S/87", "vert_dist": 3.126 }, { "index": 20, "type": "phosphate", "atom": "///S/111/OP2", "nt": "///S/109", "vert_dist": 3.063 }, { "index": 21, "type": "sugar", "atom": "///S/25/O4'", "nt": "///S/112", "vert_dist": 3.032 }, { "index": 22, "type": "phosphate", "atom": "///S/112/OP2", "nt": "///S/113", "vert_dist": 3.429 } ], "num_hairpins": 20, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 10 ], "stem_indices": [ 3 ], "summary": "[1] 10 [P.17 P.17] 6", "num_nts": 12, "nts_short": "CAUUGCACUCCG", "nts_long": "///P/17,///P/17,///P/17,///P/17,///P/17,///P/17,///P/17,///P/17,///P/17,///P/17,///P/17,///P/17", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 10, "nts_short": "AUUGCACUCC", "nts_long": "///P/17,///P/17,///P/17,///P/17,///P/17,///P/17,///P/17,///P/17,///P/17,///P/17" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 11 ], "stem_indices": [ 4 ], "summary": "[1] 11 [P.31 P.43] 3", "num_nts": 13, "nts_short": "AGGUGGGGUUUAU", "nts_long": "///P/31,///P/32,///P/33,///P/34,///P/35,///P/36,///P/37,///P/38,///P/39,///P/40,///P/41,///P/42,///P/43", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 11, "nts_short": "GGUGGGGUUUA", "nts_long": "///P/32,///P/33,///P/34,///P/35,///P/36,///P/37,///P/38,///P/39,///P/40,///P/41,///P/42" } ] }, { "index": 3, "type": "hairpin loop", "bridging_nts": [ 19 ], "stem_indices": [ 5 ], "summary": "[1] 19 [P.40 P.60] 6", "num_nts": 21, "nts_short": "UUAUCGAGAUUUCGGCGGAUG", "nts_long": "///P/40,///P/41,///P/42,///P/43,///P/44,///P/45,///P/46,///P/47,///P/48,///P/49,///P/50,///P/51,///P/52,///P/53,///P/54,///P/55,///P/56,///P/57,///P/58,///P/59,///P/60", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 19, "nts_short": "UAUCGAGAUUUCGGCGGAU", "nts_long": "///P/41,///P/42,///P/43,///P/44,///P/45,///P/46,///P/47,///P/48,///P/49,///P/50,///P/51,///P/52,///P/53,///P/54,///P/55,///P/56,///P/57,///P/58,///P/59" } ] }, { "index": 4, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 6 ], "summary": "[1] 7 [P.71 P.79] 6", "num_nts": 9, "nts_short": "GUUCAUCAC", "nts_long": "///P/71,///P/72,///P/73,///P/74,///P/75,///P/76,///P/77,///P/78,///P/79", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUCAUCA", "nts_long": "///P/72,///P/73,///P/74,///P/75,///P/76,///P/77,///P/78" } ] }, { "index": 5, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 10 ], "summary": "[1] 4 [P.108 P.113] 7", "num_nts": 6, "nts_short": "GGUGAC", "nts_long": "///P/108,///P/109,///P/110,///P/111,///P/112,///P/113", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GUGA", "nts_long": "///P/109,///P/110,///P/111,///P/112" } ] }, { "index": 6, "type": "hairpin loop", "bridging_nts": [ 10 ], "stem_indices": [ 13 ], "summary": "[1] 10 [Q.17 Q.17] 6", "num_nts": 12, "nts_short": "CAUUGCACUCCG", "nts_long": "///Q/17,///Q/17,///Q/17,///Q/17,///Q/17,///Q/17,///Q/17,///Q/17,///Q/17,///Q/17,///Q/17,///Q/17", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 10, "nts_short": "AUUGCACUCC", "nts_long": "///Q/17,///Q/17,///Q/17,///Q/17,///Q/17,///Q/17,///Q/17,///Q/17,///Q/17,///Q/17" } ] }, { "index": 7, "type": "hairpin loop", "bridging_nts": [ 11 ], "stem_indices": [ 14 ], "summary": "[1] 11 [Q.31 Q.43] 3", "num_nts": 13, "nts_short": "AGGUGGGGUUUAU", "nts_long": "///Q/31,///Q/32,///Q/33,///Q/34,///Q/35,///Q/36,///Q/37,///Q/38,///Q/39,///Q/40,///Q/41,///Q/42,///Q/43", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 11, "nts_short": "GGUGGGGUUUA", "nts_long": "///Q/32,///Q/33,///Q/34,///Q/35,///Q/36,///Q/37,///Q/38,///Q/39,///Q/40,///Q/41,///Q/42" } ] }, { "index": 8, "type": "hairpin loop", "bridging_nts": [ 19 ], "stem_indices": [ 15 ], "summary": "[1] 19 [Q.40 Q.60] 6", "num_nts": 21, "nts_short": "UUAUCGAGAUUUCGGCGGAUG", "nts_long": "///Q/40,///Q/41,///Q/42,///Q/43,///Q/44,///Q/45,///Q/46,///Q/47,///Q/48,///Q/49,///Q/50,///Q/51,///Q/52,///Q/53,///Q/54,///Q/55,///Q/56,///Q/57,///Q/58,///Q/59,///Q/60", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 19, "nts_short": "UAUCGAGAUUUCGGCGGAU", "nts_long": "///Q/41,///Q/42,///Q/43,///Q/44,///Q/45,///Q/46,///Q/47,///Q/48,///Q/49,///Q/50,///Q/51,///Q/52,///Q/53,///Q/54,///Q/55,///Q/56,///Q/57,///Q/58,///Q/59" } ] }, { "index": 9, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 16 ], "summary": "[1] 7 [Q.71 Q.79] 6", "num_nts": 9, "nts_short": "GUUCAUCAC", "nts_long": "///Q/71,///Q/72,///Q/73,///Q/74,///Q/75,///Q/76,///Q/77,///Q/78,///Q/79", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUCAUCA", "nts_long": "///Q/72,///Q/73,///Q/74,///Q/75,///Q/76,///Q/77,///Q/78" } ] }, { "index": 10, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 19 ], "summary": "[1] 4 [Q.108 Q.113] 7", "num_nts": 6, "nts_short": "GGUGAC", "nts_long": "///Q/108,///Q/109,///Q/110,///Q/111,///Q/112,///Q/113", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GUGA", "nts_long": "///Q/109,///Q/110,///Q/111,///Q/112" } ] }, { "index": 11, "type": "hairpin loop", "bridging_nts": [ 10 ], "stem_indices": [ 22 ], "summary": "[1] 10 [R.17 R.17] 6", "num_nts": 12, "nts_short": "CAUUGCACUCCG", "nts_long": "///R/17,///R/17,///R/17,///R/17,///R/17,///R/17,///R/17,///R/17,///R/17,///R/17,///R/17,///R/17", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 10, "nts_short": "AUUGCACUCC", "nts_long": "///R/17,///R/17,///R/17,///R/17,///R/17,///R/17,///R/17,///R/17,///R/17,///R/17" } ] }, { "index": 12, "type": "hairpin loop", "bridging_nts": [ 11 ], "stem_indices": [ 23 ], "summary": "[1] 11 [R.31 R.43] 3", "num_nts": 13, "nts_short": "AGGUGGGGUUUAU", "nts_long": "///R/31,///R/32,///R/33,///R/34,///R/35,///R/36,///R/37,///R/38,///R/39,///R/40,///R/41,///R/42,///R/43", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 11, "nts_short": "GGUGGGGUUUA", "nts_long": "///R/32,///R/33,///R/34,///R/35,///R/36,///R/37,///R/38,///R/39,///R/40,///R/41,///R/42" } ] }, { "index": 13, "type": "hairpin loop", "bridging_nts": [ 19 ], "stem_indices": [ 24 ], "summary": "[1] 19 [R.40 R.60] 6", "num_nts": 21, "nts_short": "UUAUCGAGAUUUCGGCGGAUG", "nts_long": "///R/40,///R/41,///R/42,///R/43,///R/44,///R/45,///R/46,///R/47,///R/48,///R/49,///R/50,///R/51,///R/52,///R/53,///R/54,///R/55,///R/56,///R/57,///R/58,///R/59,///R/60", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 19, "nts_short": "UAUCGAGAUUUCGGCGGAU", "nts_long": "///R/41,///R/42,///R/43,///R/44,///R/45,///R/46,///R/47,///R/48,///R/49,///R/50,///R/51,///R/52,///R/53,///R/54,///R/55,///R/56,///R/57,///R/58,///R/59" } ] }, { "index": 14, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 25 ], "summary": "[1] 7 [R.71 R.79] 6", "num_nts": 9, "nts_short": "GUUCAUCAC", "nts_long": "///R/71,///R/72,///R/73,///R/74,///R/75,///R/76,///R/77,///R/78,///R/79", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUCAUCA", "nts_long": "///R/72,///R/73,///R/74,///R/75,///R/76,///R/77,///R/78" } ] }, { "index": 15, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 28 ], "summary": "[1] 4 [R.108 R.113] 7", "num_nts": 6, "nts_short": "GGUGAC", "nts_long": "///R/108,///R/109,///R/110,///R/111,///R/112,///R/113", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GUGA", "nts_long": "///R/109,///R/110,///R/111,///R/112" } ] }, { "index": 16, "type": "hairpin loop", "bridging_nts": [ 10 ], "stem_indices": [ 31 ], "summary": "[1] 10 [S.17 S.17] 6", "num_nts": 12, "nts_short": "CAUUGCACUCCG", "nts_long": "///S/17,///S/17,///S/17,///S/17,///S/17,///S/17,///S/17,///S/17,///S/17,///S/17,///S/17,///S/17", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 10, "nts_short": "AUUGCACUCC", "nts_long": "///S/17,///S/17,///S/17,///S/17,///S/17,///S/17,///S/17,///S/17,///S/17,///S/17" } ] }, { "index": 17, "type": "hairpin loop", "bridging_nts": [ 11 ], "stem_indices": [ 32 ], "summary": "[1] 11 [S.31 S.43] 3", "num_nts": 13, "nts_short": "AGGUGGGGUUUAU", "nts_long": "///S/31,///S/32,///S/33,///S/34,///S/35,///S/36,///S/37,///S/38,///S/39,///S/40,///S/41,///S/42,///S/43", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 11, "nts_short": "GGUGGGGUUUA", "nts_long": "///S/32,///S/33,///S/34,///S/35,///S/36,///S/37,///S/38,///S/39,///S/40,///S/41,///S/42" } ] }, { "index": 18, "type": "hairpin loop", "bridging_nts": [ 19 ], "stem_indices": [ 33 ], "summary": "[1] 19 [S.40 S.60] 6", "num_nts": 21, "nts_short": "UUAUCGAGAUUUCGGCGGAUG", "nts_long": "///S/40,///S/41,///S/42,///S/43,///S/44,///S/45,///S/46,///S/47,///S/48,///S/49,///S/50,///S/51,///S/52,///S/53,///S/54,///S/55,///S/56,///S/57,///S/58,///S/59,///S/60", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 19, "nts_short": "UAUCGAGAUUUCGGCGGAU", "nts_long": "///S/41,///S/42,///S/43,///S/44,///S/45,///S/46,///S/47,///S/48,///S/49,///S/50,///S/51,///S/52,///S/53,///S/54,///S/55,///S/56,///S/57,///S/58,///S/59" } ] }, { "index": 19, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 34 ], "summary": "[1] 7 [S.71 S.79] 6", "num_nts": 9, "nts_short": "GUUCAUCAC", "nts_long": "///S/71,///S/72,///S/73,///S/74,///S/75,///S/76,///S/77,///S/78,///S/79", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUCAUCA", "nts_long": "///S/72,///S/73,///S/74,///S/75,///S/76,///S/77,///S/78" } ] }, { "index": 20, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 37 ], "summary": "[1] 4 [S.108 S.113] 7", "num_nts": 6, "nts_short": "GGUGAC", "nts_long": "///S/108,///S/109,///S/110,///S/111,///S/112,///S/113", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GUGA", "nts_long": "///S/109,///S/110,///S/111,///S/112" } ] } ], "num_bulges": 4, "bulges": [ { "index": 1, "type": "bulge", "bridging_nts": [ 1, 0 ], "stem_indices": [ 1, -1 ], "summary": "[2] 1 0 [E.5 P.53 E.7 P.52] 4 1", "num_nts": 5, "nts_short": "CAGCG", "nts_long": "///E/5,///E/6,///E/7,///P/52,///P/53", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///E/6" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] }, { "index": 2, "type": "bulge", "bridging_nts": [ 1, 0 ], "stem_indices": [ 11, -2 ], "summary": "[2] 1 0 [F.5 Q.53 F.7 Q.52] 4 1", "num_nts": 5, "nts_short": "CAGCG", "nts_long": "///F/5,///F/6,///F/7,///Q/52,///Q/53", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///F/6" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] }, { "index": 3, "type": "bulge", "bridging_nts": [ 1, 0 ], "stem_indices": [ 20, -3 ], "summary": "[2] 1 0 [G.5 R.53 G.7 R.52] 4 1", "num_nts": 5, "nts_short": "CAGCG", "nts_long": "///G/5,///G/6,///G/7,///R/52,///R/53", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///G/6" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] }, { "index": 4, "type": "bulge", "bridging_nts": [ 1, 0 ], "stem_indices": [ 29, -4 ], "summary": "[2] 1 0 [H.5 S.53 H.7 S.52] 4 1", "num_nts": 5, "nts_short": "CAGCG", "nts_long": "///H/5,///H/6,///H/7,///S/52,///S/53", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "A", "nts_long": "///H/6" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" } ] } ], "num_iloops": 5, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 1, 1 ], "stem_indices": [ 8, 9 ], "summary": "[2] 1 1 [P.90 P.132 P.92 P.130] 2 5", "num_nts": 6, "nts_short": "UUUAAA", "nts_long": "///P/90,///P/91,///P/92,///P/130,///P/131,///P/132", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///P/91" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///P/131" } ] }, { "index": 2, "type": "asymmetric internal loop", "bridging_nts": [ 5, 6 ], "stem_indices": [ 9, 10 ], "summary": "[2] 5 6 [P.96 P.126 P.102 P.119] 5 7", "num_nts": 15, "nts_short": "UUAAAUCGGACAAAG", "nts_long": "///P/96,///P/97,///P/98,///P/99,///P/100,///P/101,///P/102,///P/119,///P/120,///P/121,///P/122,///P/123,///P/124,///P/125,///P/126", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 5, "nts_short": "UAAAU", "nts_long": "///P/97,///P/98,///P/99,///P/100,///P/101" }, { "index": 2, "num_nts": 6, "nts_short": "GACAAA", "nts_long": "///P/120,///P/121,///P/122,///P/123,///P/124,///P/125" } ] }, { "index": 3, "type": "asymmetric internal loop", "bridging_nts": [ 5, 6 ], "stem_indices": [ 18, 19 ], "summary": "[2] 5 6 [Q.96 Q.126 Q.102 Q.119] 9 7", "num_nts": 15, "nts_short": "UUAAAUCGGACAAAG", "nts_long": "///Q/96,///Q/97,///Q/98,///Q/99,///Q/100,///Q/101,///Q/102,///Q/119,///Q/120,///Q/121,///Q/122,///Q/123,///Q/124,///Q/125,///Q/126", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 5, "nts_short": "UAAAU", "nts_long": "///Q/97,///Q/98,///Q/99,///Q/100,///Q/101" }, { "index": 2, "num_nts": 6, "nts_short": "GACAAA", "nts_long": "///Q/120,///Q/121,///Q/122,///Q/123,///Q/124,///Q/125" } ] }, { "index": 4, "type": "asymmetric internal loop", "bridging_nts": [ 5, 6 ], "stem_indices": [ 27, 28 ], "summary": "[2] 5 6 [R.96 R.126 R.102 R.119] 9 7", "num_nts": 15, "nts_short": "UUAAAUCGGACAAAG", "nts_long": "///R/96,///R/97,///R/98,///R/99,///R/100,///R/101,///R/102,///R/119,///R/120,///R/121,///R/122,///R/123,///R/124,///R/125,///R/126", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 5, "nts_short": "UAAAU", "nts_long": "///R/97,///R/98,///R/99,///R/100,///R/101" }, { "index": 2, "num_nts": 6, "nts_short": "GACAAA", "nts_long": "///R/120,///R/121,///R/122,///R/123,///R/124,///R/125" } ] }, { "index": 5, "type": "asymmetric internal loop", "bridging_nts": [ 5, 6 ], "stem_indices": [ 36, 37 ], "summary": "[2] 5 6 [S.96 S.126 S.102 S.119] 9 7", "num_nts": 15, "nts_short": "UUAAAUCGGACAAAG", "nts_long": "///S/96,///S/97,///S/98,///S/99,///S/100,///S/101,///S/102,///S/119,///S/120,///S/121,///S/122,///S/123,///S/124,///S/125,///S/126", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 5, "nts_short": "UAAAU", "nts_long": "///S/97,///S/98,///S/99,///S/100,///S/101" }, { "index": 2, "num_nts": 6, "nts_short": "GACAAA", "nts_long": "///S/120,///S/121,///S/122,///S/123,///S/124,///S/125" } ] } ], "num_junctions": 4, "junctions": [ { "index": 1, "type": "3-way junction", "bridging_nts": [ 0, 2, 6 ], "stem_indices": [ -1, 2, 4 ], "summary": "[3] 0 2 6 [E.7 P.52 E.8 P.26 P.29 P.45] 1 4 3", "num_nts": 14, "nts_short": "GAUGACGAGAUUUC", "nts_long": "///E/7,///E/8,///P/26,///P/27,///P/28,///P/29,///P/45,///P/46,///P/47,///P/48,///P/49,///P/50,///P/51,///P/52", "num_stems": 3, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 2, "nts_short": "GA", "nts_long": "///P/27,///P/28" }, { "index": 3, "num_nts": 6, "nts_short": "AGAUUU", "nts_long": "///P/46,///P/47,///P/48,///P/49,///P/50,///P/51" } ] }, { "index": 2, "type": "3-way junction", "bridging_nts": [ 0, 2, 6 ], "stem_indices": [ -2, 12, 14 ], "summary": "[3] 0 2 6 [F.7 Q.52 F.8 Q.26 Q.29 Q.45] 1 4 3", "num_nts": 14, "nts_short": "GAUGACGAGAUUUC", "nts_long": "///F/7,///F/8,///Q/26,///Q/27,///Q/28,///Q/29,///Q/45,///Q/46,///Q/47,///Q/48,///Q/49,///Q/50,///Q/51,///Q/52", "num_stems": 3, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 2, "nts_short": "GA", "nts_long": "///Q/27,///Q/28" }, { "index": 3, "num_nts": 6, "nts_short": "AGAUUU", "nts_long": "///Q/46,///Q/47,///Q/48,///Q/49,///Q/50,///Q/51" } ] }, { "index": 3, "type": "3-way junction", "bridging_nts": [ 0, 2, 6 ], "stem_indices": [ -3, 21, 23 ], "summary": "[3] 0 2 6 [G.7 R.52 G.8 R.26 R.29 R.45] 1 4 3", "num_nts": 14, "nts_short": "GAUGACGAGAUUUC", "nts_long": "///G/7,///G/8,///R/26,///R/27,///R/28,///R/29,///R/45,///R/46,///R/47,///R/48,///R/49,///R/50,///R/51,///R/52", "num_stems": 3, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 2, "nts_short": "GA", "nts_long": "///R/27,///R/28" }, { "index": 3, "num_nts": 6, "nts_short": "AGAUUU", "nts_long": "///R/46,///R/47,///R/48,///R/49,///R/50,///R/51" } ] }, { "index": 4, "type": "3-way junction", "bridging_nts": [ 0, 2, 6 ], "stem_indices": [ -4, 30, 32 ], "summary": "[3] 0 2 6 [H.7 S.52 H.8 S.26 S.29 S.45] 1 4 3", "num_nts": 14, "nts_short": "GAUGACGAGAUUUC", "nts_long": "///H/7,///H/8,///S/26,///S/27,///S/28,///S/29,///S/45,///S/46,///S/47,///S/48,///S/49,///S/50,///S/51,///S/52", "num_stems": 3, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 2, "nts_short": "GA", "nts_long": "///S/27,///S/28" }, { "index": 3, "num_nts": 6, "nts_short": "AGAUUU", "nts_long": "///S/46,///S/47,///S/48,///S/49,///S/50,///S/51" } ] } ], "num_ssSegments": 12, "ssSegments": [ { "index": 1, "num_nts": 3, "nts_short": "AaG", "nts_long": "///E/-1,///E/0,///E/1" }, { "index": 2, "num_nts": 4, "nts_short": "CAAG", "nts_long": "///P/85,///P/86,///P/87,///P/88" }, { "index": 3, "num_nts": 2, "nts_short": "UG", "nts_long": "///P/134,///P/135" }, { "index": 4, "num_nts": 3, "nts_short": "AaG", "nts_long": "///F/-1,///F/0,///F/1" }, { "index": 5, "num_nts": 3, "nts_short": "CAA", "nts_long": "///Q/85,///Q/86,///Q/87" }, { "index": 6, "num_nts": 1, "nts_short": "G", "nts_long": "///Q/135" }, { "index": 7, "num_nts": 3, "nts_short": "AaG", "nts_long": "///G/-1,///G/0,///G/1" }, { "index": 8, "num_nts": 3, "nts_short": "CAA", "nts_long": "///R/85,///R/86,///R/87" }, { "index": 9, "num_nts": 1, "nts_short": "G", "nts_long": "///R/135" }, { "index": 10, "num_nts": 3, "nts_short": "AaG", "nts_long": "///H/-1,///H/0,///H/1" }, { "index": 11, "num_nts": 3, "nts_short": "CAA", "nts_long": "///S/85,///S/86,///S/87" }, { "index": 12, "num_nts": 1, "nts_short": "G", "nts_long": "///S/135" } ], "num_Aminors": 34, "Aminors": [ { "index": 1, "type": "X", "desc_short": "A vs C-G (WC)", "desc_long": "///E/-1 vs ///F/2,///Q/56", "A_nt1": { "desc": "///E/-1 vs ///F/2", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[3.12],N1-O2'(hydroxyl)[2.67]" }, "A_nt2": { "desc": "///E/-1 vs ///Q/56", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N6(amino)*N2(amino)[3.10]" } }, { "index": 2, "type": "X", "desc_short": "A vs G-C (WC)", "desc_long": "///P/86 vs ///P/67,///P/83", "A_nt1": { "desc": "///P/86 vs ///P/67", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///P/86 vs ///P/83", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "N3-O2'(hydroxyl)[2.43]" } }, { "index": 3, "type": "I", "desc_short": "A vs G-C (WC)", "desc_long": "///P/87 vs ///P/68,///P/82", "A_nt1": { "desc": "///P/87 vs ///P/68", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-O2'(hydroxyl)[2.76]" }, "A_nt2": { "desc": "///P/87 vs ///P/82", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O3'-O2'(hydroxyl)[3.38],O2'(hydroxyl)-O2(carbonyl)[2.73]" } }, { "index": 4, "type": "II", "desc_short": "A vs C-G (WC)", "desc_long": "///P/99 vs ///P/29,///P/45", "A_nt1": { "desc": "///P/99 vs ///P/29", "face_type": "-", "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O3'[2.93],O2'(hydroxyl)-O2'(hydroxyl)[2.80],N3-O2'(hydroxyl)[2.67]" }, "A_nt2": { "desc": "///P/99 vs ///P/45", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 5, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///P/112 vs ///E/10,///P/24", "A_nt1": { "desc": "///P/112 vs ///E/10", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.66],O2'(hydroxyl)-O2(carbonyl)[3.36]" }, "A_nt2": { "desc": "///P/112 vs ///P/24", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.57],N3-N2(amino)[3.02]" } }, { "index": 6, "type": "X", "desc_short": "A vs G-C (WC)", "desc_long": "///P/123 vs ///P/30,///P/44", "A_nt1": { "desc": "///P/123 vs ///P/30", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-N2(amino)[2.90]" }, "A_nt2": { "desc": "///P/123 vs ///P/44", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 7, "type": "II", "desc_short": "A vs G-C (WC)", "desc_long": "///P/124 vs ///P/30,///P/44", "A_nt1": { "desc": "///P/124 vs ///P/30", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///P/124 vs ///P/44", "face_type": "-", "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O3'[2.76],O2'(hydroxyl)-O2'(hydroxyl)[2.93],N3-O2'(hydroxyl)[2.46]" } }, { "index": 8, "type": "I", "desc_short": "A vs A-U (WC)", "desc_long": "///P/125 vs ///P/31,///P/43", "A_nt1": { "desc": "///P/125 vs ///P/31", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-O2'(hydroxyl)[2.93]" }, "A_nt2": { "desc": "///P/125 vs ///P/43", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 9, "type": "X", "desc_short": "A vs C-G (WC)", "desc_long": "///F/-1 vs ///E/2,///P/56", "A_nt1": { "desc": "///F/-1 vs ///E/2", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[3.12],N1-O2'(hydroxyl)[2.76]" }, "A_nt2": { "desc": "///F/-1 vs ///P/56", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N6(amino)*N2(amino)[3.28]" } }, { "index": 10, "type": "II", "desc_short": "A vs G-C (WC)", "desc_long": "///Q/86 vs ///Q/67,///Q/83", "A_nt1": { "desc": "///Q/86 vs ///Q/67", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///Q/86 vs ///Q/83", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "N3-O2'(hydroxyl)[2.47]" } }, { "index": 11, "type": "I", "desc_short": "A vs G-C (WC)", "desc_long": "///Q/87 vs ///Q/68,///Q/82", "A_nt1": { "desc": "///Q/87 vs ///Q/68", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.73],N3-N2(amino)[3.09]" }, "A_nt2": { "desc": "///Q/87 vs ///Q/82", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.65],O2'(hydroxyl)-O2(carbonyl)[3.02]" } }, { "index": 12, "type": "X", "desc_short": "A vs C-G (WC)", "desc_long": "///Q/98 vs ///Q/29,///Q/45", "A_nt1": { "desc": "///Q/98 vs ///Q/29", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///Q/98 vs ///Q/45", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-N2(amino)[2.94]" } }, { "index": 13, "type": "II", "desc_short": "A vs C-G (WC)", "desc_long": "///Q/99 vs ///Q/29,///Q/45", "A_nt1": { "desc": "///Q/99 vs ///Q/29", "face_type": "-", "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O3'[3.06],O2'(hydroxyl)-O2'(hydroxyl)[2.70],N3-O2'(hydroxyl)[2.62]" }, "A_nt2": { "desc": "///Q/99 vs ///Q/45", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 14, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///Q/112 vs ///F/10,///Q/24", "A_nt1": { "desc": "///Q/112 vs ///F/10", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.86]" }, "A_nt2": { "desc": "///Q/112 vs ///Q/24", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.75],N3-N2(amino)[3.13]" } }, { "index": 15, "type": "X", "desc_short": "A vs G-C (WC)", "desc_long": "///Q/123 vs ///Q/30,///Q/44", "A_nt1": { "desc": "///Q/123 vs ///Q/30", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-N2(amino)[3.02]" }, "A_nt2": { "desc": "///Q/123 vs ///Q/44", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 16, "type": "II", "desc_short": "A vs G-C (WC)", "desc_long": "///Q/124 vs ///Q/30,///Q/44", "A_nt1": { "desc": "///Q/124 vs ///Q/30", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///Q/124 vs ///Q/44", "face_type": "-", "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O3'[2.82],O2'(hydroxyl)-O2'(hydroxyl)[2.72],N3-O2'(hydroxyl)[2.78]" } }, { "index": 17, "type": "I", "desc_short": "A vs A-U (WC)", "desc_long": "///Q/125 vs ///Q/31,///Q/43", "A_nt1": { "desc": "///Q/125 vs ///Q/31", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-O2'(hydroxyl)[2.82]" }, "A_nt2": { "desc": "///Q/125 vs ///Q/43", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 18, "type": "X", "desc_short": "A vs C-G (WC)", "desc_long": "///G/-1 vs ///H/2,///S/56", "A_nt1": { "desc": "///G/-1 vs ///H/2", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.88],N1-O2'(hydroxyl)[2.85]" }, "A_nt2": { "desc": "///G/-1 vs ///S/56", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N6(amino)*N2(amino)[3.15]" } }, { "index": 19, "type": "II", "desc_short": "A vs G-C (WC)", "desc_long": "///R/86 vs ///R/67,///R/83", "A_nt1": { "desc": "///R/86 vs ///R/67", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///R/86 vs ///R/83", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "N3-O2'(hydroxyl)[2.72]" } }, { "index": 20, "type": "I", "desc_short": "A vs G-C (WC)", "desc_long": "///R/87 vs ///R/68,///R/82", "A_nt1": { "desc": "///R/87 vs ///R/68", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.59],N3-N2(amino)[3.06]" }, "A_nt2": { "desc": "///R/87 vs ///R/82", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.66],O2'(hydroxyl)-O2(carbonyl)[2.93]" } }, { "index": 21, "type": "X", "desc_short": "A vs C-G (WC)", "desc_long": "///R/98 vs ///R/29,///R/45", "A_nt1": { "desc": "///R/98 vs ///R/29", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///R/98 vs ///R/45", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-N2(amino)[3.04]" } }, { "index": 22, "type": "II", "desc_short": "A vs C-G (WC)", "desc_long": "///R/99 vs ///R/29,///R/45", "A_nt1": { "desc": "///R/99 vs ///R/29", "face_type": "-", "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O3'[2.84],O2'(hydroxyl)-O2'(hydroxyl)[2.79],N3-O2'(hydroxyl)[2.51]" }, "A_nt2": { "desc": "///R/99 vs ///R/45", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 23, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///R/112 vs ///G/10,///R/24", "A_nt1": { "desc": "///R/112 vs ///G/10", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.50],O2'(hydroxyl)-O2(carbonyl)[3.27]" }, "A_nt2": { "desc": "///R/112 vs ///R/24", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.71],N3-N2(amino)[2.85]" } }, { "index": 24, "type": "X", "desc_short": "A vs G-C (WC)", "desc_long": "///R/123 vs ///R/30,///R/44", "A_nt1": { "desc": "///R/123 vs ///R/30", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-N2(amino)[3.13]" }, "A_nt2": { "desc": "///R/123 vs ///R/44", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 25, "type": "II", "desc_short": "A vs G-C (WC)", "desc_long": "///R/124 vs ///R/30,///R/44", "A_nt1": { "desc": "///R/124 vs ///R/30", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///R/124 vs ///R/44", "face_type": "-", "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O3'[2.97],O2'(hydroxyl)-O2'(hydroxyl)[2.91],N3-O2'(hydroxyl)[2.69]" } }, { "index": 26, "type": "I", "desc_short": "A vs A-U (WC)", "desc_long": "///R/125 vs ///R/31,///R/43", "A_nt1": { "desc": "///R/125 vs ///R/31", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-O2'(hydroxyl)[2.98]" }, "A_nt2": { "desc": "///R/125 vs ///R/43", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 27, "type": "X", "desc_short": "A vs C-G (WC)", "desc_long": "///H/-1 vs ///G/2,///R/56", "A_nt1": { "desc": "///H/-1 vs ///G/2", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "N6(amino)-O2(carbonyl)[2.99],N1-O2'(hydroxyl)[2.90]" }, "A_nt2": { "desc": "///H/-1 vs ///R/56", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N6(amino)*N2(amino)[2.89]" } }, { "index": 28, "type": "II", "desc_short": "A vs G-C (WC)", "desc_long": "///S/86 vs ///S/67,///S/83", "A_nt1": { "desc": "///S/86 vs ///S/67", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///S/86 vs ///S/83", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "N3-O2'(hydroxyl)[2.66]" } }, { "index": 29, "type": "I", "desc_short": "A vs G-C (WC)", "desc_long": "///S/87 vs ///S/68,///S/82", "A_nt1": { "desc": "///S/87 vs ///S/68", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-O2'(hydroxyl)[2.60]" }, "A_nt2": { "desc": "///S/87 vs ///S/82", "face_type": "-", "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.82],O2'(hydroxyl)-O2(carbonyl)[3.22]" } }, { "index": 30, "type": "II", "desc_short": "A vs C-G (WC)", "desc_long": "///S/99 vs ///S/29,///S/45", "A_nt1": { "desc": "///S/99 vs ///S/29", "face_type": "-", "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O3'[2.57],O2'(hydroxyl)-O2'(hydroxyl)[2.74],N3-O2'(hydroxyl)[2.70]" }, "A_nt2": { "desc": "///S/99 vs ///S/45", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 31, "type": "I", "desc_short": "A vs C-G (WC)", "desc_long": "///S/112 vs ///H/10,///S/24", "A_nt1": { "desc": "///S/112 vs ///H/10", "face_type": "-", "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-O2'(hydroxyl)[2.60]" }, "A_nt2": { "desc": "///S/112 vs ///S/24", "face_type": "+", "hbonds_num": 2, "hbonds_desc": "N1-O2'(hydroxyl)[2.53],N3-N2(amino)[2.76]" } }, { "index": 32, "type": "X", "desc_short": "A vs G-C (WC)", "desc_long": "///S/123 vs ///S/30,///S/44", "A_nt1": { "desc": "///S/123 vs ///S/30", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-N2(amino)[2.78]" }, "A_nt2": { "desc": "///S/123 vs ///S/44", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" } }, { "index": 33, "type": "II", "desc_short": "A vs G-C (WC)", "desc_long": "///S/124 vs ///S/30,///S/44", "A_nt1": { "desc": "///S/124 vs ///S/30", "face_type": "+", "hbonds_num": 0, "hbonds_desc": "" }, "A_nt2": { "desc": "///S/124 vs ///S/44", "face_type": "-", "hbonds_num": 3, "hbonds_desc": "O2'(hydroxyl)-O3'[2.57],O2'(hydroxyl)-O2'(hydroxyl)[2.92],N3-O2'(hydroxyl)[2.59]" } }, { "index": 34, "type": "I", "desc_short": "A vs A-U (WC)", "desc_long": "///S/125 vs ///S/31,///S/43", "A_nt1": { "desc": "///S/125 vs ///S/31", "face_type": "+", "hbonds_num": 1, "hbonds_desc": "N1-O2'(hydroxyl)[3.19]" }, "A_nt2": { "desc": "///S/125 vs ///S/43", "face_type": "-", "hbonds_num": 0, "hbonds_desc": "" } } ], "num_riboseZippers": 16, "riboseZippers": [ { "index": 1, "num_nts": 4, "nts_short": "CUGA", "nts_long": "///E/10,///E/11,///P/111,///P/112" }, { "index": 2, "num_nts": 4, "nts_short": "CGAA", "nts_long": "///P/29,///P/30,///P/98,///P/99" }, { "index": 3, "num_nts": 4, "nts_short": "CGAA", "nts_long": "///P/44,///P/45,///P/123,///P/124" }, { "index": 4, "num_nts": 4, "nts_short": "ACAG", "nts_long": "///P/81,///P/82,///P/87,///P/88" }, { "index": 5, "num_nts": 4, "nts_short": "CUGA", "nts_long": "///F/10,///F/11,///Q/111,///Q/112" }, { "index": 6, "num_nts": 4, "nts_short": "CGAA", "nts_long": "///Q/29,///Q/30,///Q/98,///Q/99" }, { "index": 7, "num_nts": 4, "nts_short": "CGAA", "nts_long": "///Q/44,///Q/45,///Q/123,///Q/124" }, { "index": 8, "num_nts": 6, "nts_short": "ACCAAG", "nts_long": "///Q/81,///Q/82,///Q/83,///Q/86,///Q/87,///Q/88" }, { "index": 9, "num_nts": 4, "nts_short": "CUGA", "nts_long": "///G/10,///G/11,///R/111,///R/112" }, { "index": 10, "num_nts": 4, "nts_short": "CGAA", "nts_long": "///R/29,///R/30,///R/98,///R/99" }, { "index": 11, "num_nts": 4, "nts_short": "CGAA", "nts_long": "///R/44,///R/45,///R/123,///R/124" }, { "index": 12, "num_nts": 6, "nts_short": "ACCAAG", "nts_long": "///R/81,///R/82,///R/83,///R/86,///R/87,///R/88" }, { "index": 13, "num_nts": 4, "nts_short": "CUGA", "nts_long": "///H/10,///H/11,///S/111,///S/112" }, { "index": 14, "num_nts": 4, "nts_short": "CGAA", "nts_long": "///S/29,///S/30,///S/98,///S/99" }, { "index": 15, "num_nts": 4, "nts_short": "CGAA", "nts_long": "///S/44,///S/45,///S/123,///S/124" }, { "index": 16, "num_nts": 6, "nts_short": "ACCAAG", "nts_long": "///S/81,///S/82,///S/83,///S/86,///S/87,///S/88" } ], "num_splayUnits": 48, "splayUnits": [ { "index": 1, "num_nts": 3, "nts_short": "AaG", "nts_long": "///E/-1,///E/0,///E/1" }, { "index": 2, "num_nts": 2, "nts_short": "GC", "nts_long": "///P/17,///P/17" }, { "index": 3, "num_nts": 2, "nts_short": "CG", "nts_long": "///P/17,///P/17" }, { "index": 4, "num_nts": 2, "nts_short": "GA", "nts_long": "///P/27,///P/28" }, { "index": 5, "num_nts": 2, "nts_short": "UG", "nts_long": "///P/34,///P/35" }, { "index": 6, "num_nts": 3, "nts_short": "UUA", "nts_long": "///P/40,///P/41,///P/42" }, { "index": 7, "num_nts": 2, "nts_short": "AU", "nts_long": "///P/48,///P/49" }, { "index": 8, "num_nts": 3, "nts_short": "UUC", "nts_long": "///P/50,///P/51,///P/52" }, { "index": 9, "num_nts": 3, "nts_short": "AUG", "nts_long": "///P/58,///P/59,///P/60" }, { "index": 10, "num_nts": 3, "nts_short": "GUU", "nts_long": "///P/71,///P/72,///P/73" }, { "index": 11, "num_nts": 2, "nts_short": "AG", "nts_long": "///P/87,///P/88" }, { "index": 12, "num_nts": 3, "nts_short": "UUA", "nts_long": "///P/96,///P/97,///P/98" }, { "index": 13, "num_nts": 2, "nts_short": "aG", "nts_long": "///F/0,///F/1" }, { "index": 14, "num_nts": 2, "nts_short": "AG", "nts_long": "///F/6,///F/7" }, { "index": 15, "num_nts": 2, "nts_short": "GC", "nts_long": "///Q/17,///Q/17" }, { "index": 16, "num_nts": 2, "nts_short": "CU", "nts_long": "///Q/17,///Q/17" }, { "index": 17, "num_nts": 2, "nts_short": "CG", "nts_long": "///Q/17,///Q/17" }, { "index": 18, "num_nts": 2, "nts_short": "GA", "nts_long": "///Q/27,///Q/28" }, { "index": 19, "num_nts": 2, "nts_short": "UG", "nts_long": "///Q/34,///Q/35" }, { "index": 20, "num_nts": 3, "nts_short": "UUA", "nts_long": "///Q/40,///Q/41,///Q/42" }, { "index": 21, "num_nts": 3, "nts_short": "UUC", "nts_long": "///Q/50,///Q/51,///Q/52" }, { "index": 22, "num_nts": 3, "nts_short": "AUG", "nts_long": "///Q/58,///Q/59,///Q/60" }, { "index": 23, "num_nts": 3, "nts_short": "GUU", "nts_long": "///Q/71,///Q/72,///Q/73" }, { "index": 24, "num_nts": 2, "nts_short": "AG", "nts_long": "///Q/87,///Q/88" }, { "index": 25, "num_nts": 3, "nts_short": "UUA", "nts_long": "///Q/96,///Q/97,///Q/98" }, { "index": 26, "num_nts": 2, "nts_short": "aG", "nts_long": "///G/0,///G/1" }, { "index": 27, "num_nts": 2, "nts_short": "AG", "nts_long": "///G/6,///G/7" }, { "index": 28, "num_nts": 2, "nts_short": "GC", "nts_long": "///R/17,///R/17" }, { "index": 29, "num_nts": 2, "nts_short": "CU", "nts_long": "///R/17,///R/17" }, { "index": 30, "num_nts": 2, "nts_short": "CG", "nts_long": "///R/17,///R/17" }, { "index": 31, "num_nts": 2, "nts_short": "GA", "nts_long": "///R/27,///R/28" }, { "index": 32, "num_nts": 2, "nts_short": "UG", "nts_long": "///R/34,///R/35" }, { "index": 33, "num_nts": 3, "nts_short": "UUA", "nts_long": "///R/40,///R/41,///R/42" }, { "index": 34, "num_nts": 4, "nts_short": "UUUC", "nts_long": "///R/49,///R/50,///R/51,///R/52" }, { "index": 35, "num_nts": 3, "nts_short": "AUG", "nts_long": "///R/58,///R/59,///R/60" }, { "index": 36, "num_nts": 3, "nts_short": "GUU", "nts_long": "///R/71,///R/72,///R/73" }, { "index": 37, "num_nts": 2, "nts_short": "AG", "nts_long": "///R/87,///R/88" }, { "index": 38, "num_nts": 3, "nts_short": "UUA", "nts_long": "///R/96,///R/97,///R/98" }, { "index": 39, "num_nts": 2, "nts_short": "aG", "nts_long": "///H/0,///H/1" }, { "index": 40, "num_nts": 2, "nts_short": "CG", "nts_long": "///S/17,///S/17" }, { "index": 41, "num_nts": 2, "nts_short": "GA", "nts_long": "///S/27,///S/28" }, { "index": 42, "num_nts": 2, "nts_short": "UG", "nts_long": "///S/34,///S/35" }, { "index": 43, "num_nts": 3, "nts_short": "UUA", "nts_long": "///S/40,///S/41,///S/42" }, { "index": 44, "num_nts": 3, "nts_short": "UUC", "nts_long": "///S/50,///S/51,///S/52" }, { "index": 45, "num_nts": 3, "nts_short": "AUG", "nts_long": "///S/58,///S/59,///S/60" }, { "index": 46, "num_nts": 3, "nts_short": "GUU", "nts_long": "///S/71,///S/72,///S/73" }, { "index": 47, "num_nts": 2, "nts_short": "AG", "nts_long": "///S/87,///S/88" }, { "index": 48, "num_nts": 3, "nts_short": "UUA", "nts_long": "///S/96,///S/97,///S/98" } ], "num_HtypePknots": 12, "HtypePknots": [ { "index": 1, "desc": "stem#4(hairpin#2) vs stem#5(hairpin#3) L1 groove=----- nts=3 GGU ///P/32,///P/33,///P/34" }, { "index": 2, "desc": "stem#4(hairpin#2) vs stem#5(hairpin#3) L2 groove=----- nts=2 UA ///P/41,///P/42" }, { "index": 3, "desc": "stem#4(hairpin#2) vs stem#5(hairpin#3) L3 groove=MAJOR nts=14 AGAUUUCGGCGGAU ///P/46,///P/47,///P/48,///P/49,///P/50,///P/51,///P/52,///P/53,///P/54,///P/55,///P/56,///P/57,///P/58,///P/59" }, { "index": 4, "desc": "stem#14(hairpin#7) vs stem#15(hairpin#8) L1 groove=----- nts=3 GGU ///Q/32,///Q/33,///Q/34" }, { "index": 5, "desc": "stem#14(hairpin#7) vs stem#15(hairpin#8) L2 groove=----- nts=2 UA ///Q/41,///Q/42" }, { "index": 6, "desc": "stem#14(hairpin#7) vs stem#15(hairpin#8) L3 groove=MAJOR nts=14 AGAUUUCGGCGGAU ///Q/46,///Q/47,///Q/48,///Q/49,///Q/50,///Q/51,///Q/52,///Q/53,///Q/54,///Q/55,///Q/56,///Q/57,///Q/58,///Q/59" }, { "index": 7, "desc": "stem#23(hairpin#12) vs stem#24(hairpin#13) L1 groove=----- nts=3 GGU ///R/32,///R/33,///R/34" }, { "index": 8, "desc": "stem#23(hairpin#12) vs stem#24(hairpin#13) L2 groove=----- nts=2 UA ///R/41,///R/42" }, { "index": 9, "desc": "stem#23(hairpin#12) vs stem#24(hairpin#13) L3 groove=MAJOR nts=14 AGAUUUCGGCGGAU ///R/46,///R/47,///R/48,///R/49,///R/50,///R/51,///R/52,///R/53,///R/54,///R/55,///R/56,///R/57,///R/58,///R/59" }, { "index": 10, "desc": "stem#32(hairpin#17) vs stem#33(hairpin#18) L1 groove=----- nts=3 GGU ///S/32,///S/33,///S/34" }, { "index": 11, "desc": "stem#32(hairpin#17) vs stem#33(hairpin#18) L2 groove=----- nts=2 UA ///S/41,///S/42" }, { "index": 12, "desc": "stem#32(hairpin#17) vs stem#33(hairpin#18) L3 groove=MAJOR nts=14 AGAUUUCGGCGGAU ///S/46,///S/47,///S/48,///S/49,///S/50,///S/51,///S/52,///S/53,///S/54,///S/55,///S/56,///S/57,///S/58,///S/59" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 112, "nts_short": "CGCCGCGAUCGCGGCGUCAUCAUGAUGACGCCGCGAUCGCGGCGUCAUCAUGAUGACGCCGCGAUCGCGGCGUCAUCAUGAUGACGCCGCGAUCGCGGCGUCAUCAUGAUGA", "nts_long": "///E/2,///E/3,///E/4,///E/5,///E/7,///P/29,///P/30,///P/31,///P/43,///P/44,///P/45,///P/52,///P/53,///P/54,///P/55,///P/56,///P/73,///P/74,///P/75,///P/76,///P/77,///P/78,///P/136,///P/137,///P/138,///P/139,///P/140,///P/141,///F/2,///F/3,///F/4,///F/5,///F/7,///Q/29,///Q/30,///Q/31,///Q/43,///Q/44,///Q/45,///Q/52,///Q/53,///Q/54,///Q/55,///Q/56,///Q/73,///Q/74,///Q/75,///Q/76,///Q/77,///Q/78,///Q/136,///Q/137,///Q/138,///Q/139,///Q/140,///Q/141,///G/2,///G/3,///G/4,///G/5,///G/7,///R/29,///R/30,///R/31,///R/43,///R/44,///R/45,///R/52,///R/53,///R/54,///R/55,///R/56,///R/73,///R/74,///R/75,///R/76,///R/77,///R/78,///R/136,///R/137,///R/138,///R/139,///R/140,///R/141,///H/2,///H/3,///H/4,///H/5,///H/7,///S/29,///S/30,///S/31,///S/43,///S/44,///S/45,///S/52,///S/53,///S/54,///S/55,///S/56,///S/73,///S/74,///S/75,///S/76,///S/77,///S/78,///S/136,///S/137,///S/138,///S/139,///S/140,///S/141" } ], "dbn": { "all_chains": { "num_nts": 616, "num_chars": 623, "bseq": "AaGCGCCAGAACU&gGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA&AaGCGCCAGAACU&gGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA&AaGCGCCAGAACU&gGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA&AaGCGCCAGAACU&gGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA", "bseqUP": "AAGCGCCAGAACU&GGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA&AAGCGCCAGAACU&GGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA&AAGCGCCAGAACU&GGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA&AAGCGCCAGAACU&GGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA", "sstr": "...[[[[.[((((&((((((..........))))))))))..[[[...((((((..]]]......]]]]]...))))))((((((.[[[[[[))))))....((.(((((.....(((((((....)))))))......))))).))..]]]]]]&...[[[[.[((((&((((((..........))))))))))..[[[...((((((..]]]......]]]]]...))))))((((((.[[[[[[))))))...(((((((((.....(((((((....)))))))......))))))))).]]]]]]&...[[[[.[((((&((((((..........))))))))))..[[[...((((((..]]]......]]]]]...))))))((((((.[[[[[[))))))...(((((((((.....(((((((....)))))))......))))))))).]]]]]]&...[[[[.[((((&((((((..........))))))))))..[[[...((((((..]]]......]]]]]...))))))((((((.[[[[[[))))))...(((((((((.....(((((((....)))))))......))))))))).]]]]]]", "form": "...AAA--.AAA-&AAAAA.A....A---.AAAAAAAAA...AA.A..AAAA....AAA.B.....AAA....AAAAAAAA.AA...A.AAAAA.AA--...A--..AA...A..AA..AAA....AAAAAAA.A..A.AAAA...--.AAAA.-&...AAA...AAA-&AAAAAAA....A....AAAAAAAAA...AA.A..AAAAA...AAA..--...AAA.....AAAAAAAAAA..AAAAA.AAAAA--..AAAAAAAA..BA..AA.AAAA....AAA.AAA.A..AAAAAAAAA...AAAAA-&...AAA....AA-&AAAAAAA....A....AAA..AAAA...AA.A..AAAAA...AAA.......AAA.....AAAAAAAAAA..AAAAA.AAAAA--..AAAAAAAA..BA..AA.AAAA....AAA.AAA.A..AAAAAAAAA...AAAAA-&...AAA--.AAA-&AAAAAAA....A--..A.AAAAAAA...AA.A..AAAAA...AAAA.--...AAA.....AAAA.AA.AA..AA.AAAAA.AA....AAA...AA...A..A..BAAA....AAAAAAA.A..AAAAAA.......AAA.-" }, "chain_E": { "num_nts": 13, "num_chars": 13, "bseq": "AaGCGCCAGAACU", "bseqUP": "AAGCGCCAGAACU", "sstr": "...[[[[.[((((", "form": "...AAA--.AAA-" }, "chain_P": { "num_nts": 141, "num_chars": 141, "bseq": "gGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA", "bseqUP": "GGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA", "sstr": "((((((..........))))))))))..[[[...((((((..]]]......]]]]]...))))))((((((.[[[[[[))))))....((.(((((.....(((((((....)))))))......))))).))..]]]]]]", "form": "AAAAA.A....A---.AAAAAAAAA...AA.A..AAAA....AAA.B.....AAA....AAAAAAAA.AA...A.AAAAA.AA--...A--..AA...A..AA..AAA....AAAAAAA.A..A.AAAA...--.AAAA.-" }, "chain_F": { "num_nts": 13, "num_chars": 13, "bseq": "AaGCGCCAGAACU", "bseqUP": "AAGCGCCAGAACU", "sstr": "...[[[[.[((((", "form": "...AAA...AAA-" }, "chain_Q": { "num_nts": 141, "num_chars": 141, "bseq": "gGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA", "bseqUP": "GGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA", "sstr": "((((((..........))))))))))..[[[...((((((..]]]......]]]]]...))))))((((((.[[[[[[))))))...(((((((((.....(((((((....)))))))......))))))))).]]]]]]", "form": "AAAAAAA....A....AAAAAAAAA...AA.A..AAAAA...AAA..--...AAA.....AAAAAAAAAA..AAAAA.AAAAA--..AAAAAAAA..BA..AA.AAAA....AAA.AAA.A..AAAAAAAAA...AAAAA-" }, "chain_G": { "num_nts": 13, "num_chars": 13, "bseq": "AaGCGCCAGAACU", "bseqUP": "AAGCGCCAGAACU", "sstr": "...[[[[.[((((", "form": "...AAA....AA-" }, "chain_R": { "num_nts": 141, "num_chars": 141, "bseq": "gGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA", "bseqUP": "GGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA", "sstr": "((((((..........))))))))))..[[[...((((((..]]]......]]]]]...))))))((((((.[[[[[[))))))...(((((((((.....(((((((....)))))))......))))))))).]]]]]]", "form": "AAAAAAA....A....AAA..AAAA...AA.A..AAAAA...AAA.......AAA.....AAAAAAAAAA..AAAAA.AAAAA--..AAAAAAAA..BA..AA.AAAA....AAA.AAA.A..AAAAAAAAA...AAAAA-" }, "chain_H": { "num_nts": 13, "num_chars": 13, "bseq": "AaGCGCCAGAACU", "bseqUP": "AAGCGCCAGAACU", "sstr": "...[[[[.[((((", "form": "...AAA--.AAA-" }, "chain_S": { "num_nts": 141, "num_chars": 141, "bseq": "gGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA", "bseqUP": "GGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA", "sstr": "((((((..........))))))))))..[[[...((((((..]]]......]]]]]...))))))((((((.[[[[[[))))))...(((((((((.....(((((((....)))))))......))))))))).]]]]]]", "form": "AAAAAAA....A--..A.AAAAAAA...AA.A..AAAAA...AAAA.--...AAA.....AAAA.AA.AA..AA.AAAAA.AA....AAA...AA...A..A..BAAA....AAAAAAA.A..AAAAAA.......AAA.-" } }, "chains": { "chain_E": { "num_nts": 13, "bseq": "AaGCGCCAGAACU", "sstr": "...[[[[.[((((", "form": "...AAA--.AAA-", "helical_rise": 2.616, "helical_rise_std": 1.553, "helical_axis": [ -0.128, -0.988, -0.090 ], "point1": [ 23.275, 39.660, 15.551 ], "point2": [ 19.310, 9.000, 12.754 ], "num_chars": 37, "suite": "A__a!!G6nC1aG1aC1bC4nA1aG1aA1aA1aC1aU" }, "chain_P": { "num_nts": 141, "bseq": "gGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA", "sstr": "((((((..........))))))))))..[[[...((((((..]]]......]]]]]...))))))((((((.[[[[[[))))))....((.(((((.....(((((((....)))))))......))))).))..]]]]]]", "form": "AAAAA.A....A---.AAAAAAAAA...AA.A..AAAA....AAA.B.....AAA....AAAAAAAA.AA...A.AAAAA.AA--...A--..AA...A..AA..AAA....AAAAAAA.A..A.AAAA...--.AAAA.-", "helical_rise": 0.199, "helical_rise_std": 3.140, "helical_axis": [ 0.100, 0.313, -0.944 ], "point1": [ 21.011, 32.235, 25.648 ], "point2": [ 23.922, 41.331, -1.754 ], "num_chars": 421, "suite": "g1aG1aC1aA1aC1aC1aA1aU1[U6gG1[C0aA1aC!!U!!C1[C!!G1aG1aU1aG1aC1aC1aA1aG1aU1aU1aG3bA6gC!!G1aA1aG1aG1[U8dG1aG1aG1aG1aU1aU1zU2[A4aU1aC!!G1aA1aG1bA!!U!!U6pU2aC1mG1aG1aC1aG1cG1aA!!U2aG1aA1aC1aU!!C1aC1aC1aG1cG1aU1aU1aG!!U!!U!!C1eA!!U1aC!!A!!C1aA1LA1cC!!C1bG!!C!!A1aA3dG1aC1aU!!U!!U1aU!!A1aC1aU5rU2hA1aA1aA1aU1aC1aA1aU1bU!!A1aA1aG1aG1gU1aG1aA1cC1aU1aU1aA1aG1aU1aG1aG1eA1LC1fA1LA1aA1aG1aG1aU1aG!!A1aA1aA!!G1aU1mG1fU!!G1mA1aU!!G!!A" }, "chain_F": { "num_nts": 13, "bseq": "AaGCGCCAGAACU", "sstr": "...[[[[.[((((", "form": "...AAA...AAA-", "helical_rise": 2.637, "helical_rise_std": 1.595, "helical_axis": [ 0.336, -0.914, 0.226 ], "point1": [ 20.707, 41.243, 32.010 ], "point2": [ 31.329, 12.295, 39.176 ], "num_chars": 37, "suite": "A!!a!!G6nC1aG1aC1bC!!A2aG1aA1aA1aC1aU" }, "chain_Q": { "num_nts": 141, "bseq": "gGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA", "sstr": "((((((..........))))))))))..[[[...((((((..]]]......]]]]]...))))))((((((.[[[[[[))))))...(((((((((.....(((((((....)))))))......))))))))).]]]]]]", "form": "AAAAAAA....A....AAAAAAAAA...AA.A..AAAAA...AAA..--...AAA.....AAAAAAAAAA..AAAAA.AAAAA--..AAAAAAAA..BA..AA.AAAA....AAA.AAA.A..AAAAAAAAA...AAAAA-", "helical_rise": 0.238, "helical_rise_std": 3.019, "helical_axis": [ -0.238, 0.393, 0.888 ], "point1": [ 22.226, 32.572, 25.102 ], "point2": [ 15.150, 44.256, 51.515 ], "num_chars": 421, "suite": "g1aG1aC1aA1aC1aC1aA1aU1[U6gG1[C0aA1aC!!U!!C1aC!!G1aG1aU1aG1aC1aC1aA1aG1aU1aU1aG3bA!!C!!G1aA1aG1aG1[U4dG1aG1aG1aG1aU1aU1zU2[A4aU1aC1LG1aA1aG1bA!!U!!U6pU2aC1aG1aG1aC1aG!!G1aA!!U2aG1aA1aC1aU!!C1aC1aC1aG1cG1aU1aU1aG!!U!!U1aC1LA!!U1aC!!A1aC1aA1aA1aC1aC1bG!!C!!A!!A3dG1aC1aU1aU1aU1aU1aA1cC1aU3bU2hA1aA!!A1aU1aC1aA1LU1aU1aA1aA1aG1aG1gU1LG1aA1cC1aU1aU1aA1cG1aU1aG1aG1aA1aC1fA1aA1aA1aG1aG1aU1aG1aA1aA1aA1aG1aU1aG1eU!!G!!A1aU1aG1bA" }, "chain_G": { "num_nts": 13, "bseq": "AaGCGCCAGAACU", "sstr": "...[[[[.[((((", "form": "...AAA....AA-", "helical_rise": 2.606, "helical_rise_std": 1.647, "helical_axis": [ 0.358, 0.901, -0.245 ], "point1": [ 20.770, 20.029, 69.664 ], "point2": [ 31.915, 48.123, 62.031 ], "num_chars": 37, "suite": "A3ba!!G6nC1aG1aC1bC!!A2aG1aA1aA1aC!!U" }, "chain_R": { "num_nts": 141, "bseq": "gGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA", "sstr": "((((((..........))))))))))..[[[...((((((..]]]......]]]]]...))))))((((((.[[[[[[))))))...(((((((((.....(((((((....)))))))......))))))))).]]]]]]", "form": "AAAAAAA....A....AAA..AAAA...AA.A..AAAAA...AAA.......AAA.....AAAAAAAAAA..AAAAA.AAAAA--..AAAAAAAA..BA..AA.AAAA....AAA.AAA.A..AAAAAAAAA...AAAAA-", "helical_rise": 0.243, "helical_rise_std": 3.098, "helical_axis": [ -0.234, -0.457, -0.858 ], "point1": [ 22.544, 30.026, 78.021 ], "point2": [ 14.734, 14.753, 49.313 ], "num_chars": 421, "suite": "g1aG!!C!!A1aC!!C1aA1aU1[U6gG1[C0aA1aC!!U!!C!!C!!G1aG1aU1cG!!C1aC1aA1aG1aU1aU1aG3bA!!C1LG1aA1aG1aG1[U4dG1aG1aG1aG1aU1aU1zU2[A4aU1aC!!G1aA1aG1aA!!U!!U6pU2aC1aG1aG1aC1aG1cG1aA!!U2aG1aA1aC1aU1cC1aC1aC1aG1cG1aU1aU1aG!!U!!U1aC1aA1aU!!C1LA1aC1aA1aA1aC1aC1bG!!C0iA!!A3dG1aC1aU1aU1aU1aU1aA!!C1aU3bU2hA1aA1aA1aU1aC1aA1aU1aU1aA1aA1aG!!G1gU1aG1aA1cC1aU!!U1aA1cG1aU1aG1aG1aA1aC1fA1aA1aA1aG1aG1aU1aG1aA1aA1aA1aG1aU1aG!!U!!G1aA1aU1aG1aA" }, "chain_H": { "num_nts": 13, "bseq": "AaGCGCCAGAACU", "sstr": "...[[[[.[((((", "form": "...AAA--.AAA-", "helical_rise": 2.617, "helical_rise_std": 1.569, "helical_axis": [ -0.153, 0.985, 0.078 ], "point1": [ 23.252, 21.455, 86.066 ], "point2": [ 18.557, 51.769, 88.467 ], "num_chars": 37, "suite": "A!!a!!G6nC1aG1aC1bC4nA1aG1aA1LA1aC1aU" }, "chain_S": { "num_nts": 141, "bseq": "gGCACCAUUGCACUCCGGUGCCAGUUGACGAGGUGGGGUUUAUCGAGAUUUCGGCGGAUGACUCCCGGUUGUUCAUCACAACCGCAAGCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAGGUGAAAGUGUGAUGA", "sstr": "((((((..........))))))))))..[[[...((((((..]]]......]]]]]...))))))((((((.[[[[[[))))))...(((((((((.....(((((((....)))))))......))))))))).]]]]]]", "form": "AAAAAAA....A--..A.AAAAAAA...AA.A..AAAAA...AAAA.--...AAA.....AAAA.AA.AA..AA.AAAAA.AA....AAA...AA...A..A..BAAA....AAAAAAA.A..AAAAAA.......AAA.-", "helical_rise": 0.302, "helical_rise_std": 3.140, "helical_axis": [ 0.083, -0.449, 0.889 ], "point1": [ 20.836, 31.891, 72.723 ], "point2": [ 24.353, 12.926, 110.262 ], "num_chars": 421, "suite": "g1aG1cC!!A1aC1aC1aA1aU1[U6gG!!C0aA1aC!!U7aC!!C!!G1aG1aU!!G1aC1aC1aA1aG1aU1aU1aG3bA!!C!!G1aA1aG1aG1bU8dG1aG1aG1aG1aU1aU1zU2[A4aU1aC!!G1aA1aG1bA!!U2zU6pU2aC1mG1aG1aC1aG1cG1aA!!U2aG1aA1aC1aU!!C1eC1aC1aG1cG1aU1aU1aG!!U!!U1aC1eA!!U1aC!!A1aC1aA!!A!!C1aC1bG!!C!!A1aA!!G1aC!!U1aU!!U1aU1LA1aC1aU3bU2hA1aA1aA1aU1aC1aA!!U!!U!!A1aA1aG1aG1gU1aG1aA1cC1aU1aU1aA1aG1aU1aG1aG!!A1aC1fA1aA1aA1aG!!G1aU1aG!!A1aA1aA!!G1aU1mG1fU!!G1aA!!U!!G1cA" } }, "num_nts": 616, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "E", "nt_resnum": -1, "nt_name": "A", "nt_code": "A", "nt_id": "///E/-1", "linked_nts": [ null, "///E/0" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,BII,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,splayed-apart", "alpha": null, "beta": null, "gamma": null, "delta": null, "epsilon": -106.599, "zeta": 141.866, "epsilon_zeta": 111.535, "bb_type": "BII", "chi": -122.706, "glyco_bond": "anti", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 1.262, "Dp": 2.534, "splay_angle": 86.496, "splay_distance": 13.838, "splay_ratio": 0.686, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 19.895, "v1": 1.805, "v2": -21.327, "v3": 33.482, "v4": -32.616, "amplitude": 34.686, "phase_angle": 232.059, "puckering": "C4'-endo", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.014, "origin": [ 24.225, 36.870, 29.095 ], "x_axis": [ 0.860, 0.002, 0.511 ], "y_axis": [ 0.477, 0.358, -0.803 ], "z_axis": [ -0.184, 0.934, 0.307 ], "quaternion": [ 0.795, -0.546, -0.219, -0.149 ] } }, { "index": 2, "index_chain": 2, "chain_name": "E", "nt_resnum": 0, "nt_name": "A2M", "nt_code": "a", "is_modified": true, "nt_id": "///E/0", "linked_nts": [ "///E/-1", "///E/1" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,splayed-apart", "alpha": -53.172, "beta": 161.779, "gamma": 44.717, "delta": 144.271, "epsilon": -169.417, "zeta": 120.870, "epsilon_zeta": 69.713, "bb_type": "--", "chi": -126.334, "glyco_bond": "anti", "C5prime_xyz": [ -2.638, 8.676, -0.878 ], "P_xyz": [ -0.362, 9.702, 0.028 ], "form": ".", "ssZp": 2.333, "Dp": 2.591, "splay_angle": 111.983, "splay_distance": 14.476, "splay_ratio": 0.829, "d22": null, "d64": null, "eta": -160.782, "theta": 119.384, "eta_prime": -150.158, "theta_prime": 91.049, "eta_base": -148.117, "theta_base": 147.272, "v0": -33.094, "v1": 44.075, "v2": -37.728, "v3": 19.665, "v4": 8.239, "amplitude": 43.356, "phase_angle": 150.482, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.048, "origin": [ 15.099, 38.700, 18.854 ], "x_axis": [ -0.243, 0.458, 0.855 ], "y_axis": [ 0.950, 0.290, 0.114 ], "z_axis": [ -0.195, 0.840, -0.506 ], "quaternion": [ -0.368, 0.493, 0.714, 0.334 ] } }, { "index": 3, "index_chain": 3, "chain_name": "E", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///E/1", "linked_nts": [ "///E/0", "///E/2" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -38.165, "beta": 109.681, "gamma": 161.856, "delta": 140.113, "epsilon": -82.985, "zeta": 92.484, "epsilon_zeta": 184.530, "bb_type": "--", "chi": -73.310, "glyco_bond": "--", "C5prime_xyz": [ -3.163, 6.880, -3.033 ], "P_xyz": [ -4.028, 5.682, -5.201 ], "form": ".", "ssZp": 0.075, "Dp": 0.722, "splay_angle": 40.494, "splay_distance": 7.313, "splay_ratio": 0.347, "d22": null, "d64": null, "eta": -9.057, "theta": 62.028, "eta_prime": -38.014, "theta_prime": 53.254, "eta_base": -105.974, "theta_base": 61.313, "v0": -28.227, "v1": 38.350, "v2": -33.738, "v3": 18.628, "v4": 5.720, "amplitude": 37.978, "phase_angle": 152.667, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.031, "frame": { "rmsd": 0.031, "origin": [ 21.747, 34.269, 6.782 ], "x_axis": [ 0.301, 0.338, -0.892 ], "y_axis": [ 0.766, 0.471, 0.438 ], "z_axis": [ 0.568, -0.815, -0.117 ], "quaternion": [ 0.643, 0.487, 0.567, -0.166 ] } }, { "index": 4, "index_chain": 4, "chain_name": "E", "nt_resnum": 2, "nt_name": "C", "nt_code": "C", "nt_id": "///E/2", "linked_nts": [ "///E/1", "///E/3" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor,phosphate", "alpha": 42.759, "beta": 172.092, "gamma": -159.037, "delta": 82.975, "epsilon": -153.375, "zeta": -68.047, "epsilon_zeta": -85.328, "bb_type": "BI", "chi": -169.617, "glyco_bond": "anti", "C5prime_xyz": [ -0.930, 8.372, 1.252 ], "P_xyz": [ -0.005, 10.776, 0.667 ], "form": "A", "ssZp": 4.552, "Dp": 4.639, "splay_angle": 23.670, "splay_distance": 3.664, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 130.612, "theta": 166.105, "eta_prime": 108.429, "theta_prime": 179.958, "eta_base": 124.173, "theta_base": -159.262, "v0": 18.489, "v1": -40.565, "v2": 45.946, "v3": -35.912, "v4": 11.169, "amplitude": 46.110, "phase_angle": 355.160, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "6n", "suiteness": 0.109, "filter_rmsd": 0.079, "frame": { "rmsd": 0.023, "origin": [ 16.646, 33.919, 12.011 ], "x_axis": [ 0.346, 0.004, -0.938 ], "y_axis": [ 0.902, 0.275, 0.334 ], "z_axis": [ 0.259, -0.962, 0.091 ], "quaternion": [ 0.654, 0.495, 0.457, -0.343 ] } }, { "index": 5, "index_chain": 5, "chain_name": "E", "nt_resnum": 3, "nt_name": "G", "nt_code": "G", "nt_id": "///E/3", "linked_nts": [ "///E/2", "///E/4" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.620, "beta": -172.163, "gamma": 50.496, "delta": 82.083, "epsilon": -158.201, "zeta": -62.992, "epsilon_zeta": -95.209, "bb_type": "BI", "chi": -159.691, "glyco_bond": "anti", "C5prime_xyz": [ -1.003, 8.646, 0.622 ], "P_xyz": [ 1.555, 8.879, 1.151 ], "form": "A", "ssZp": 4.416, "Dp": 4.601, "splay_angle": 22.715, "splay_distance": 3.583, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 168.667, "theta": -146.372, "eta_prime": 178.616, "theta_prime": -142.748, "eta_base": -160.049, "theta_base": -116.729, "v0": 13.374, "v1": -36.003, "v2": 43.701, "v3": -36.483, "v4": 14.717, "amplitude": 43.705, "phase_angle": 0.776, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.818, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 15.410, 30.483, 12.323 ], "x_axis": [ 0.680, 0.232, -0.696 ], "y_axis": [ 0.672, 0.182, 0.718 ], "z_axis": [ 0.294, -0.955, -0.032 ], "quaternion": [ 0.676, 0.618, 0.366, -0.162 ] } }, { "index": 6, "index_chain": 6, "chain_name": "E", "nt_resnum": 4, "nt_name": "C", "nt_code": "C", "nt_id": "///E/4", "linked_nts": [ "///E/3", "///E/5" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -77.714, "beta": 170.264, "gamma": 70.111, "delta": 82.650, "epsilon": -139.301, "zeta": -72.923, "epsilon_zeta": -66.378, "bb_type": "BI", "chi": -162.570, "glyco_bond": "anti", "C5prime_xyz": [ -1.430, 8.787, 0.725 ], "P_xyz": [ 1.156, 9.157, 0.574 ], "form": "A", "ssZp": 4.340, "Dp": 4.597, "splay_angle": 20.786, "splay_distance": 3.577, "splay_ratio": 0.185, "d22": 4.095, "d64": 4.286, "eta": 176.622, "theta": -135.662, "eta_prime": -167.410, "theta_prime": -129.502, "eta_base": -129.257, "theta_base": -120.932, "v0": 6.518, "v1": -28.554, "v2": 38.963, "v3": -35.743, "v4": 18.663, "amplitude": 39.467, "phase_angle": 9.159, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.487, "filter_rmsd": 0.071, "frame": { "rmsd": 0.012, "origin": [ 16.058, 27.366, 10.681 ], "x_axis": [ 0.929, 0.279, -0.245 ], "y_axis": [ 0.261, -0.022, 0.965 ], "z_axis": [ 0.264, -0.960, -0.093 ], "quaternion": [ 0.673, 0.715, 0.189, 0.007 ] } }, { "index": 7, "index_chain": 7, "chain_name": "E", "nt_resnum": 5, "nt_name": "C", "nt_code": "C", "nt_id": "///E/5", "linked_nts": [ "///E/4", "///E/6" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -47.531, "beta": 175.875, "gamma": 53.468, "delta": 138.995, "epsilon": -130.624, "zeta": 178.921, "epsilon_zeta": 50.455, "bb_type": "BII", "chi": -121.421, "glyco_bond": "anti", "C5prime_xyz": [ -2.461, 8.692, -1.365 ], "P_xyz": [ -0.335, 10.039, -0.642 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -171.662, "theta": -171.057, "eta_prime": -142.063, "theta_prime": 150.531, "eta_base": -127.534, "theta_base": null, "v0": -35.136, "v1": 44.995, "v2": -37.880, "v3": 18.731, "v4": 10.101, "amplitude": 44.437, "phase_angle": 148.479, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.795, "filter_rmsd": 0.071, "frame": { "rmsd": 0.011, "origin": [ 17.363, 24.741, 8.632 ], "x_axis": [ 0.757, 0.618, 0.210 ], "y_axis": [ -0.036, -0.281, 0.959 ], "z_axis": [ 0.652, -0.734, -0.191 ], "quaternion": [ 0.567, 0.747, 0.195, 0.289 ] } }, { "index": 8, "index_chain": 8, "chain_name": "E", "nt_resnum": 6, "nt_name": "A", "nt_code": "A", "nt_id": "///E/6", "linked_nts": [ "///E/5", "///E/7" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-stack,bulge,phosphate", "alpha": 77.260, "beta": -161.240, "gamma": 165.478, "delta": 96.924, "epsilon": -111.590, "zeta": -76.922, "epsilon_zeta": -34.667, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 123.506, "theta": -134.852, "eta_prime": 114.210, "theta_prime": -131.040, "eta_base": null, "theta_base": null, "v0": 25.292, "v1": -40.415, "v2": 39.063, "v3": -24.962, "v4": 0.058, "amplitude": 41.239, "phase_angle": 341.302, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "4n", "suiteness": 0.010, "filter_rmsd": null }, { "index": 9, "index_chain": 9, "chain_name": "E", "nt_resnum": 7, "nt_name": "G", "nt_code": "G", "nt_id": "///E/7", "linked_nts": [ "///E/6", "///E/8" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,junction-loop", "alpha": -75.725, "beta": -179.045, "gamma": 60.519, "delta": 83.406, "epsilon": -135.648, "zeta": -68.578, "epsilon_zeta": -67.070, "bb_type": "BI", "chi": -177.303, "glyco_bond": "anti", "C5prime_xyz": [ -1.521, 8.479, 1.576 ], "P_xyz": [ 0.976, 8.725, 2.254 ], "form": ".", "ssZp": 4.704, "Dp": 4.712, "splay_angle": 31.517, "splay_distance": 4.738, "splay_ratio": 0.272, "d22": null, "d64": null, "eta": 168.858, "theta": -125.788, "eta_prime": -171.478, "theta_prime": -120.480, "eta_base": null, "theta_base": -65.532, "v0": 6.076, "v1": -27.411, "v2": 37.194, "v3": -34.599, "v4": 18.193, "amplitude": 37.719, "phase_angle": 9.572, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.157, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 19.300, 20.886, 5.609 ], "x_axis": [ 0.184, 0.096, 0.978 ], "y_axis": [ -0.876, -0.436, 0.208 ], "z_axis": [ 0.447, -0.895, 0.003 ], "quaternion": [ 0.433, 0.636, -0.307, 0.560 ] } }, { "index": 10, "index_chain": 10, "chain_name": "E", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///E/8", "linked_nts": [ "///E/7", "///E/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop", "alpha": -52.964, "beta": 170.737, "gamma": 40.665, "delta": 81.219, "epsilon": -132.044, "zeta": -84.959, "epsilon_zeta": -47.086, "bb_type": "BI", "chi": -159.796, "glyco_bond": "anti", "C5prime_xyz": [ -1.057, 8.597, 0.585 ], "P_xyz": [ 1.568, 8.573, 1.008 ], "form": "A", "ssZp": 4.335, "Dp": 4.762, "splay_angle": 21.886, "splay_distance": 3.380, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 168.300, "theta": -143.678, "eta_prime": -170.256, "theta_prime": -138.611, "eta_base": -96.385, "theta_base": -106.655, "v0": 12.053, "v1": -34.623, "v2": 43.269, "v3": -36.866, "v4": 15.715, "amplitude": 43.312, "phase_angle": 2.539, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.628, "filter_rmsd": 0.040, "frame": { "rmsd": 0.010, "origin": [ 20.539, 17.855, 9.034 ], "x_axis": [ -0.673, -0.342, 0.656 ], "y_axis": [ -0.563, -0.337, -0.754 ], "z_axis": [ 0.479, -0.877, 0.034 ], "quaternion": [ 0.077, 0.397, -0.570, 0.715 ] } }, { "index": 11, "index_chain": 11, "chain_name": "E", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///E/9", "linked_nts": [ "///E/8", "///E/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.792, "beta": 155.788, "gamma": 56.118, "delta": 80.492, "epsilon": -146.711, "zeta": -75.111, "epsilon_zeta": -71.600, "bb_type": "BI", "chi": -161.464, "glyco_bond": "anti", "C5prime_xyz": [ -1.239, 8.623, 0.667 ], "P_xyz": [ 1.336, 8.650, 0.343 ], "form": "A", "ssZp": 4.466, "Dp": 4.682, "splay_angle": 23.170, "splay_distance": 3.585, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 163.739, "theta": -140.555, "eta_prime": 179.895, "theta_prime": -142.107, "eta_base": -133.231, "theta_base": -113.788, "v0": 8.853, "v1": -32.570, "v2": 42.817, "v3": -38.903, "v4": 18.996, "amplitude": 43.151, "phase_angle": 7.127, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.693, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 21.395, 14.821, 10.252 ], "x_axis": [ -0.945, -0.307, 0.115 ], "y_axis": [ -0.049, -0.213, -0.976 ], "z_axis": [ 0.324, -0.927, 0.187 ], "quaternion": [ -0.084, 0.143, -0.621, 0.766 ] } }, { "index": 12, "index_chain": 12, "chain_name": "E", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///E/10", "linked_nts": [ "///E/9", "///E/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper", "alpha": -61.479, "beta": 168.715, "gamma": 51.730, "delta": 79.602, "epsilon": -144.153, "zeta": -76.619, "epsilon_zeta": -67.534, "bb_type": "BI", "chi": -159.743, "glyco_bond": "anti", "C5prime_xyz": [ -1.288, 8.757, 0.542 ], "P_xyz": [ 1.343, 8.935, 0.371 ], "form": "A", "ssZp": 4.456, "Dp": 4.741, "splay_angle": 24.497, "splay_distance": 3.864, "splay_ratio": 0.214, "d22": 4.093, "d64": 4.213, "eta": 166.908, "theta": -146.707, "eta_prime": -179.471, "theta_prime": -143.663, "eta_base": -132.559, "theta_base": -126.197, "v0": 10.170, "v1": -33.875, "v2": 43.778, "v3": -39.009, "v4": 18.223, "amplitude": 43.987, "phase_angle": 5.590, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.968, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ 21.108, 11.654, 11.908 ], "x_axis": [ -0.814, -0.314, -0.489 ], "y_axis": [ 0.541, -0.103, -0.835 ], "z_axis": [ 0.212, -0.944, 0.254 ], "quaternion": [ -0.290, -0.094, -0.603, 0.737 ] } }, { "index": 13, "index_chain": 13, "chain_name": "E", "nt_resnum": 11, "nt_name": "U", "nt_code": "U", "nt_id": "///E/11", "linked_nts": [ "///E/10", null ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,ribose-zipper", "alpha": -77.989, "beta": 172.176, "gamma": 75.639, "delta": 87.236, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -164.615, "glyco_bond": "anti", "C5prime_xyz": [ -1.716, 8.736, 0.755 ], "P_xyz": [ 0.820, 9.221, 0.737 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -2.444, "v1": -18.276, "v2": 30.479, "v3": -32.764, "v4": 22.513, "amplitude": 33.064, "phase_angle": 22.807, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.266, "filter_rmsd": 0.108, "frame": { "rmsd": 0.008, "origin": [ 20.220, 8.228, 13.458 ], "x_axis": [ -0.509, 0.025, -0.861 ], "y_axis": [ 0.861, -0.014, -0.509 ], "z_axis": [ -0.025, -1.000, -0.014 ], "quaternion": [ -0.340, -0.360, -0.614, 0.614 ] } }, { "index": 14, "index_chain": 1, "chain_name": "P", "nt_resnum": 12, "nt_name": "GTP", "nt_code": "g", "is_modified": true, "nt_id": "///P/12", "linked_nts": [ null, "///P/13" ], "nt_type": "RNA", "dbn": "(", "summary": "modified,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 99.465, "delta": 80.053, "epsilon": -124.912, "zeta": -85.213, "epsilon_zeta": -39.699, "bb_type": "BI", "chi": 176.083, "glyco_bond": "anti", "C5prime_xyz": [ -1.383, 8.191, 1.944 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 5.053, "Dp": 5.043, "splay_angle": 24.690, "splay_distance": 3.821, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 14.095, "v1": -34.793, "v2": 40.912, "v3": -33.385, "v4": 12.395, "amplitude": 40.924, "phase_angle": 358.586, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.061, "origin": [ 17.963, 5.296, 14.082 ], "x_axis": [ 0.026, -0.004, -1.000 ], "y_axis": [ 0.992, -0.122, 0.026 ], "z_axis": [ -0.122, -0.993, 0.001 ], "quaternion": [ 0.476, 0.535, 0.461, -0.524 ] } }, { "index": 15, "index_chain": 2, "chain_name": "P", "nt_resnum": 13, "nt_name": "G", "nt_code": "G", "nt_id": "///P/13", "linked_nts": [ "///P/12", "///P/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -101.257, "beta": -161.105, "gamma": 70.185, "delta": 82.532, "epsilon": -146.942, "zeta": -79.714, "epsilon_zeta": -67.228, "bb_type": "BI", "chi": -171.150, "glyco_bond": "anti", "C5prime_xyz": [ -1.460, 8.570, 1.237 ], "P_xyz": [ 1.128, 8.902, 1.755 ], "form": "A", "ssZp": 4.651, "Dp": 4.693, "splay_angle": 21.495, "splay_distance": 3.302, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 167.872, "theta": -147.304, "eta_prime": -177.440, "theta_prime": -144.701, "eta_base": -134.591, "theta_base": -112.226, "v0": 10.558, "v1": -33.053, "v2": 42.024, "v3": -37.055, "v4": 16.714, "amplitude": 42.153, "phase_angle": 4.491, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.058, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 15.660, 2.431, 13.038 ], "x_axis": [ 0.606, -0.032, -0.795 ], "y_axis": [ 0.787, -0.121, 0.605 ], "z_axis": [ -0.116, -0.992, -0.048 ], "quaternion": [ 0.599, 0.666, 0.283, -0.342 ] } }, { "index": 16, "index_chain": 3, "chain_name": "P", "nt_resnum": 14, "nt_name": "C", "nt_code": "C", "nt_id": "///P/14", "linked_nts": [ "///P/13", "///P/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -56.004, "beta": 171.184, "gamma": 44.696, "delta": 78.031, "epsilon": -158.089, "zeta": -71.329, "epsilon_zeta": -86.760, "bb_type": "BI", "chi": -151.799, "glyco_bond": "anti", "C5prime_xyz": [ -0.980, 8.718, 0.108 ], "P_xyz": [ 1.671, 8.851, 0.050 ], "form": "A", "ssZp": 4.282, "Dp": 4.669, "splay_angle": 22.290, "splay_distance": 3.479, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 167.035, "theta": -153.762, "eta_prime": 179.244, "theta_prime": -153.214, "eta_base": -133.941, "theta_base": -148.058, "v0": 16.271, "v1": -39.481, "v2": 46.427, "v3": -38.007, "v4": 13.963, "amplitude": 46.443, "phase_angle": 358.484, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.793, "filter_rmsd": 0.075, "frame": { "rmsd": 0.014, "origin": [ 14.884, -0.216, 11.224 ], "x_axis": [ 0.951, -0.180, -0.251 ], "y_axis": [ 0.200, -0.259, 0.945 ], "z_axis": [ -0.235, -0.949, -0.210 ], "quaternion": [ 0.609, 0.778, 0.006, -0.156 ] } }, { "index": 17, "index_chain": 4, "chain_name": "P", "nt_resnum": 15, "nt_name": "A", "nt_code": "A", "nt_id": "///P/15", "linked_nts": [ "///P/14", "///P/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -78.493, "beta": -178.020, "gamma": 58.784, "delta": 76.579, "epsilon": -152.489, "zeta": -64.773, "epsilon_zeta": -87.715, "bb_type": "BI", "chi": -155.212, "glyco_bond": "anti", "C5prime_xyz": [ -1.305, 8.694, 0.300 ], "P_xyz": [ 1.312, 9.037, 0.201 ], "form": "A", "ssZp": 4.314, "Dp": 4.696, "splay_angle": 21.325, "splay_distance": 3.463, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 166.943, "theta": -144.618, "eta_prime": 174.371, "theta_prime": -143.939, "eta_base": -169.354, "theta_base": -119.637, "v0": 8.939, "v1": -33.991, "v2": 44.672, "v3": -40.728, "v4": 20.207, "amplitude": 45.054, "phase_angle": 7.460, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.757, "filter_rmsd": 0.035, "frame": { "rmsd": 0.005, "origin": [ 13.453, -2.680, 9.229 ], "x_axis": [ 0.989, -0.035, 0.145 ], "y_axis": [ -0.149, -0.321, 0.935 ], "z_axis": [ 0.013, -0.946, -0.323 ], "quaternion": [ 0.580, 0.811, -0.057, 0.049 ] } }, { "index": 18, "index_chain": 5, "chain_name": "P", "nt_resnum": 16, "nt_name": "C", "nt_code": "C", "nt_id": "///P/16", "linked_nts": [ "///P/15", "///P/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -64.386, "beta": 176.152, "gamma": 53.504, "delta": 76.588, "epsilon": -167.042, "zeta": -55.244, "epsilon_zeta": -111.798, "bb_type": "BI", "chi": -154.414, "glyco_bond": "anti", "C5prime_xyz": [ -1.382, 8.863, 0.189 ], "P_xyz": [ 1.158, 9.446, 0.099 ], "form": "A", "ssZp": 4.303, "Dp": 4.583, "splay_angle": 21.250, "splay_distance": 3.431, "splay_ratio": 0.186, "d22": 3.904, "d64": 3.858, "eta": 170.928, "theta": -145.461, "eta_prime": -175.070, "theta_prime": -144.850, "eta_base": -135.733, "theta_base": -112.125, "v0": 2.213, "v1": -28.276, "v2": 41.799, "v3": -41.956, "v4": 25.230, "amplitude": 43.467, "phase_angle": 15.922, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.879, "filter_rmsd": 0.069, "frame": { "rmsd": 0.008, "origin": [ 15.118, -4.950, 7.210 ], "x_axis": [ 0.767, -0.063, 0.639 ], "y_axis": [ -0.602, -0.415, 0.682 ], "z_axis": [ 0.222, -0.908, -0.356 ], "quaternion": [ 0.499, 0.797, -0.209, 0.270 ] } }, { "index": 19, "index_chain": 6, "chain_name": "P", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///P/17", "linked_nts": [ "///P/16", "///P/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop", "alpha": -89.408, "beta": -175.496, "gamma": 62.657, "delta": 80.968, "epsilon": -130.015, "zeta": -73.247, "epsilon_zeta": -56.768, "bb_type": "BI", "chi": -156.800, "glyco_bond": "anti", "C5prime_xyz": [ -1.397, 8.895, 0.302 ], "P_xyz": [ 1.218, 9.375, 0.239 ], "form": ".", "ssZp": 4.292, "Dp": 4.762, "splay_angle": 27.987, "splay_distance": 4.465, "splay_ratio": 0.242, "d22": null, "d64": null, "eta": 168.187, "theta": -133.627, "eta_prime": -178.876, "theta_prime": -132.041, "eta_base": -133.489, "theta_base": -92.853, "v0": 4.527, "v1": -28.304, "v2": 39.796, "v3": -37.906, "v4": 21.326, "amplitude": 40.710, "phase_angle": 12.165, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.369, "filter_rmsd": 0.073, "frame": { "rmsd": 0.013, "origin": [ 17.575, -7.279, 6.652 ], "x_axis": [ 0.223, -0.121, 0.967 ], "y_axis": [ -0.884, -0.444, 0.148 ], "z_axis": [ 0.411, -0.888, -0.206 ], "quaternion": [ 0.379, 0.684, -0.367, 0.504 ] } }, { "index": 20, "index_chain": 7, "chain_name": "P", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///P/17", "linked_nts": [ "///P/17", "///P/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -70.506, "beta": 156.207, "gamma": 62.755, "delta": 77.168, "epsilon": -139.123, "zeta": -73.830, "epsilon_zeta": -65.293, "bb_type": "BI", "chi": -171.953, "glyco_bond": "anti", "C5prime_xyz": [ -1.427, 8.537, 1.209 ], "P_xyz": [ 1.061, 9.100, 0.741 ], "form": "A", "ssZp": 4.739, "Dp": 4.810, "splay_angle": 24.169, "splay_distance": 3.822, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 158.707, "theta": -139.509, "eta_prime": 178.602, "theta_prime": -138.748, "eta_base": -122.027, "theta_base": -101.436, "v0": 6.452, "v1": -32.464, "v2": 44.438, "v3": -42.041, "v4": 22.590, "amplitude": 45.216, "phase_angle": 10.648, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.653, "filter_rmsd": 0.035, "frame": { "rmsd": 0.008, "origin": [ 19.278, -10.779, 8.838 ], "x_axis": [ -0.537, -0.140, 0.832 ], "y_axis": [ -0.779, -0.295, -0.553 ], "z_axis": [ 0.323, -0.945, 0.049 ], "quaternion": [ 0.233, 0.421, -0.546, 0.686 ] } }, { "index": 21, "index_chain": 8, "chain_name": "P", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///P/17", "linked_nts": [ "///P/17", "///P/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop", "alpha": -51.886, "beta": 171.373, "gamma": 42.924, "delta": 78.412, "epsilon": -138.911, "zeta": -80.121, "epsilon_zeta": -58.790, "bb_type": "BI", "chi": -155.451, "glyco_bond": "anti", "C5prime_xyz": [ -1.239, 8.805, 0.239 ], "P_xyz": [ 1.365, 9.227, 0.287 ], "form": ".", "ssZp": 4.312, "Dp": 4.790, "splay_angle": 51.832, "splay_distance": 8.397, "splay_ratio": 0.440, "d22": 6.009, "d64": 7.112, "eta": 171.094, "theta": -153.458, "eta_prime": -175.014, "theta_prime": -139.875, "eta_base": -121.801, "theta_base": -130.906, "v0": 6.231, "v1": -30.657, "v2": 42.104, "v3": -39.289, "v4": 21.047, "amplitude": 42.788, "phase_angle": 10.257, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.688, "filter_rmsd": 0.111, "frame": { "rmsd": 0.010, "origin": [ 19.584, -13.289, 11.706 ], "x_axis": [ -0.943, -0.242, 0.227 ], "y_axis": [ -0.143, -0.320, -0.937 ], "z_axis": [ 0.299, -0.916, 0.267 ], "quaternion": [ -0.031, 0.165, -0.582, 0.795 ] } }, { "index": 22, "index_chain": 9, "chain_name": "P", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///P/17", "linked_nts": [ "///P/17", "///P/17" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor", "alpha": -54.309, "beta": -150.936, "gamma": 56.807, "delta": 137.221, "epsilon": -77.467, "zeta": 86.186, "epsilon_zeta": 196.347, "bb_type": "--", "chi": -135.730, "glyco_bond": "anti", "C5prime_xyz": [ -2.139, 8.849, -0.523 ], "P_xyz": [ -0.364, 9.982, 1.056 ], "form": ".", "ssZp": 0.605, "Dp": 0.617, "splay_angle": 30.897, "splay_distance": 5.324, "splay_ratio": 0.297, "d22": null, "d64": null, "eta": -127.718, "theta": 100.542, "eta_prime": -121.882, "theta_prime": 84.607, "eta_base": -128.572, "theta_base": 72.708, "v0": -27.127, "v1": 38.399, "v2": -34.450, "v3": 19.599, "v4": 4.548, "amplitude": 38.155, "phase_angle": 154.543, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.771, "filter_rmsd": 0.110, "frame": { "rmsd": 0.009, "origin": [ 21.174, -20.809, 15.085 ], "x_axis": [ -0.896, 0.440, 0.066 ], "y_axis": [ 0.060, 0.265, -0.962 ], "z_axis": [ -0.441, -0.858, -0.264 ], "quaternion": [ -0.163, 0.160, 0.779, -0.585 ] } }, { "index": 23, "index_chain": 10, "chain_name": "P", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///P/17", "linked_nts": [ "///P/17", "///P/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart", "alpha": -147.768, "beta": 158.274, "gamma": 73.813, "delta": 88.081, "epsilon": -117.630, "zeta": -70.168, "epsilon_zeta": -47.463, "bb_type": "--", "chi": -97.553, "glyco_bond": "anti", "C5prime_xyz": [ -1.817, 7.558, -2.698 ], "P_xyz": [ -0.118, 6.456, -4.305 ], "form": ".", "ssZp": 0.131, "Dp": 4.714, "splay_angle": 97.494, "splay_distance": 14.932, "splay_ratio": 0.752, "d22": null, "d64": null, "eta": 150.215, "theta": -127.338, "eta_prime": 153.441, "theta_prime": -124.199, "eta_base": 143.535, "theta_base": -105.515, "v0": 13.591, "v1": -31.710, "v2": 36.662, "v3": -29.742, "v4": 10.389, "amplitude": 36.700, "phase_angle": 357.377, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6g", "suiteness": 0.301, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 23.853, -17.260, 12.159 ], "x_axis": [ 0.248, -0.651, 0.718 ], "y_axis": [ 0.821, -0.252, -0.512 ], "z_axis": [ 0.514, 0.716, 0.472 ], "quaternion": [ 0.606, -0.507, -0.084, -0.607 ] } }, { "index": 24, "index_chain": 11, "chain_name": "P", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///P/17", "linked_nts": [ "///P/17", "///P/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -43.799, "beta": -126.007, "gamma": 62.372, "delta": 143.616, "epsilon": -147.487, "zeta": 147.679, "epsilon_zeta": 64.834, "bb_type": "--", "chi": -126.635, "glyco_bond": "anti", "C5prime_xyz": [ -1.946, 8.779, -0.907 ], "P_xyz": [ -0.297, 9.616, 0.954 ], "form": ".", "ssZp": 1.534, "Dp": 1.658, "splay_angle": 51.474, "splay_distance": 8.040, "splay_ratio": 0.437, "d22": null, "d64": null, "eta": -127.160, "theta": 136.111, "eta_prime": -107.164, "theta_prime": 121.887, "eta_base": -124.219, "theta_base": 141.565, "v0": -25.736, "v1": 39.068, "v2": -38.275, "v3": 24.399, "v4": 0.694, "amplitude": 40.538, "phase_angle": 160.767, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.488, "filter_rmsd": 0.067, "frame": { "rmsd": 0.006, "origin": [ 37.766, -22.586, 13.175 ], "x_axis": [ -0.608, -0.780, 0.152 ], "y_axis": [ -0.663, 0.393, -0.637 ], "z_axis": [ 0.437, -0.488, -0.756 ], "quaternion": [ 0.086, -0.435, 0.830, -0.339 ] } }, { "index": 25, "index_chain": 12, "chain_name": "P", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///P/17", "linked_nts": [ "///P/17", "///P/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate", "alpha": -69.428, "beta": 124.313, "gamma": 64.460, "delta": 84.623, "epsilon": -151.571, "zeta": -61.077, "epsilon_zeta": -90.494, "bb_type": "BI", "chi": -170.176, "glyco_bond": "anti", "C5prime_xyz": [ -1.706, 8.661, 1.101 ], "P_xyz": [ 0.849, 8.675, 0.481 ], "form": "A", "ssZp": 4.392, "Dp": 4.447, "splay_angle": 20.927, "splay_distance": 3.367, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 174.490, "theta": -123.736, "eta_prime": 178.177, "theta_prime": -131.769, "eta_base": -171.367, "theta_base": -96.352, "v0": 1.165, "v1": -23.113, "v2": 34.977, "v3": -35.037, "v4": 21.635, "amplitude": 36.526, "phase_angle": 16.748, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.317, "filter_rmsd": 0.039, "frame": { "rmsd": 0.007, "origin": [ 40.592, -15.147, 14.315 ], "x_axis": [ 0.485, -0.836, -0.255 ], "y_axis": [ -0.492, -0.019, -0.870 ], "z_axis": [ 0.723, 0.548, -0.421 ], "quaternion": [ 0.511, -0.694, 0.479, -0.169 ] } }, { "index": 26, "index_chain": 13, "chain_name": "P", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///P/17", "linked_nts": [ "///P/17", "///P/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,BII,non-pair-contact,hairpin-loop", "alpha": -81.842, "beta": -168.596, "gamma": 54.182, "delta": 102.705, "epsilon": -125.169, "zeta": 141.045, "epsilon_zeta": 93.786, "bb_type": "BII", "chi": -142.146, "glyco_bond": "anti", "C5prime_xyz": [ -1.397, 8.822, -0.447 ], "P_xyz": [ 1.145, 9.336, 0.091 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 175.619, "theta": 98.769, "eta_prime": -167.531, "theta_prime": 72.905, "eta_base": -115.810, "theta_base": null, "v0": -8.090, "v1": -2.399, "v2": 11.165, "v3": -16.017, "v4": 15.262, "amplitude": 16.400, "phase_angle": 47.095, "puckering": "C4'-exo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.089, "filter_rmsd": 0.067, "frame": { "rmsd": 0.006, "origin": [ 43.710, -15.167, 13.043 ], "x_axis": [ -0.182, -0.671, -0.719 ], "y_axis": [ -0.543, 0.678, -0.495 ], "z_axis": [ 0.820, 0.300, -0.488 ], "quaternion": [ 0.502, -0.396, 0.766, -0.064 ] } }, { "index": 27, "index_chain": 14, "chain_name": "P", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///P/17", "linked_nts": [ "///P/17", "///P/17" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-stack,hairpin-loop", "alpha": 146.696, "beta": 156.490, "gamma": -42.414, "delta": 93.917, "epsilon": -117.864, "zeta": -149.453, "epsilon_zeta": 31.588, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -26.367, "theta": 176.704, "eta_prime": -17.768, "theta_prime": 174.910, "eta_base": null, "theta_base": null, "v0": 21.374, "v1": -36.190, "v2": 36.511, "v3": -24.973, "v4": 2.531, "amplitude": 37.795, "phase_angle": 345.024, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null }, { "index": 28, "index_chain": 15, "chain_name": "P", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///P/17", "linked_nts": [ "///P/17", "///P/17" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-stack,hairpin-loop", "alpha": 80.953, "beta": -125.131, "gamma": -157.649, "delta": 91.549, "epsilon": -117.594, "zeta": -56.438, "epsilon_zeta": -61.156, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 171.559, "theta": -128.861, "eta_prime": 163.685, "theta_prime": -121.328, "eta_base": null, "theta_base": null, "v0": 13.187, "v1": -28.654, "v2": 32.656, "v3": -25.742, "v4": 8.104, "amplitude": 32.759, "phase_angle": 355.452, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null }, { "index": 29, "index_chain": 16, "chain_name": "P", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///P/17", "linked_nts": [ "///P/17", "///P/17" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,BII,non-stack,hairpin-loop,phosphate,splayed-apart", "alpha": -89.561, "beta": -155.692, "gamma": 45.150, "delta": 142.880, "epsilon": -87.754, "zeta": 159.343, "epsilon_zeta": 112.903, "bb_type": "BII", "chi": -66.204, "glyco_bond": "--", "C5prime_xyz": [ -2.608, 6.679, -3.121 ], "P_xyz": [ -0.248, 7.784, -3.706 ], "form": ".", "ssZp": -0.822, "Dp": 1.407, "splay_angle": 153.361, "splay_distance": 19.372, "splay_ratio": 0.973, "d22": null, "d64": null, "eta": 162.964, "theta": -161.769, "eta_prime": -160.181, "theta_prime": -172.805, "eta_base": null, "theta_base": 142.917, "v0": -3.664, "v1": 19.822, "v2": -27.431, "v3": 26.038, "v4": -14.220, "amplitude": 27.967, "phase_angle": 191.236, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.265, "filter_rmsd": 0.068, "frame": { "rmsd": 0.008, "origin": [ 34.062, 1.960, 3.509 ], "x_axis": [ 0.960, -0.203, 0.191 ], "y_axis": [ -0.249, -0.934, 0.256 ], "z_axis": [ 0.126, -0.293, -0.948 ], "quaternion": [ 0.140, 0.980, -0.115, 0.081 ] } }, { "index": 30, "index_chain": 17, "chain_name": "P", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///P/17", "linked_nts": [ "///P/17", "///P/18" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart", "alpha": 33.345, "beta": 142.256, "gamma": 68.654, "delta": 77.757, "epsilon": -157.847, "zeta": -65.989, "epsilon_zeta": -91.858, "bb_type": "BI", "chi": -167.002, "glyco_bond": "anti", "C5prime_xyz": [ -1.585, 8.771, 0.927 ], "P_xyz": [ 0.856, 9.275, 0.079 ], "form": "A", "ssZp": 4.592, "Dp": 4.640, "splay_angle": 26.454, "splay_distance": 4.210, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": -59.018, "theta": -144.592, "eta_prime": -56.762, "theta_prime": -149.684, "eta_base": 14.584, "theta_base": -128.686, "v0": 2.511, "v1": -28.454, "v2": 41.819, "v3": -41.768, "v4": 24.794, "amplitude": 43.389, "phase_angle": 15.460, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 17.570, -7.953, 5.745 ], "x_axis": [ 0.113, 0.020, 0.993 ], "y_axis": [ 0.948, 0.298, -0.113 ], "z_axis": [ -0.298, 0.954, 0.015 ], "quaternion": [ 0.597, -0.447, -0.541, -0.389 ] } }, { "index": 31, "index_chain": 18, "chain_name": "P", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///P/18", "linked_nts": [ "///P/17", "///P/19" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -83.649, "beta": 176.714, "gamma": 71.742, "delta": 79.003, "epsilon": -145.967, "zeta": -69.301, "epsilon_zeta": -76.667, "bb_type": "BI", "chi": -173.092, "glyco_bond": "anti", "C5prime_xyz": [ -1.713, 8.673, 1.273 ], "P_xyz": [ 0.819, 9.301, 1.424 ], "form": "A", "ssZp": 4.673, "Dp": 4.678, "splay_angle": 22.165, "splay_distance": 3.616, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 173.104, "theta": -142.581, "eta_prime": -174.196, "theta_prime": -143.139, "eta_base": -135.526, "theta_base": -111.896, "v0": 0.012, "v1": -24.356, "v2": 37.896, "v3": -39.035, "v4": 24.757, "amplitude": 40.003, "phase_angle": 18.676, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.368, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 14.905, -5.015, 7.157 ], "x_axis": [ 0.622, 0.073, 0.779 ], "y_axis": [ 0.755, 0.205, -0.622 ], "z_axis": [ -0.206, 0.976, 0.073 ], "quaternion": [ 0.689, -0.580, -0.357, -0.247 ] } }, { "index": 32, "index_chain": 19, "chain_name": "P", "nt_resnum": 19, "nt_name": "U", "nt_code": "U", "nt_id": "///P/19", "linked_nts": [ "///P/18", "///P/20" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.594, "beta": 171.373, "gamma": 55.905, "delta": 75.849, "epsilon": -145.818, "zeta": -73.011, "epsilon_zeta": -72.807, "bb_type": "BI", "chi": -161.428, "glyco_bond": "anti", "C5prime_xyz": [ -1.562, 8.815, 0.624 ], "P_xyz": [ 0.956, 9.512, 0.587 ], "form": "A", "ssZp": 4.492, "Dp": 4.725, "splay_angle": 18.778, "splay_distance": 2.992, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 166.601, "theta": -150.676, "eta_prime": -179.502, "theta_prime": -149.212, "eta_base": -131.307, "theta_base": -115.875, "v0": 3.190, "v1": -29.071, "v2": 42.264, "v3": -41.666, "v4": 24.397, "amplitude": 43.668, "phase_angle": 14.567, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.906, "filter_rmsd": 0.112, "frame": { "rmsd": 0.011, "origin": [ 14.060, -2.360, 9.462 ], "x_axis": [ 0.937, 0.222, 0.270 ], "y_axis": [ 0.217, 0.237, -0.947 ], "z_axis": [ -0.274, 0.946, 0.173 ], "quaternion": [ 0.766, -0.618, -0.178, 0.002 ] } }, { "index": 33, "index_chain": 20, "chain_name": "P", "nt_resnum": 20, "nt_name": "G", "nt_code": "G", "nt_id": "///P/20", "linked_nts": [ "///P/19", "///P/21" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.430, "beta": 163.782, "gamma": 60.541, "delta": 79.994, "epsilon": -152.941, "zeta": -66.393, "epsilon_zeta": -86.548, "bb_type": "BI", "chi": -162.185, "glyco_bond": "anti", "C5prime_xyz": [ -1.362, 8.769, 0.698 ], "P_xyz": [ 1.195, 9.202, 0.501 ], "form": "A", "ssZp": 4.457, "Dp": 4.623, "splay_angle": 18.521, "splay_distance": 2.966, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 165.403, "theta": -143.126, "eta_prime": -179.993, "theta_prime": -145.206, "eta_base": -131.906, "theta_base": -111.375, "v0": 5.745, "v1": -29.983, "v2": 41.357, "v3": -39.202, "v4": 21.191, "amplitude": 42.126, "phase_angle": 10.967, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.829, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 14.414, 0.049, 11.201 ], "x_axis": [ 0.925, 0.166, -0.341 ], "y_axis": [ -0.374, 0.252, -0.893 ], "z_axis": [ -0.062, 0.953, 0.295 ], "quaternion": [ 0.786, -0.587, 0.089, 0.172 ] } }, { "index": 34, "index_chain": 21, "chain_name": "P", "nt_resnum": 21, "nt_name": "C", "nt_code": "C", "nt_id": "///P/21", "linked_nts": [ "///P/20", "///P/22" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.390, "beta": 172.642, "gamma": 53.691, "delta": 80.241, "epsilon": -152.591, "zeta": -74.161, "epsilon_zeta": -78.430, "bb_type": "BI", "chi": -153.573, "glyco_bond": "anti", "C5prime_xyz": [ -1.220, 8.840, 0.130 ], "P_xyz": [ 1.379, 9.233, -0.221 ], "form": "A", "ssZp": 4.357, "Dp": 4.733, "splay_angle": 23.719, "splay_distance": 3.789, "splay_ratio": 0.207, "d22": 4.310, "d64": 4.545, "eta": 161.801, "theta": -151.016, "eta_prime": 176.952, "theta_prime": -151.351, "eta_base": -130.848, "theta_base": -134.035, "v0": 6.572, "v1": -30.682, "v2": 41.371, "v3": -38.603, "v4": 20.383, "amplitude": 41.970, "phase_angle": 9.686, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.933, "filter_rmsd": 0.069, "frame": { "rmsd": 0.008, "origin": [ 15.852, 2.383, 12.333 ], "x_axis": [ 0.530, 0.303, -0.792 ], "y_axis": [ -0.838, 0.327, -0.436 ], "z_axis": [ 0.127, 0.895, 0.427 ], "quaternion": [ 0.756, -0.440, 0.304, 0.378 ] } }, { "index": 35, "index_chain": 22, "chain_name": "P", "nt_resnum": 22, "nt_name": "C", "nt_code": "C", "nt_id": "///P/22", "linked_nts": [ "///P/21", "///P/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -71.573, "beta": 165.731, "gamma": 61.288, "delta": 74.734, "epsilon": -147.586, "zeta": -76.612, "epsilon_zeta": -70.974, "bb_type": "BI", "chi": -161.587, "glyco_bond": "anti", "C5prime_xyz": [ -1.420, 8.787, 0.643 ], "P_xyz": [ 1.115, 9.302, 0.192 ], "form": "A", "ssZp": 4.510, "Dp": 4.756, "splay_angle": 24.906, "splay_distance": 3.825, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 165.847, "theta": -149.423, "eta_prime": 177.899, "theta_prime": -148.888, "eta_base": -149.797, "theta_base": -118.078, "v0": 8.960, "v1": -35.654, "v2": 47.220, "v3": -43.349, "v4": 21.905, "amplitude": 47.694, "phase_angle": 8.083, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.795, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 17.803, 5.268, 13.827 ], "x_axis": [ 0.105, 0.273, -0.956 ], "y_axis": [ -0.966, 0.257, -0.033 ], "z_axis": [ 0.237, 0.927, 0.291 ], "quaternion": [ 0.643, -0.373, 0.464, 0.482 ] } }, { "index": 36, "index_chain": 23, "chain_name": "P", "nt_resnum": 23, "nt_name": "A", "nt_code": "A", "nt_id": "///P/23", "linked_nts": [ "///P/22", "///P/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet", "alpha": -45.423, "beta": 162.235, "gamma": 44.249, "delta": 76.620, "epsilon": -142.288, "zeta": -75.342, "epsilon_zeta": -66.946, "bb_type": "BI", "chi": -166.268, "glyco_bond": "anti", "C5prime_xyz": [ -1.186, 8.581, 0.969 ], "P_xyz": [ 1.432, 8.832, 1.144 ], "form": "A", "ssZp": 4.584, "Dp": 4.736, "splay_angle": 23.682, "splay_distance": 3.678, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 172.272, "theta": -147.183, "eta_prime": -175.241, "theta_prime": -143.432, "eta_base": -128.389, "theta_base": -119.419, "v0": 12.096, "v1": -36.067, "v2": 45.178, "v3": -39.484, "v4": 17.380, "amplitude": 45.266, "phase_angle": 3.581, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.549, "filter_rmsd": 0.039, "frame": { "rmsd": 0.009, "origin": [ 19.748, 8.502, 13.206 ], "x_axis": [ -0.512, 0.252, -0.821 ], "y_axis": [ -0.836, 0.077, 0.544 ], "z_axis": [ 0.200, 0.965, 0.171 ], "quaternion": [ 0.429, -0.245, 0.595, 0.634 ] } }, { "index": 37, "index_chain": 24, "chain_name": "P", "nt_resnum": 24, "nt_name": "G", "nt_code": "G", "nt_id": "///P/24", "linked_nts": [ "///P/23", "///P/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -60.851, "beta": 167.458, "gamma": 60.797, "delta": 77.165, "epsilon": -160.697, "zeta": -56.320, "epsilon_zeta": -104.377, "bb_type": "BI", "chi": -163.894, "glyco_bond": "anti", "C5prime_xyz": [ -1.547, 8.636, 0.788 ], "P_xyz": [ 1.019, 9.069, 0.733 ], "form": "A", "ssZp": 4.478, "Dp": 4.628, "splay_angle": 25.750, "splay_distance": 4.027, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 172.342, "theta": -140.179, "eta_prime": -172.213, "theta_prime": -140.748, "eta_base": -133.630, "theta_base": -109.265, "v0": 9.788, "v1": -35.395, "v2": 45.644, "v3": -41.543, "v4": 20.393, "amplitude": 45.967, "phase_angle": 6.801, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.832, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 21.143, 11.660, 11.935 ], "x_axis": [ -0.874, 0.175, -0.454 ], "y_axis": [ -0.456, 0.032, 0.890 ], "z_axis": [ 0.170, 0.984, 0.052 ], "quaternion": [ 0.229, -0.103, 0.681, 0.688 ] } }, { "index": 38, "index_chain": 25, "chain_name": "P", "nt_resnum": 25, "nt_name": "U", "nt_code": "U", "nt_id": "///P/25", "linked_nts": [ "///P/24", "///P/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.120, "beta": -172.513, "gamma": 51.790, "delta": 77.797, "epsilon": -159.222, "zeta": -71.766, "epsilon_zeta": -87.456, "bb_type": "BI", "chi": -162.541, "glyco_bond": "anti", "C5prime_xyz": [ -1.471, 8.734, 0.710 ], "P_xyz": [ 1.067, 9.075, 1.352 ], "form": "A", "ssZp": 4.394, "Dp": 4.553, "splay_angle": 20.566, "splay_distance": 3.265, "splay_ratio": 0.181, "d22": 4.524, "d64": 4.535, "eta": 168.658, "theta": -153.937, "eta_prime": -176.388, "theta_prime": -151.142, "eta_base": -126.869, "theta_base": -134.933, "v0": 4.001, "v1": -30.131, "v2": 43.882, "v3": -42.659, "v4": 24.161, "amplitude": 45.149, "phase_angle": 13.606, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.690, "filter_rmsd": 0.109, "frame": { "rmsd": 0.008, "origin": [ 20.726, 15.353, 10.383 ], "x_axis": [ -0.977, 0.018, 0.214 ], "y_axis": [ 0.210, -0.110, 0.971 ], "z_axis": [ 0.041, 0.994, 0.103 ], "quaternion": [ -0.065, 0.086, 0.664, 0.740 ] } }, { "index": 39, "index_chain": 26, "chain_name": "P", "nt_resnum": 26, "nt_name": "U", "nt_code": "U", "nt_id": "///P/26", "linked_nts": [ "///P/25", "///P/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop", "alpha": -79.690, "beta": 177.828, "gamma": 65.658, "delta": 83.932, "epsilon": -131.362, "zeta": -65.009, "epsilon_zeta": -66.352, "bb_type": "BI", "chi": -156.781, "glyco_bond": "anti", "C5prime_xyz": [ -1.523, 8.821, 0.331 ], "P_xyz": [ 1.060, 9.234, 0.158 ], "form": ".", "ssZp": 4.186, "Dp": 4.630, "splay_angle": 31.800, "splay_distance": 5.010, "splay_ratio": 0.274, "d22": null, "d64": null, "eta": 175.126, "theta": -119.872, "eta_prime": -177.114, "theta_prime": -115.460, "eta_base": -153.646, "theta_base": -63.476, "v0": 1.670, "v1": -27.337, "v2": 40.804, "v3": -40.619, "v4": 24.564, "amplitude": 42.463, "phase_angle": 16.070, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.616, "filter_rmsd": 0.112, "frame": { "rmsd": 0.010, "origin": [ 20.504, 18.285, 8.963 ], "x_axis": [ -0.795, -0.065, 0.603 ], "y_axis": [ 0.600, 0.057, 0.798 ], "z_axis": [ -0.087, 0.996, -0.006 ], "quaternion": [ -0.253, 0.196, 0.682, 0.658 ] } }, { "index": 40, "index_chain": 27, "chain_name": "P", "nt_resnum": 27, "nt_name": "G", "nt_code": "G", "nt_id": "///P/27", "linked_nts": [ "///P/26", "///P/28" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart", "alpha": -66.021, "beta": 174.304, "gamma": 54.134, "delta": 83.745, "epsilon": -140.382, "zeta": 162.294, "epsilon_zeta": 57.324, "bb_type": "--", "chi": -131.787, "glyco_bond": "anti", "C5prime_xyz": [ -1.641, 8.545, -1.140 ], "P_xyz": [ 0.807, 8.796, -1.923 ], "form": ".", "ssZp": 3.128, "Dp": 4.654, "splay_angle": 128.842, "splay_distance": 16.185, "splay_ratio": 0.902, "d22": null, "d64": null, "eta": 165.859, "theta": 74.955, "eta_prime": -168.448, "theta_prime": 110.368, "eta_base": -100.755, "theta_base": 139.525, "v0": 2.344, "v1": -26.689, "v2": 39.004, "v3": -39.306, "v4": 23.289, "amplitude": 40.500, "phase_angle": 15.620, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.812, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 18.303, 20.287, 12.995 ], "x_axis": [ 0.043, -0.066, 0.997 ], "y_axis": [ 0.860, 0.510, -0.003 ], "z_axis": [ -0.508, 0.858, 0.078 ], "quaternion": [ 0.639, -0.337, -0.589, -0.363 ] } }, { "index": 41, "index_chain": 28, "chain_name": "P", "nt_resnum": 28, "nt_name": "A", "nt_code": "A", "nt_id": "///P/28", "linked_nts": [ "///P/27", "///P/29" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,non-stack,non-canonical,multiplet,junction-loop,splayed-apart", "alpha": -77.381, "beta": -127.884, "gamma": 53.501, "delta": 154.200, "epsilon": -89.326, "zeta": 117.539, "epsilon_zeta": 153.135, "bb_type": "--", "chi": -76.648, "glyco_bond": "--", "C5prime_xyz": [ -1.705, 6.771, -2.942 ], "P_xyz": [ 0.571, 7.980, -2.428 ], "form": ".", "ssZp": -1.062, "Dp": 1.341, "splay_angle": 45.096, "splay_distance": 7.428, "splay_ratio": 0.389, "d22": null, "d64": null, "eta": -105.969, "theta": 160.845, "eta_prime": -123.455, "theta_prime": 147.384, "eta_base": 179.224, "theta_base": -177.664, "v0": 0.092, "v1": 20.352, "v2": -32.266, "v3": 32.580, "v4": -20.579, "amplitude": 33.990, "phase_angle": 198.330, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.103, "filter_rmsd": 0.038, "frame": { "rmsd": 0.019, "origin": [ 24.535, 33.002, 5.155 ], "x_axis": [ -0.902, -0.356, -0.245 ], "y_axis": [ -0.094, -0.391, 0.915 ], "z_axis": [ -0.422, 0.849, 0.319 ], "quaternion": [ -0.081, -0.206, 0.546, 0.808 ] } }, { "index": 42, "index_chain": 29, "chain_name": "P", "nt_resnum": 29, "nt_name": "C", "nt_code": "C", "nt_id": "///P/29", "linked_nts": [ "///P/28", "///P/30" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,junction-loop,A-minor,ribose-zipper,phosphate", "alpha": 166.811, "beta": -130.500, "gamma": 62.949, "delta": 86.313, "epsilon": -126.173, "zeta": -128.821, "epsilon_zeta": 2.648, "bb_type": "--", "chi": -168.053, "glyco_bond": "anti", "C5prime_xyz": [ -1.342, 8.682, 0.961 ], "P_xyz": [ 0.979, 8.583, 2.176 ], "form": "A", "ssZp": 4.569, "Dp": 4.727, "splay_angle": 20.728, "splay_distance": 3.364, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 145.048, "theta": -139.937, "eta_prime": 127.020, "theta_prime": -144.754, "eta_base": 162.483, "theta_base": -136.512, "v0": 3.991, "v1": -28.343, "v2": 39.790, "v3": -38.189, "v4": 21.809, "amplitude": 40.792, "phase_angle": 12.730, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6g", "suiteness": 0.010, "filter_rmsd": 0.073, "frame": { "rmsd": 0.015, "origin": [ 30.089, 37.079, 7.930 ], "x_axis": [ -0.913, -0.281, -0.294 ], "y_axis": [ 0.082, -0.836, 0.543 ], "z_axis": [ -0.399, 0.472, 0.787 ], "quaternion": [ -0.097, -0.184, 0.270, 0.940 ] } }, { "index": 43, "index_chain": 30, "chain_name": "P", "nt_resnum": 30, "nt_name": "G", "nt_code": "G", "nt_id": "///P/30", "linked_nts": [ "///P/29", "///P/31" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper,phosphate", "alpha": 105.518, "beta": -115.558, "gamma": -171.347, "delta": 91.647, "epsilon": -137.494, "zeta": -73.626, "epsilon_zeta": -63.868, "bb_type": "BI", "chi": 175.175, "glyco_bond": "anti", "C5prime_xyz": [ -1.149, 8.029, 1.953 ], "P_xyz": [ 0.328, 9.485, 0.298 ], "form": "A", "ssZp": 4.647, "Dp": 4.688, "splay_angle": 23.918, "splay_distance": 3.712, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 167.795, "theta": -157.410, "eta_prime": -179.601, "theta_prime": -158.860, "eta_base": -153.380, "theta_base": -135.791, "v0": 15.026, "v1": -34.325, "v2": 39.474, "v3": -31.835, "v4": 10.720, "amplitude": 39.535, "phase_angle": 356.798, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 29.346, 40.057, 9.305 ], "x_axis": [ -0.877, -0.472, -0.090 ], "y_axis": [ 0.270, -0.641, 0.719 ], "z_axis": [ -0.397, 0.606, 0.689 ], "quaternion": [ -0.207, -0.136, 0.370, 0.895 ] } }, { "index": 44, "index_chain": 31, "chain_name": "P", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///P/31", "linked_nts": [ "///P/30", "///P/32" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,A-minor,phosphate", "alpha": -82.153, "beta": -177.086, "gamma": 58.421, "delta": 83.880, "epsilon": -146.573, "zeta": -61.426, "epsilon_zeta": -85.146, "bb_type": "BI", "chi": -166.170, "glyco_bond": "anti", "C5prime_xyz": [ -1.403, 8.635, 0.955 ], "P_xyz": [ 1.189, 8.975, 1.357 ], "form": ".", "ssZp": 4.508, "Dp": 4.613, "splay_angle": 28.623, "splay_distance": 4.419, "splay_ratio": 0.249, "d22": null, "d64": null, "eta": 161.013, "theta": -129.749, "eta_prime": 177.384, "theta_prime": -126.619, "eta_base": -142.281, "theta_base": -80.145, "v0": 8.226, "v1": -30.606, "v2": 40.679, "v3": -36.393, "v4": 17.880, "amplitude": 40.987, "phase_angle": 7.031, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.559, "filter_rmsd": 0.036, "frame": { "rmsd": 0.009, "origin": [ 27.071, 42.916, 9.961 ], "x_axis": [ -0.527, -0.779, 0.340 ], "y_axis": [ 0.732, -0.213, 0.647 ], "z_axis": [ -0.432, 0.589, 0.683 ], "quaternion": [ -0.486, -0.030, 0.397, 0.778 ] } }, { "index": 45, "index_chain": 32, "chain_name": "P", "nt_resnum": 32, "nt_name": "G", "nt_code": "G", "nt_id": "///P/32", "linked_nts": [ "///P/31", "///P/33" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -68.712, "beta": -176.821, "gamma": 51.645, "delta": 86.810, "epsilon": -148.274, "zeta": -85.258, "epsilon_zeta": -63.017, "bb_type": "BI", "chi": -155.929, "glyco_bond": "anti", "C5prime_xyz": [ -1.179, 8.722, 0.325 ], "P_xyz": [ 1.407, 9.021, 0.510 ], "form": "A", "ssZp": 4.372, "Dp": 4.688, "splay_angle": 20.505, "splay_distance": 3.215, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 169.501, "theta": -149.679, "eta_prime": -170.576, "theta_prime": -145.490, "eta_base": -106.661, "theta_base": -117.225, "v0": 9.410, "v1": -31.078, "v2": 39.122, "v3": -34.171, "v4": 15.917, "amplitude": 39.246, "phase_angle": 4.559, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.841, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 24.108, 42.272, 13.176 ], "x_axis": [ 0.275, -0.680, 0.679 ], "y_axis": [ 0.815, 0.539, 0.210 ], "z_axis": [ -0.509, 0.496, 0.703 ], "quaternion": [ 0.793, -0.090, -0.375, -0.471 ] } }, { "index": 46, "index_chain": 33, "chain_name": "P", "nt_resnum": 33, "nt_name": "G", "nt_code": "G", "nt_id": "///P/33", "linked_nts": [ "///P/32", "///P/34" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -62.118, "beta": 152.095, "gamma": 65.909, "delta": 84.692, "epsilon": -143.879, "zeta": -92.235, "epsilon_zeta": -51.644, "bb_type": "BI", "chi": -149.747, "glyco_bond": "anti", "C5prime_xyz": [ -1.470, 8.821, -0.078 ], "P_xyz": [ 1.017, 8.837, -0.874 ], "form": ".", "ssZp": 4.030, "Dp": 4.580, "splay_angle": 53.671, "splay_distance": 8.800, "splay_ratio": 0.452, "d22": null, "d64": null, "eta": 174.959, "theta": -160.928, "eta_prime": -168.598, "theta_prime": -154.845, "eta_base": -130.095, "theta_base": -157.416, "v0": 0.867, "v1": -23.889, "v2": 35.914, "v3": -36.379, "v4": 22.696, "amplitude": 37.605, "phase_angle": 17.250, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.554, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 22.341, 42.856, 15.796 ], "x_axis": [ 0.609, -0.311, 0.730 ], "y_axis": [ 0.433, 0.901, 0.022 ], "z_axis": [ -0.664, 0.303, 0.683 ], "quaternion": [ 0.893, -0.079, -0.390, -0.208 ] } }, { "index": 47, "index_chain": 34, "chain_name": "P", "nt_resnum": 34, "nt_name": "U", "nt_code": "U", "nt_id": "///P/34", "linked_nts": [ "///P/33", "///P/35" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -48.304, "beta": -153.074, "gamma": 51.687, "delta": 144.791, "epsilon": -122.667, "zeta": -133.070, "epsilon_zeta": 10.403, "bb_type": "--", "chi": -102.943, "glyco_bond": "anti", "C5prime_xyz": [ -2.397, 8.180, -1.994 ], "P_xyz": [ -0.401, 9.791, -1.488 ], "form": ".", "ssZp": 1.245, "Dp": 1.280, "splay_angle": 126.082, "splay_distance": 16.758, "splay_ratio": 0.892, "d22": null, "d64": null, "eta": -138.942, "theta": -105.401, "eta_prime": -132.620, "theta_prime": -148.050, "eta_base": -147.905, "theta_base": 160.525, "v0": -24.982, "v1": 38.111, "v2": -36.634, "v3": 23.812, "v4": 0.609, "amplitude": 38.859, "phase_angle": 160.516, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.579, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ 14.897, 45.592, 19.610 ], "x_axis": [ 0.672, -0.475, 0.569 ], "y_axis": [ 0.653, 0.743, -0.151 ], "z_axis": [ -0.351, 0.472, 0.809 ], "quaternion": [ 0.898, -0.173, -0.256, -0.314 ] } }, { "index": 48, "index_chain": 35, "chain_name": "P", "nt_resnum": 35, "nt_name": "G", "nt_code": "G", "nt_id": "///P/35", "linked_nts": [ "///P/34", "///P/36" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart", "alpha": 95.259, "beta": 149.340, "gamma": 39.355, "delta": 80.893, "epsilon": -149.534, "zeta": -68.673, "epsilon_zeta": -80.861, "bb_type": "BI", "chi": -178.196, "glyco_bond": "anti", "C5prime_xyz": [ -1.684, 8.453, 1.640 ], "P_xyz": [ 0.890, 8.404, 2.246 ], "form": "A", "ssZp": 4.680, "Dp": 4.674, "splay_angle": 24.837, "splay_distance": 3.869, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": -58.460, "theta": -134.753, "eta_prime": -26.778, "theta_prime": -135.704, "eta_base": 27.804, "theta_base": -108.178, "v0": 6.812, "v1": -29.613, "v2": 39.597, "v3": -36.886, "v4": 19.099, "amplitude": 40.104, "phase_angle": 9.118, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "8d", "suiteness": 0.054, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 9.544, 59.644, 12.212 ], "x_axis": [ 0.613, -0.022, -0.790 ], "y_axis": [ 0.749, -0.301, 0.590 ], "z_axis": [ -0.251, -0.953, -0.168 ], "quaternion": [ 0.535, 0.721, 0.252, -0.361 ] } }, { "index": 49, "index_chain": 36, "chain_name": "P", "nt_resnum": 36, "nt_name": "G", "nt_code": "G", "nt_id": "///P/36", "linked_nts": [ "///P/35", "///P/37" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -76.684, "beta": -178.687, "gamma": 53.439, "delta": 77.683, "epsilon": -164.568, "zeta": -69.052, "epsilon_zeta": -95.517, "bb_type": "BI", "chi": -169.692, "glyco_bond": "anti", "C5prime_xyz": [ -1.423, 8.627, 1.108 ], "P_xyz": [ 1.150, 9.011, 1.518 ], "form": "A", "ssZp": 4.654, "Dp": 4.653, "splay_angle": 22.602, "splay_distance": 3.552, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 160.960, "theta": -154.572, "eta_prime": 174.675, "theta_prime": -152.417, "eta_base": -135.858, "theta_base": -137.445, "v0": 6.457, "v1": -31.365, "v2": 42.714, "v3": -40.120, "v4": 21.375, "amplitude": 43.401, "phase_angle": 10.209, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.853, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 8.169, 57.031, 9.712 ], "x_axis": [ 0.961, -0.164, -0.224 ], "y_axis": [ 0.187, -0.214, 0.959 ], "z_axis": [ -0.205, -0.963, -0.175 ], "quaternion": [ 0.627, 0.766, 0.007, -0.140 ] } }, { "index": 50, "index_chain": 37, "chain_name": "P", "nt_resnum": 37, "nt_name": "G", "nt_code": "G", "nt_id": "///P/37", "linked_nts": [ "///P/36", "///P/38" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -82.525, "beta": -167.847, "gamma": 57.324, "delta": 76.329, "epsilon": -158.191, "zeta": -60.198, "epsilon_zeta": -97.994, "bb_type": "BI", "chi": -162.166, "glyco_bond": "anti", "C5prime_xyz": [ -1.485, 8.751, 0.635 ], "P_xyz": [ 1.090, 9.114, 0.880 ], "form": "A", "ssZp": 4.549, "Dp": 4.698, "splay_angle": 27.394, "splay_distance": 4.160, "splay_ratio": 0.238, "d22": null, "d64": null, "eta": 167.280, "theta": -142.871, "eta_prime": 174.615, "theta_prime": -139.100, "eta_base": -159.168, "theta_base": -99.067, "v0": 5.263, "v1": -32.971, "v2": 46.239, "v3": -44.551, "v4": 24.896, "amplitude": 47.339, "phase_angle": 12.371, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.579, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 7.235, 54.922, 7.011 ], "x_axis": [ 0.953, -0.178, 0.246 ], "y_axis": [ -0.285, -0.240, 0.928 ], "z_axis": [ -0.106, -0.954, -0.280 ], "quaternion": [ 0.599, 0.786, -0.147, 0.045 ] } }, { "index": 51, "index_chain": 38, "chain_name": "P", "nt_resnum": 38, "nt_name": "G", "nt_code": "G", "nt_id": "///P/38", "linked_nts": [ "///P/37", "///P/39" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -71.572, "beta": 176.661, "gamma": 62.436, "delta": 82.810, "epsilon": -138.772, "zeta": -77.760, "epsilon_zeta": -61.012, "bb_type": "BI", "chi": -167.144, "glyco_bond": "anti", "C5prime_xyz": [ -1.332, 8.587, 1.043 ], "P_xyz": [ 1.250, 8.798, 1.239 ], "form": "A", "ssZp": 4.603, "Dp": 4.735, "splay_angle": 21.025, "splay_distance": 3.303, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 176.515, "theta": -140.328, "eta_prime": -167.771, "theta_prime": -139.575, "eta_base": -112.298, "theta_base": -109.458, "v0": 11.406, "v1": -34.206, "v2": 42.424, "v3": -37.006, "v4": 16.353, "amplitude": 42.499, "phase_angle": 3.395, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.744, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 9.567, 51.570, 6.221 ], "x_axis": [ 0.508, -0.174, 0.843 ], "y_axis": [ -0.861, -0.087, 0.501 ], "z_axis": [ -0.014, -0.981, -0.194 ], "quaternion": [ 0.554, 0.669, -0.387, 0.310 ] } }, { "index": 52, "index_chain": 39, "chain_name": "P", "nt_resnum": 39, "nt_name": "U", "nt_code": "U", "nt_id": "///P/39", "linked_nts": [ "///P/38", "///P/40" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -65.707, "beta": 162.473, "gamma": 59.554, "delta": 77.171, "epsilon": -133.287, "zeta": -83.551, "epsilon_zeta": -49.736, "bb_type": "BI", "chi": -164.153, "glyco_bond": "anti", "C5prime_xyz": [ -1.448, 8.748, 0.744 ], "P_xyz": [ 1.152, 9.085, 0.632 ], "form": ".", "ssZp": 4.441, "Dp": 4.732, "splay_angle": 19.297, "splay_distance": 3.015, "splay_ratio": 0.168, "d22": 4.126, "d64": 3.474, "eta": 168.229, "theta": -142.790, "eta_prime": -177.723, "theta_prime": -141.025, "eta_base": -131.743, "theta_base": -96.885, "v0": 5.024, "v1": -30.187, "v2": 42.769, "v3": -40.556, "v4": 22.735, "amplitude": 43.731, "phase_angle": 12.042, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.844, "filter_rmsd": 0.110, "frame": { "rmsd": 0.008, "origin": [ 11.071, 48.629, 6.181 ], "x_axis": [ -0.094, -0.119, 0.988 ], "y_axis": [ -0.989, -0.099, -0.106 ], "z_axis": [ 0.110, -0.988, -0.108 ], "quaternion": [ 0.418, 0.527, -0.525, 0.521 ] } }, { "index": 53, "index_chain": 40, "chain_name": "P", "nt_resnum": 40, "nt_name": "U", "nt_code": "U", "nt_id": "///P/40", "linked_nts": [ "///P/39", "///P/41" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -45.129, "beta": 160.766, "gamma": 39.213, "delta": 83.972, "epsilon": -166.976, "zeta": -81.242, "epsilon_zeta": -85.733, "bb_type": "BI", "chi": -146.806, "glyco_bond": "anti", "C5prime_xyz": [ -1.092, 8.676, -0.233 ], "P_xyz": [ 1.536, 8.767, -0.458 ], "form": ".", "ssZp": 4.086, "Dp": 4.537, "splay_angle": 129.261, "splay_distance": 14.795, "splay_ratio": 0.905, "d22": 11.216, "d64": 13.136, "eta": 163.444, "theta": -144.053, "eta_prime": -178.552, "theta_prime": 169.642, "eta_base": -117.164, "theta_base": 106.003, "v0": 9.069, "v1": -29.946, "v2": 38.311, "v3": -34.131, "v4": 15.954, "amplitude": 38.479, "phase_angle": 5.364, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.418, "filter_rmsd": 0.107, "frame": { "rmsd": 0.007, "origin": [ 11.258, 45.982, 7.610 ], "x_axis": [ -0.725, -0.123, 0.677 ], "y_axis": [ -0.631, -0.273, -0.726 ], "z_axis": [ 0.274, -0.954, 0.121 ], "quaternion": [ 0.175, 0.327, -0.577, 0.728 ] } }, { "index": 54, "index_chain": 41, "chain_name": "P", "nt_resnum": 41, "nt_name": "U", "nt_code": "U", "nt_id": "///P/41", "linked_nts": [ "///P/40", "///P/42" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-stack,hairpin-loop,splayed-apart", "alpha": 157.216, "beta": 159.236, "gamma": 48.616, "delta": 150.687, "epsilon": -72.551, "zeta": -84.300, "epsilon_zeta": 11.749, "bb_type": "--", "chi": 141.766, "glyco_bond": "--", "C5prime_xyz": [ -2.965, 6.826, 3.081 ], "P_xyz": [ -2.387, 4.957, 4.772 ], "form": ".", "ssZp": 0.070, "Dp": 0.216, "splay_angle": 141.835, "splay_distance": 18.734, "splay_ratio": 0.945, "d22": null, "d64": null, "eta": 36.880, "theta": -44.128, "eta_prime": 62.152, "theta_prime": -79.196, "eta_base": 57.060, "theta_base": -50.917, "v0": -17.614, "v1": 37.029, "v2": -41.492, "v3": 32.034, "v4": -9.364, "amplitude": 41.715, "phase_angle": 174.079, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1z", "suiteness": 0.115, "filter_rmsd": 0.112, "frame": { "rmsd": 0.015, "origin": [ 11.232, 40.313, -6.056 ], "x_axis": [ -0.367, -0.808, -0.461 ], "y_axis": [ 0.260, -0.565, 0.783 ], "z_axis": [ -0.893, 0.168, 0.417 ], "quaternion": [ -0.348, -0.442, 0.310, 0.766 ] } }, { "index": 55, "index_chain": 42, "chain_name": "P", "nt_resnum": 42, "nt_name": "A", "nt_code": "A", "nt_id": "///P/42", "linked_nts": [ "///P/41", "///P/43" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -56.598, "beta": -133.146, "gamma": 70.844, "delta": 135.306, "epsilon": -114.676, "zeta": 174.759, "epsilon_zeta": 70.565, "bb_type": "BII", "chi": -147.660, "glyco_bond": "anti", "C5prime_xyz": [ -2.291, 8.796, -0.049 ], "P_xyz": [ -0.810, 9.300, 2.008 ], "form": ".", "ssZp": 1.176, "Dp": 1.308, "splay_angle": 78.583, "splay_distance": 11.908, "splay_ratio": 0.635, "d22": null, "d64": null, "eta": -140.043, "theta": 175.434, "eta_prime": -92.513, "theta_prime": 177.850, "eta_base": -115.699, "theta_base": -150.048, "v0": -33.565, "v1": 41.759, "v2": -33.888, "v3": 15.562, "v4": 11.126, "amplitude": 40.974, "phase_angle": 145.797, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.204, "filter_rmsd": 0.037, "frame": { "rmsd": 0.011, "origin": [ 15.289, 44.516, 11.744 ], "x_axis": [ -0.968, -0.183, 0.171 ], "y_axis": [ -0.112, -0.291, -0.950 ], "z_axis": [ 0.224, -0.939, 0.261 ], "quaternion": [ -0.022, 0.124, -0.595, 0.794 ] } }, { "index": 56, "index_chain": 43, "chain_name": "P", "nt_resnum": 43, "nt_name": "U", "nt_code": "U", "nt_id": "///P/43", "linked_nts": [ "///P/42", "///P/44" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,A-minor,phosphate", "alpha": -54.149, "beta": 166.804, "gamma": 43.213, "delta": 78.382, "epsilon": -153.216, "zeta": -57.574, "epsilon_zeta": -95.642, "bb_type": "BI", "chi": -171.717, "glyco_bond": "anti", "C5prime_xyz": [ -1.336, 8.483, 1.291 ], "P_xyz": [ 1.205, 8.607, 1.805 ], "form": "A", "ssZp": 4.697, "Dp": 4.714, "splay_angle": 27.086, "splay_distance": 4.278, "splay_ratio": 0.241, "d22": 4.337, "d64": 4.690, "eta": -149.739, "theta": -133.364, "eta_prime": -160.915, "theta_prime": -132.414, "eta_base": -144.198, "theta_base": -103.361, "v0": 9.451, "v1": -34.849, "v2": 44.720, "v3": -40.568, "v4": 19.812, "amplitude": 45.024, "phase_angle": 6.664, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.564, "filter_rmsd": 0.114, "frame": { "rmsd": 0.015, "origin": [ 27.005, 42.943, 10.309 ], "x_axis": [ -0.369, -0.899, 0.237 ], "y_axis": [ -0.767, 0.151, -0.624 ], "z_axis": [ 0.525, -0.412, -0.745 ], "quaternion": [ 0.095, -0.553, 0.752, -0.344 ] } }, { "index": 57, "index_chain": 44, "chain_name": "P", "nt_resnum": 44, "nt_name": "C", "nt_code": "C", "nt_id": "///P/44", "linked_nts": [ "///P/43", "///P/45" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,multiplet,hairpin-loop,A-minor,ribose-zipper", "alpha": -97.032, "beta": -170.099, "gamma": 71.508, "delta": 77.200, "epsilon": -103.593, "zeta": -106.965, "epsilon_zeta": 3.373, "bb_type": "--", "chi": -170.344, "glyco_bond": "anti", "C5prime_xyz": [ -1.472, 8.690, 1.080 ], "P_xyz": [ 1.082, 9.252, 1.229 ], "form": "A", "ssZp": 4.437, "Dp": 4.774, "splay_angle": 20.516, "splay_distance": 3.234, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 173.076, "theta": -151.023, "eta_prime": -175.008, "theta_prime": -147.474, "eta_base": -131.776, "theta_base": -126.111, "v0": 5.522, "v1": -31.578, "v2": 44.082, "v3": -41.852, "v4": 22.970, "amplitude": 44.993, "phase_angle": 11.548, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.142, "filter_rmsd": 0.074, "frame": { "rmsd": 0.015, "origin": [ 29.305, 39.503, 9.225 ], "x_axis": [ -0.827, -0.546, -0.134 ], "y_axis": [ -0.346, 0.682, -0.644 ], "z_axis": [ 0.443, -0.486, -0.753 ], "quaternion": [ 0.160, -0.247, 0.903, -0.313 ] } }, { "index": 58, "index_chain": 45, "chain_name": "P", "nt_resnum": 45, "nt_name": "G", "nt_code": "G", "nt_id": "///P/45", "linked_nts": [ "///P/44", "///P/46" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,junction-loop,A-minor,ribose-zipper", "alpha": -60.191, "beta": 101.230, "gamma": 97.877, "delta": 79.368, "epsilon": -149.899, "zeta": -71.016, "epsilon_zeta": -78.882, "bb_type": "BI", "chi": 174.868, "glyco_bond": "anti", "C5prime_xyz": [ -1.806, 8.430, 1.875 ], "P_xyz": [ 0.180, 9.172, 0.233 ], "form": "A", "ssZp": 4.539, "Dp": 4.600, "splay_angle": 25.482, "splay_distance": 3.910, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 156.910, "theta": -144.095, "eta_prime": -177.785, "theta_prime": -157.200, "eta_base": -139.950, "theta_base": -138.100, "v0": 2.931, "v1": -29.378, "v2": 43.419, "v3": -42.211, "v4": 24.967, "amplitude": 44.873, "phase_angle": 14.624, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 30.532, 36.941, 7.679 ], "x_axis": [ -0.934, -0.223, -0.279 ], "y_axis": [ 0.017, 0.752, -0.659 ], "z_axis": [ 0.356, -0.621, -0.698 ], "quaternion": [ 0.173, -0.056, 0.920, -0.348 ] } }, { "index": 59, "index_chain": 46, "chain_name": "P", "nt_resnum": 46, "nt_name": "A", "nt_code": "A", "nt_id": "///P/46", "linked_nts": [ "///P/45", "///P/47" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,junction-loop", "alpha": -86.718, "beta": -165.009, "gamma": 58.645, "delta": 84.501, "epsilon": -147.997, "zeta": -69.723, "epsilon_zeta": -78.274, "bb_type": "BI", "chi": -163.126, "glyco_bond": "anti", "C5prime_xyz": [ -1.485, 8.522, 0.784 ], "P_xyz": [ 0.970, 8.918, 1.449 ], "form": ".", "ssZp": 4.390, "Dp": 4.553, "splay_angle": 28.339, "splay_distance": 4.320, "splay_ratio": 0.246, "d22": null, "d64": null, "eta": 167.684, "theta": -138.095, "eta_prime": 176.954, "theta_prime": -132.169, "eta_base": -146.738, "theta_base": -88.386, "v0": 10.479, "v1": -33.585, "v2": 42.159, "v3": -38.200, "v4": 17.404, "amplitude": 42.326, "phase_angle": 5.083, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.524, "filter_rmsd": 0.033, "frame": { "rmsd": 0.018, "origin": [ 31.155, 33.199, 6.730 ], "x_axis": [ -0.771, 0.322, -0.550 ], "y_axis": [ 0.568, 0.739, -0.363 ], "z_axis": [ 0.289, -0.592, -0.752 ], "quaternion": [ 0.232, 0.246, 0.903, -0.265 ] } }, { "index": 60, "index_chain": 47, "chain_name": "P", "nt_resnum": 47, "nt_name": "G", "nt_code": "G", "nt_id": "///P/47", "linked_nts": [ "///P/46", "///P/48" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,junction-loop", "alpha": -70.736, "beta": 171.348, "gamma": 70.061, "delta": 84.639, "epsilon": -141.353, "zeta": -73.030, "epsilon_zeta": -68.323, "bb_type": "BI", "chi": -164.076, "glyco_bond": "anti", "C5prime_xyz": [ -1.390, 8.750, 0.833 ], "P_xyz": [ 1.228, 8.865, 0.937 ], "form": "B", "ssZp": 4.262, "Dp": 4.485, "splay_angle": 22.457, "splay_distance": 3.563, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 177.778, "theta": -130.779, "eta_prime": -162.130, "theta_prime": -122.683, "eta_base": -104.564, "theta_base": -74.387, "v0": 4.978, "v1": -26.512, "v2": 36.987, "v3": -34.419, "v4": 18.951, "amplitude": 37.664, "phase_angle": 10.880, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.533, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 30.005, 31.828, 2.798 ], "x_axis": [ -0.120, 0.801, -0.586 ], "y_axis": [ 0.955, 0.254, 0.152 ], "z_axis": [ 0.271, -0.542, -0.796 ], "quaternion": [ 0.291, 0.596, 0.737, -0.132 ] } }, { "index": 61, "index_chain": 48, "chain_name": "P", "nt_resnum": 48, "nt_name": "A", "nt_code": "A", "nt_id": "///P/48", "linked_nts": [ "///P/47", "///P/49" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,junction-loop,splayed-apart", "alpha": -54.158, "beta": 166.116, "gamma": 60.942, "delta": 150.410, "epsilon": -106.843, "zeta": -155.135, "epsilon_zeta": 48.293, "bb_type": "BII", "chi": -111.527, "glyco_bond": "anti", "C5prime_xyz": [ -2.093, 8.381, -1.457 ], "P_xyz": [ 0.564, 8.714, -1.369 ], "form": ".", "ssZp": 1.418, "Dp": 1.366, "splay_angle": 154.712, "splay_distance": 18.363, "splay_ratio": 0.976, "d22": null, "d64": null, "eta": -175.394, "theta": -153.740, "eta_prime": -132.367, "theta_prime": 167.104, "eta_base": -77.397, "theta_base": 150.337, "v0": -19.541, "v1": 36.223, "v2": -38.680, "v3": 28.670, "v4": -5.846, "amplitude": 39.291, "phase_angle": 169.880, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.863, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 31.331, 32.324, -0.472 ], "x_axis": [ 0.578, 0.766, -0.280 ], "y_axis": [ 0.816, -0.533, 0.225 ], "z_axis": [ 0.023, -0.359, -0.933 ], "quaternion": [ 0.167, 0.872, 0.453, -0.074 ] } }, { "index": 62, "index_chain": 49, "chain_name": "P", "nt_resnum": 49, "nt_name": "U", "nt_code": "U", "nt_id": "///P/49", "linked_nts": [ "///P/48", "///P/50" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,non-stack,hairpin-loop,junction-loop,splayed-apart", "alpha": -59.152, "beta": -160.335, "gamma": 156.471, "delta": 127.862, "epsilon": -84.841, "zeta": -60.268, "epsilon_zeta": -24.573, "bb_type": "--", "chi": -132.581, "glyco_bond": "anti", "C5prime_xyz": [ -1.110, 8.509, -0.589 ], "P_xyz": [ 1.126, 8.464, -1.959 ], "form": ".", "ssZp": 1.284, "Dp": 2.401, "splay_angle": 76.858, "splay_distance": 12.664, "splay_ratio": 0.623, "d22": 9.957, "d64": 12.183, "eta": 13.536, "theta": -76.966, "eta_prime": 7.809, "theta_prime": -126.085, "eta_base": 15.663, "theta_base": -160.800, "v0": -4.073, "v1": 12.157, "v2": -15.214, "v3": 13.291, "v4": -5.883, "amplitude": 15.244, "phase_angle": 183.597, "puckering": "C3'-exo", "sugar_class": "--", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.010, "origin": [ 33.875, 14.723, 4.101 ], "x_axis": [ 0.780, 0.229, 0.583 ], "y_axis": [ -0.146, 0.972, -0.185 ], "z_axis": [ -0.609, 0.059, 0.791 ], "quaternion": [ 0.941, -0.065, -0.317, 0.100 ] } }, { "index": 63, "index_chain": 50, "chain_name": "P", "nt_resnum": 50, "nt_name": "U", "nt_code": "U", "nt_id": "///P/50", "linked_nts": [ "///P/49", "///P/51" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,splayed-apart", "alpha": -150.601, "beta": 143.414, "gamma": 26.018, "delta": 142.977, "epsilon": -105.554, "zeta": 96.990, "epsilon_zeta": 157.457, "bb_type": "--", "chi": -150.292, "glyco_bond": "anti", "C5prime_xyz": [ -2.090, 8.895, 0.070 ], "P_xyz": [ -0.328, 9.413, 1.972 ], "form": ".", "ssZp": 0.605, "Dp": 1.042, "splay_angle": 165.052, "splay_distance": 18.904, "splay_ratio": 0.992, "d22": 11.783, "d64": 15.179, "eta": 21.614, "theta": 128.805, "eta_prime": 87.482, "theta_prime": 75.153, "eta_base": 90.045, "theta_base": 69.190, "v0": -30.933, "v1": 42.293, "v2": -38.048, "v3": 21.374, "v4": 5.803, "amplitude": 42.409, "phase_angle": 153.786, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.010, "origin": [ 21.517, 17.415, 4.740 ], "x_axis": [ -0.272, -0.373, -0.887 ], "y_axis": [ 0.526, 0.715, -0.461 ], "z_axis": [ 0.806, -0.592, 0.001 ], "quaternion": [ 0.601, 0.054, 0.705, -0.374 ] } }, { "index": 64, "index_chain": 51, "chain_name": "P", "nt_resnum": 51, "nt_name": "U", "nt_code": "U", "nt_id": "///P/51", "linked_nts": [ "///P/50", "///P/52" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,junction-loop,splayed-apart", "alpha": 54.799, "beta": -172.126, "gamma": 53.633, "delta": 147.300, "epsilon": -69.114, "zeta": -56.190, "epsilon_zeta": -12.924, "bb_type": "--", "chi": -139.541, "glyco_bond": "anti", "C5prime_xyz": [ -1.623, 8.733, -0.201 ], "P_xyz": [ 0.331, 9.095, 1.535 ], "form": ".", "ssZp": -0.084, "Dp": 0.073, "splay_angle": 128.131, "splay_distance": 17.210, "splay_ratio": 0.900, "d22": 8.937, "d64": 10.943, "eta": 2.502, "theta": -0.442, "eta_prime": 14.658, "theta_prime": -21.945, "eta_base": 6.577, "theta_base": 18.382, "v0": -20.858, "v1": 35.534, "v2": -37.183, "v3": 25.838, "v4": -3.315, "amplitude": 38.222, "phase_angle": 166.611, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.770, "filter_rmsd": 0.113, "frame": { "rmsd": 0.015, "origin": [ 31.918, 32.912, 7.742 ], "x_axis": [ 0.608, -0.419, 0.675 ], "y_axis": [ -0.582, -0.813, 0.019 ], "z_axis": [ 0.541, -0.404, -0.738 ], "quaternion": [ 0.119, 0.889, -0.282, 0.342 ] } }, { "index": 65, "index_chain": 52, "chain_name": "P", "nt_resnum": 52, "nt_name": "C", "nt_code": "C", "nt_id": "///P/52", "linked_nts": [ "///P/51", "///P/53" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,bulge,junction-loop,splayed-apart", "alpha": -76.389, "beta": -156.339, "gamma": 53.916, "delta": 78.883, "epsilon": -160.668, "zeta": -55.228, "epsilon_zeta": -105.440, "bb_type": "BI", "chi": -162.139, "glyco_bond": "anti", "C5prime_xyz": [ -1.476, 8.719, 0.648 ], "P_xyz": [ 1.040, 8.890, 1.348 ], "form": ".", "ssZp": 4.483, "Dp": 4.635, "splay_angle": 32.600, "splay_distance": 4.868, "splay_ratio": 0.281, "d22": null, "d64": null, "eta": 148.352, "theta": -129.185, "eta_prime": -172.560, "theta_prime": -124.574, "eta_base": -172.572, "theta_base": -76.360, "v0": 6.424, "v1": -33.589, "v2": 45.939, "v3": -43.662, "v4": 23.567, "amplitude": 46.782, "phase_angle": 10.896, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.426, "filter_rmsd": 0.070, "frame": { "rmsd": 0.011, "origin": [ 19.770, 20.839, 6.049 ], "x_axis": [ 0.070, 0.344, 0.936 ], "y_axis": [ 0.542, 0.775, -0.325 ], "z_axis": [ -0.838, 0.530, -0.132 ], "quaternion": [ 0.654, -0.327, -0.678, -0.076 ] } }, { "index": 66, "index_chain": 53, "chain_name": "P", "nt_resnum": 53, "nt_name": "G", "nt_code": "G", "nt_id": "///P/53", "linked_nts": [ "///P/52", "///P/54" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,bulge", "alpha": -113.148, "beta": -150.756, "gamma": 71.701, "delta": 79.866, "epsilon": -151.995, "zeta": -62.780, "epsilon_zeta": -89.215, "bb_type": "BI", "chi": -165.719, "glyco_bond": "anti", "C5prime_xyz": [ -1.163, 8.614, 0.893 ], "P_xyz": [ 1.450, 8.550, 1.224 ], "form": "A", "ssZp": 4.555, "Dp": 4.679, "splay_angle": 23.993, "splay_distance": 3.851, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 163.229, "theta": -138.932, "eta_prime": -179.327, "theta_prime": -139.144, "eta_base": -113.194, "theta_base": -120.502, "v0": 10.656, "v1": -34.954, "v2": 44.958, "v3": -39.770, "v4": 18.516, "amplitude": 45.146, "phase_angle": 5.235, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.010, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 17.711, 24.348, 8.721 ], "x_axis": [ 0.732, 0.635, 0.247 ], "y_axis": [ 0.183, 0.166, -0.969 ], "z_axis": [ -0.656, 0.755, 0.006 ], "quaternion": [ 0.690, -0.625, -0.327, 0.164 ] } }, { "index": 67, "index_chain": 54, "chain_name": "P", "nt_resnum": 54, "nt_name": "G", "nt_code": "G", "nt_id": "///P/54", "linked_nts": [ "///P/53", "///P/55" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -80.435, "beta": -176.601, "gamma": 61.144, "delta": 75.330, "epsilon": -145.540, "zeta": -68.637, "epsilon_zeta": -76.903, "bb_type": "BI", "chi": -168.039, "glyco_bond": "anti", "C5prime_xyz": [ -1.420, 8.685, 0.960 ], "P_xyz": [ 1.083, 9.338, 1.121 ], "form": "A", "ssZp": 4.639, "Dp": 4.762, "splay_angle": 23.325, "splay_distance": 3.716, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 167.780, "theta": -150.980, "eta_prime": 179.534, "theta_prime": -149.125, "eta_base": -144.644, "theta_base": -120.291, "v0": 5.959, "v1": -32.809, "v2": 45.503, "v3": -43.130, "v4": 23.745, "amplitude": 46.410, "phase_angle": 11.348, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.686, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 16.009, 27.079, 10.838 ], "x_axis": [ 0.808, 0.529, -0.261 ], "y_axis": [ -0.226, -0.132, -0.965 ], "z_axis": [ -0.545, 0.838, 0.012 ], "quaternion": [ 0.650, -0.694, -0.109, 0.290 ] } }, { "index": 68, "index_chain": 55, "chain_name": "P", "nt_resnum": 55, "nt_name": "C", "nt_code": "C", "nt_id": "///P/55", "linked_nts": [ "///P/54", "///P/56" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -64.312, "beta": 173.853, "gamma": 53.215, "delta": 75.937, "epsilon": -146.062, "zeta": -76.181, "epsilon_zeta": -69.881, "bb_type": "BI", "chi": -165.008, "glyco_bond": "anti", "C5prime_xyz": [ -1.167, 8.684, 0.823 ], "P_xyz": [ 1.343, 9.258, 0.708 ], "form": "A", "ssZp": 4.616, "Dp": 4.792, "splay_angle": 23.106, "splay_distance": 3.680, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 168.523, "theta": -151.809, "eta_prime": -179.802, "theta_prime": -146.950, "eta_base": -136.314, "theta_base": -124.367, "v0": 11.913, "v1": -35.927, "v2": 44.992, "v3": -39.153, "v4": 17.552, "amplitude": 45.084, "phase_angle": 3.663, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.846, "filter_rmsd": 0.070, "frame": { "rmsd": 0.012, "origin": [ 15.863, 30.542, 12.178 ], "x_axis": [ 0.562, 0.372, -0.739 ], "y_axis": [ -0.676, -0.308, -0.669 ], "z_axis": [ -0.477, 0.876, 0.078 ], "quaternion": [ 0.577, -0.669, 0.114, 0.454 ] } }, { "index": 69, "index_chain": 56, "chain_name": "P", "nt_resnum": 56, "nt_name": "G", "nt_code": "G", "nt_id": "///P/56", "linked_nts": [ "///P/55", "///P/57" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor", "alpha": -49.502, "beta": 165.856, "gamma": 54.554, "delta": 81.030, "epsilon": -161.978, "zeta": -60.028, "epsilon_zeta": -101.950, "bb_type": "BI", "chi": -162.607, "glyco_bond": "anti", "C5prime_xyz": [ -1.633, 8.800, 0.635 ], "P_xyz": [ 0.995, 9.289, 0.703 ], "form": ".", "ssZp": 4.425, "Dp": 4.526, "splay_angle": 24.117, "splay_distance": 4.187, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 174.211, "theta": -123.225, "eta_prime": -168.671, "theta_prime": -136.795, "eta_base": -132.295, "theta_base": -112.964, "v0": -1.118, "v1": -22.568, "v2": 36.390, "v3": -38.115, "v4": 24.662, "amplitude": 38.789, "phase_angle": 20.254, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.737, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 16.418, 34.151, 12.637 ], "x_axis": [ 0.222, 0.094, -0.971 ], "y_axis": [ -0.909, -0.340, -0.241 ], "z_axis": [ -0.352, 0.936, 0.010 ], "quaternion": [ -0.472, 0.623, -0.327, -0.531 ] } }, { "index": 70, "index_chain": 57, "chain_name": "P", "nt_resnum": 57, "nt_name": "G", "nt_code": "G", "nt_id": "///P/57", "linked_nts": [ "///P/56", "///P/58" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": 161.546, "beta": 168.371, "gamma": -179.398, "delta": 89.884, "epsilon": -126.544, "zeta": -58.474, "epsilon_zeta": -68.069, "bb_type": "--", "chi": 179.783, "glyco_bond": "anti", "C5prime_xyz": [ -0.906, 7.966, 1.753 ], "P_xyz": [ 0.282, 10.100, 0.925 ], "form": ".", "ssZp": 4.814, "Dp": 4.816, "splay_angle": 28.986, "splay_distance": 4.479, "splay_ratio": 0.253, "d22": null, "d64": null, "eta": 172.802, "theta": -151.340, "eta_prime": -177.842, "theta_prime": -139.750, "eta_base": -131.449, "theta_base": -85.523, "v0": 21.935, "v1": -40.616, "v2": 42.259, "v3": -29.810, "v4": 5.129, "amplitude": 43.201, "phase_angle": 348.014, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.633, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 17.492, 37.956, 11.258 ], "x_axis": [ -0.286, -0.100, -0.953 ], "y_axis": [ -0.902, -0.308, 0.303 ], "z_axis": [ -0.323, 0.946, -0.002 ], "quaternion": [ 0.318, -0.506, 0.495, 0.631 ] } }, { "index": 71, "index_chain": 58, "chain_name": "P", "nt_resnum": 58, "nt_name": "A", "nt_code": "A", "nt_id": "///P/58", "linked_nts": [ "///P/57", "///P/59" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -56.646, "beta": 172.443, "gamma": 41.691, "delta": 79.447, "epsilon": -139.910, "zeta": -134.886, "epsilon_zeta": -5.024, "bb_type": "--", "chi": -157.664, "glyco_bond": "anti", "C5prime_xyz": [ -1.335, 8.712, 0.430 ], "P_xyz": [ 1.243, 9.076, 0.683 ], "form": ".", "ssZp": 4.317, "Dp": 4.700, "splay_angle": 102.494, "splay_distance": 14.165, "splay_ratio": 0.780, "d22": null, "d64": null, "eta": 158.221, "theta": -177.397, "eta_prime": -174.622, "theta_prime": 153.174, "eta_base": -102.438, "theta_base": 107.399, "v0": 7.329, "v1": -32.188, "v2": 43.695, "v3": -40.426, "v4": 20.841, "amplitude": 44.263, "phase_angle": 9.187, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.496, "filter_rmsd": 0.037, "frame": { "rmsd": 0.009, "origin": [ 15.364, 40.131, 7.972 ], "x_axis": [ -0.906, -0.297, -0.300 ], "y_axis": [ -0.328, 0.049, 0.943 ], "z_axis": [ -0.266, 0.953, -0.143 ], "quaternion": [ 0.012, -0.216, 0.724, 0.655 ] } }, { "index": 72, "index_chain": 59, "chain_name": "P", "nt_resnum": 59, "nt_name": "U", "nt_code": "U", "nt_id": "///P/59", "linked_nts": [ "///P/58", "///P/60" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 80.233, "beta": -173.454, "gamma": 163.931, "delta": 153.930, "epsilon": -93.816, "zeta": -57.410, "epsilon_zeta": -36.406, "bb_type": "--", "chi": -145.782, "glyco_bond": "anti", "C5prime_xyz": [ -1.638, 8.513, 0.401 ], "P_xyz": [ 0.731, 9.310, -0.252 ], "form": ".", "ssZp": 0.330, "Dp": 0.419, "splay_angle": 120.107, "splay_distance": 16.318, "splay_ratio": 0.867, "d22": null, "d64": null, "eta": 130.618, "theta": -87.515, "eta_prime": 115.695, "theta_prime": -79.714, "eta_base": 86.038, "theta_base": -43.102, "v0": -14.074, "v1": 34.258, "v2": -39.675, "v3": 32.932, "v4": -12.288, "amplitude": 39.688, "phase_angle": 178.540, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.009, "origin": [ 21.876, 45.184, 19.491 ], "x_axis": [ -0.356, -0.807, 0.470 ], "y_axis": [ -0.838, 0.054, -0.542 ], "z_axis": [ 0.413, -0.587, -0.696 ], "quaternion": [ -0.020, -0.567, 0.726, -0.389 ] } }, { "index": 73, "index_chain": 60, "chain_name": "P", "nt_resnum": 60, "nt_name": "G", "nt_code": "G", "nt_id": "///P/60", "linked_nts": [ "///P/59", "///P/61" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -70.055, "beta": 179.543, "gamma": 64.389, "delta": 85.641, "epsilon": -144.628, "zeta": -64.311, "epsilon_zeta": -80.317, "bb_type": "BI", "chi": -176.775, "glyco_bond": "anti", "C5prime_xyz": [ -1.193, 8.317, 1.574 ], "P_xyz": [ 1.315, 8.284, 2.162 ], "form": "A", "ssZp": 4.555, "Dp": 4.588, "splay_angle": 20.738, "splay_distance": 3.187, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 163.400, "theta": -129.787, "eta_prime": -150.348, "theta_prime": -127.540, "eta_base": -126.938, "theta_base": -88.179, "v0": 8.309, "v1": -28.855, "v2": 37.258, "v3": -33.824, "v4": 16.076, "amplitude": 37.487, "phase_angle": 6.338, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.593, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 12.921, 46.236, 5.890 ], "x_axis": [ -0.715, 0.073, 0.696 ], "y_axis": [ 0.690, 0.238, 0.684 ], "z_axis": [ -0.116, 0.969, -0.220 ], "quaternion": [ -0.275, 0.259, 0.737, 0.560 ] } }, { "index": 74, "index_chain": 61, "chain_name": "P", "nt_resnum": 61, "nt_name": "A", "nt_code": "A", "nt_id": "///P/61", "linked_nts": [ "///P/60", "///P/62" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -82.839, "beta": -176.877, "gamma": 57.814, "delta": 84.691, "epsilon": -139.594, "zeta": -80.782, "epsilon_zeta": -58.812, "bb_type": "BI", "chi": -153.136, "glyco_bond": "anti", "C5prime_xyz": [ -1.327, 8.647, 0.101 ], "P_xyz": [ 1.281, 8.871, 0.067 ], "form": "A", "ssZp": 4.160, "Dp": 4.699, "splay_angle": 22.741, "splay_distance": 3.641, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 163.728, "theta": -143.119, "eta_prime": -177.518, "theta_prime": -143.477, "eta_base": -120.887, "theta_base": -120.082, "v0": 7.206, "v1": -29.333, "v2": 39.237, "v3": -36.009, "v4": 18.381, "amplitude": 39.663, "phase_angle": 8.410, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.678, "filter_rmsd": 0.034, "frame": { "rmsd": 0.014, "origin": [ 11.040, 48.809, 5.948 ], "x_axis": [ -0.056, 0.274, 0.960 ], "y_axis": [ 0.951, 0.306, -0.032 ], "z_axis": [ -0.303, 0.912, -0.278 ], "quaternion": [ -0.493, 0.479, 0.640, 0.343 ] } }, { "index": 75, "index_chain": 62, "chain_name": "P", "nt_resnum": 62, "nt_name": "C", "nt_code": "C", "nt_id": "///P/62", "linked_nts": [ "///P/61", "///P/63" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.772, "beta": 163.722, "gamma": 54.626, "delta": 74.292, "epsilon": -143.940, "zeta": -75.923, "epsilon_zeta": -68.017, "bb_type": "BI", "chi": -158.736, "glyco_bond": "anti", "C5prime_xyz": [ -1.446, 8.830, 0.448 ], "P_xyz": [ 1.081, 9.218, 0.095 ], "form": "A", "ssZp": 4.423, "Dp": 4.786, "splay_angle": 22.776, "splay_distance": 3.526, "splay_ratio": 0.198, "d22": 3.696, "d64": 3.642, "eta": 161.676, "theta": -147.558, "eta_prime": 173.522, "theta_prime": -146.056, "eta_base": -147.990, "theta_base": -110.854, "v0": 6.045, "v1": -33.006, "v2": 45.429, "v3": -43.275, "v4": 23.857, "amplitude": 46.336, "phase_angle": 11.357, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.796, "filter_rmsd": 0.070, "frame": { "rmsd": 0.009, "origin": [ 9.248, 51.975, 6.092 ], "x_axis": [ 0.489, 0.164, 0.857 ], "y_axis": [ 0.826, 0.229, -0.515 ], "z_axis": [ -0.280, 0.960, -0.023 ], "quaternion": [ 0.651, -0.566, -0.437, -0.255 ] } }, { "index": 76, "index_chain": 63, "chain_name": "P", "nt_resnum": 63, "nt_name": "U", "nt_code": "U", "nt_id": "///P/63", "linked_nts": [ "///P/62", "///P/64" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.928, "beta": 167.477, "gamma": 44.029, "delta": 77.681, "epsilon": -167.947, "zeta": -60.907, "epsilon_zeta": -107.040, "bb_type": "BI", "chi": -160.197, "glyco_bond": "anti", "C5prime_xyz": [ -1.367, 8.618, 0.599 ], "P_xyz": [ 1.227, 8.860, 0.617 ], "form": "A", "ssZp": 4.534, "Dp": 4.681, "splay_angle": 19.687, "splay_distance": 3.062, "splay_ratio": 0.173, "d22": 4.179, "d64": 4.030, "eta": 166.623, "theta": -145.783, "eta_prime": -177.991, "theta_prime": -147.038, "eta_base": -125.182, "theta_base": -122.809, "v0": 13.610, "v1": -37.376, "v2": 45.183, "v3": -38.969, "v4": 16.290, "amplitude": 45.204, "phase_angle": 1.760, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.695, "filter_rmsd": 0.108, "frame": { "rmsd": 0.008, "origin": [ 8.937, 55.000, 7.876 ], "x_axis": [ 0.920, 0.094, 0.379 ], "y_axis": [ 0.354, 0.209, -0.911 ], "z_axis": [ -0.165, 0.973, 0.159 ], "quaternion": [ 0.756, -0.623, -0.180, -0.086 ] } }, { "index": 77, "index_chain": 64, "chain_name": "P", "nt_resnum": 64, "nt_name": "C", "nt_code": "C", "nt_id": "///P/64", "linked_nts": [ "///P/63", "///P/65" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -118.404, "beta": -173.677, "gamma": 91.079, "delta": 79.780, "epsilon": -131.462, "zeta": -77.280, "epsilon_zeta": -54.182, "bb_type": "BI", "chi": -166.642, "glyco_bond": "anti", "C5prime_xyz": [ -1.316, 8.690, 0.969 ], "P_xyz": [ 1.265, 8.988, 0.489 ], "form": "A", "ssZp": 4.600, "Dp": 4.804, "splay_angle": 19.494, "splay_distance": 3.190, "splay_ratio": 0.172, "d22": 3.978, "d64": 4.183, "eta": 168.135, "theta": -141.446, "eta_prime": 179.394, "theta_prime": -145.138, "eta_base": -141.622, "theta_base": -125.163, "v0": 8.215, "v1": -31.179, "v2": 40.998, "v3": -37.091, "v4": 18.556, "amplitude": 41.337, "phase_angle": 7.340, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.070, "frame": { "rmsd": 0.009, "origin": [ 8.869, 57.336, 9.855 ], "x_axis": [ 0.977, 0.078, -0.201 ], "y_axis": [ -0.215, 0.299, -0.930 ], "z_axis": [ -0.012, 0.951, 0.309 ], "quaternion": [ 0.804, -0.585, 0.059, 0.091 ] } }, { "index": 78, "index_chain": 65, "chain_name": "P", "nt_resnum": 65, "nt_name": "C", "nt_code": "C", "nt_id": "///P/65", "linked_nts": [ "///P/64", "///P/66" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -72.181, "beta": 149.781, "gamma": 70.387, "delta": 72.560, "epsilon": -125.134, "zeta": -92.654, "epsilon_zeta": -32.480, "bb_type": "--", "chi": -170.908, "glyco_bond": "anti", "C5prime_xyz": [ -1.621, 8.792, 1.189 ], "P_xyz": [ 0.802, 9.505, 0.640 ], "form": "A", "ssZp": 4.639, "Dp": 4.808, "splay_angle": 25.982, "splay_distance": 4.056, "splay_ratio": 0.225, "d22": 4.001, "d64": 3.983, "eta": 165.874, "theta": -151.277, "eta_prime": 178.526, "theta_prime": -148.650, "eta_base": -143.362, "theta_base": -115.078, "v0": 2.561, "v1": -30.417, "v2": 44.973, "v3": -44.692, "v4": 26.735, "amplitude": 46.676, "phase_angle": 15.525, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.361, "filter_rmsd": 0.067, "frame": { "rmsd": 0.008, "origin": [ 9.961, 59.578, 11.845 ], "x_axis": [ 0.760, 0.121, -0.638 ], "y_axis": [ -0.633, 0.359, -0.686 ], "z_axis": [ 0.146, 0.925, 0.350 ], "quaternion": [ 0.786, -0.513, 0.250, 0.240 ] } }, { "index": 79, "index_chain": 66, "chain_name": "P", "nt_resnum": 66, "nt_name": "C", "nt_code": "C", "nt_id": "///P/66", "linked_nts": [ "///P/65", "///P/67" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -50.867, "beta": 151.404, "gamma": 48.144, "delta": 76.376, "epsilon": -149.495, "zeta": -69.866, "epsilon_zeta": -79.629, "bb_type": "BI", "chi": -171.017, "glyco_bond": "anti", "C5prime_xyz": [ -1.465, 8.643, 1.214 ], "P_xyz": [ 1.157, 8.888, 1.298 ], "form": "A", "ssZp": 4.615, "Dp": 4.651, "splay_angle": 21.358, "splay_distance": 3.316, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 163.637, "theta": -144.174, "eta_prime": 177.624, "theta_prime": -142.498, "eta_base": -133.048, "theta_base": -112.163, "v0": 4.185, "v1": -29.356, "v2": 42.089, "v3": -41.260, "v4": 23.199, "amplitude": 43.271, "phase_angle": 13.424, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.353, "filter_rmsd": 0.065, "frame": { "rmsd": 0.006, "origin": [ 12.183, 62.900, 12.540 ], "x_axis": [ 0.173, 0.077, -0.982 ], "y_axis": [ -0.965, 0.213, -0.153 ], "z_axis": [ 0.198, 0.974, 0.111 ], "quaternion": [ 0.612, -0.460, 0.482, 0.426 ] } }, { "index": 80, "index_chain": 67, "chain_name": "P", "nt_resnum": 67, "nt_name": "G", "nt_code": "G", "nt_id": "///P/67", "linked_nts": [ "///P/66", "///P/68" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor", "alpha": -71.361, "beta": -175.281, "gamma": 54.938, "delta": 83.749, "epsilon": -172.215, "zeta": -62.966, "epsilon_zeta": -109.249, "bb_type": "BI", "chi": -158.455, "glyco_bond": "anti", "C5prime_xyz": [ -1.311, 8.696, 0.450 ], "P_xyz": [ 1.283, 8.989, 0.664 ], "form": "A", "ssZp": 4.411, "Dp": 4.510, "splay_angle": 23.592, "splay_distance": 3.939, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 167.519, "theta": -126.235, "eta_prime": -177.670, "theta_prime": -136.383, "eta_base": -130.511, "theta_base": -110.210, "v0": 6.379, "v1": -27.540, "v2": 36.833, "v3": -34.225, "v4": 17.772, "amplitude": 37.298, "phase_angle": 9.061, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.871, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 14.272, 65.347, 11.741 ], "x_axis": [ -0.457, 0.124, -0.881 ], "y_axis": [ -0.839, 0.269, 0.473 ], "z_axis": [ 0.296, 0.955, -0.019 ], "quaternion": [ 0.445, -0.270, 0.661, 0.541 ] } }, { "index": 81, "index_chain": 68, "chain_name": "P", "nt_resnum": 68, "nt_name": "G", "nt_code": "G", "nt_id": "///P/68", "linked_nts": [ "///P/67", "///P/69" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": 163.649, "beta": -172.954, "gamma": 165.787, "delta": 80.571, "epsilon": -152.548, "zeta": -72.813, "epsilon_zeta": -79.735, "bb_type": "BI", "chi": -174.254, "glyco_bond": "anti", "C5prime_xyz": [ -0.796, 8.188, 1.441 ], "P_xyz": [ 0.926, 9.770, 0.336 ], "form": ".", "ssZp": 4.731, "Dp": 4.740, "splay_angle": 30.821, "splay_distance": 4.810, "splay_ratio": 0.275, "d22": null, "d64": null, "eta": 160.413, "theta": -174.780, "eta_prime": 178.487, "theta_prime": -171.307, "eta_base": -127.672, "theta_base": -166.515, "v0": 20.830, "v1": -42.432, "v2": 46.936, "v3": -36.245, "v4": 9.921, "amplitude": 47.264, "phase_angle": 353.251, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.628, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 15.692, 68.139, 9.352 ], "x_axis": [ -0.822, 0.327, -0.466 ], "y_axis": [ -0.406, 0.237, 0.883 ], "z_axis": [ 0.399, 0.915, -0.062 ], "quaternion": [ 0.297, -0.027, 0.728, 0.617 ] } }, { "index": 82, "index_chain": 69, "chain_name": "P", "nt_resnum": 69, "nt_name": "U", "nt_code": "U", "nt_id": "///P/69", "linked_nts": [ "///P/68", "///P/70" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor", "alpha": -64.491, "beta": -176.982, "gamma": 58.162, "delta": 80.892, "epsilon": -154.143, "zeta": -64.192, "epsilon_zeta": -89.951, "bb_type": "BI", "chi": -167.011, "glyco_bond": "anti", "C5prime_xyz": [ -1.578, 8.714, 0.937 ], "P_xyz": [ 0.942, 9.231, 1.433 ], "form": "A", "ssZp": 4.493, "Dp": 4.553, "splay_angle": 23.737, "splay_distance": 3.714, "splay_ratio": 0.208, "d22": 3.977, "d64": 3.802, "eta": -179.823, "theta": -140.321, "eta_prime": -172.140, "theta_prime": -138.885, "eta_base": -163.577, "theta_base": -98.572, "v0": 4.327, "v1": -29.325, "v2": 41.887, "v3": -40.504, "v4": 22.716, "amplitude": 42.974, "phase_angle": 12.918, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.929, "filter_rmsd": 0.108, "frame": { "rmsd": 0.011, "origin": [ 19.428, 70.000, 6.960 ], "x_axis": [ -0.936, 0.274, -0.220 ], "y_axis": [ -0.184, 0.154, 0.971 ], "z_axis": [ 0.300, 0.949, -0.094 ], "quaternion": [ 0.176, 0.031, 0.739, 0.650 ] } }, { "index": 83, "index_chain": 70, "chain_name": "P", "nt_resnum": 70, "nt_name": "U", "nt_code": "U", "nt_id": "///P/70", "linked_nts": [ "///P/69", "///P/71" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -82.398, "beta": -176.045, "gamma": 59.208, "delta": 80.391, "epsilon": -154.469, "zeta": -61.936, "epsilon_zeta": -92.533, "bb_type": "BI", "chi": -164.222, "glyco_bond": "anti", "C5prime_xyz": [ -1.327, 8.722, 0.814 ], "P_xyz": [ 1.304, 9.055, 1.066 ], "form": "A", "ssZp": 4.564, "Dp": 4.672, "splay_angle": 20.228, "splay_distance": 3.271, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 161.805, "theta": -138.481, "eta_prime": 177.823, "theta_prime": -138.652, "eta_base": -124.012, "theta_base": -109.415, "v0": 10.157, "v1": -34.191, "v2": 44.223, "v3": -38.750, "v4": 18.287, "amplitude": 44.414, "phase_angle": 5.327, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.693, "filter_rmsd": 0.110, "frame": { "rmsd": 0.008, "origin": [ 18.670, 73.302, 5.438 ], "x_axis": [ -0.832, 0.186, 0.523 ], "y_axis": [ 0.529, -0.020, 0.848 ], "z_axis": [ 0.168, 0.982, -0.082 ], "quaternion": [ -0.129, 0.260, 0.688, 0.665 ] } }, { "index": 84, "index_chain": 71, "chain_name": "P", "nt_resnum": 71, "nt_name": "G", "nt_code": "G", "nt_id": "///P/71", "linked_nts": [ "///P/70", "///P/72" ], "nt_type": "RNA", "dbn": "(", "summary": "turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -85.871, "beta": -174.813, "gamma": 59.161, "delta": 76.275, "epsilon": -152.042, "zeta": 138.191, "epsilon_zeta": 69.766, "bb_type": "--", "chi": -159.411, "glyco_bond": "anti", "C5prime_xyz": [ -1.444, 8.802, 0.472 ], "P_xyz": [ 1.128, 9.349, 0.633 ], "form": ".", "ssZp": 4.429, "Dp": 4.683, "splay_angle": 161.485, "splay_distance": 17.910, "splay_ratio": 0.987, "d22": null, "d64": null, "eta": 160.943, "theta": 23.790, "eta_prime": 174.899, "theta_prime": 13.576, "eta_base": -138.793, "theta_base": 20.895, "v0": 3.923, "v1": -30.392, "v2": 43.847, "v3": -42.690, "v4": 24.491, "amplitude": 45.129, "phase_angle": 13.688, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.577, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 17.111, 76.116, 4.850 ], "x_axis": [ -0.363, -0.052, 0.930 ], "y_axis": [ 0.930, 0.047, 0.366 ], "z_axis": [ -0.063, 0.998, 0.031 ], "quaternion": [ -0.423, 0.374, 0.587, 0.580 ] } }, { "index": 85, "index_chain": 72, "chain_name": "P", "nt_resnum": 72, "nt_name": "U", "nt_code": "U", "nt_id": "///P/72", "linked_nts": [ "///P/71", "///P/73" ], "nt_type": "RNA", "dbn": ".", "summary": "non-stack,hairpin-loop,splayed-apart", "alpha": -54.082, "beta": -86.551, "gamma": -45.740, "delta": 163.692, "epsilon": 17.105, "zeta": -179.718, "epsilon_zeta": -163.177, "bb_type": "--", "chi": 162.381, "glyco_bond": "--", "C5prime_xyz": [ -1.636, 6.432, 2.790 ], "P_xyz": [ -2.306, 7.512, 5.082 ], "form": ".", "ssZp": -0.161, "Dp": 1.172, "splay_angle": 112.317, "splay_distance": 15.239, "splay_ratio": 0.831, "d22": 9.662, "d64": 12.410, "eta": -107.184, "theta": -126.439, "eta_prime": -81.706, "theta_prime": -134.537, "eta_base": -76.588, "theta_base": -94.928, "v0": 15.783, "v1": 13.331, "v2": -35.243, "v3": 44.544, "v4": -38.614, "amplitude": 44.897, "phase_angle": 218.283, "puckering": "C4'-endo", "sugar_class": "--", "bin": "32m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.012, "origin": [ 33.187, 83.691, 7.078 ], "x_axis": [ 0.554, -0.801, -0.226 ], "y_axis": [ -0.736, -0.598, 0.316 ], "z_axis": [ -0.389, -0.009, -0.921 ], "quaternion": [ 0.093, 0.877, -0.439, -0.175 ] } }, { "index": 86, "index_chain": 73, "chain_name": "P", "nt_resnum": 73, "nt_name": "U", "nt_code": "U", "nt_id": "///P/73", "linked_nts": [ "///P/72", "///P/74" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -46.840, "beta": -97.603, "gamma": -87.650, "delta": 127.013, "epsilon": -90.293, "zeta": -61.138, "epsilon_zeta": -29.154, "bb_type": "--", "chi": 147.013, "glyco_bond": "--", "C5prime_xyz": [ -1.228, 5.819, 2.792 ], "P_xyz": [ -0.329, 7.276, 4.729 ], "form": ".", "ssZp": 4.225, "Dp": 4.399, "splay_angle": 13.482, "splay_distance": 2.472, "splay_ratio": 0.129, "d22": 4.838, "d64": 4.892, "eta": -155.051, "theta": -127.028, "eta_prime": -132.675, "theta_prime": -116.377, "eta_base": -127.221, "theta_base": -95.858, "v0": 41.688, "v1": -33.919, "v2": 15.044, "v3": 8.794, "v4": -32.412, "amplitude": 40.828, "phase_angle": 291.621, "puckering": "C1'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.113, "frame": { "rmsd": 0.014, "origin": [ 19.726, 89.426, 11.341 ], "x_axis": [ 0.106, 0.168, -0.980 ], "y_axis": [ 0.913, -0.407, 0.029 ], "z_axis": [ -0.394, -0.898, -0.197 ], "quaternion": [ 0.354, 0.654, 0.414, -0.525 ] } }, { "index": 87, "index_chain": 74, "chain_name": "P", "nt_resnum": 74, "nt_name": "C", "nt_code": "C", "nt_id": "///P/74", "linked_nts": [ "///P/73", "///P/75" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -71.241, "beta": 135.444, "gamma": 74.867, "delta": 69.341, "epsilon": -125.012, "zeta": -50.361, "epsilon_zeta": -74.651, "bb_type": "--", "chi": -163.636, "glyco_bond": "anti", "C5prime_xyz": [ -2.263, 9.067, 0.557 ], "P_xyz": [ -0.098, 10.066, -0.543 ], "form": "A", "ssZp": 4.304, "Dp": 4.642, "splay_angle": 23.319, "splay_distance": 3.868, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 136.179, "theta": -141.587, "eta_prime": 174.762, "theta_prime": -160.970, "eta_base": -146.833, "theta_base": -149.799, "v0": -10.568, "v1": -20.131, "v2": 41.259, "v3": -48.163, "v4": 37.118, "amplitude": 48.038, "phase_angle": 30.807, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.007, "origin": [ 17.414, 88.878, 10.661 ], "x_axis": [ 0.294, -0.395, -0.870 ], "y_axis": [ 0.528, -0.692, 0.492 ], "z_axis": [ -0.797, -0.604, 0.005 ], "quaternion": [ 0.389, 0.704, 0.047, -0.592 ] } }, { "index": 88, "index_chain": 75, "chain_name": "P", "nt_resnum": 75, "nt_name": "A", "nt_code": "A", "nt_id": "///P/75", "linked_nts": [ "///P/74", "///P/76" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -128.410, "beta": 80.036, "gamma": 152.381, "delta": 98.577, "epsilon": -138.716, "zeta": -71.648, "epsilon_zeta": -67.068, "bb_type": "BI", "chi": 177.737, "glyco_bond": "anti", "C5prime_xyz": [ -0.809, 7.660, 1.939 ], "P_xyz": [ -0.170, 9.705, 0.399 ], "form": ".", "ssZp": 4.628, "Dp": 4.651, "splay_angle": 30.981, "splay_distance": 4.645, "splay_ratio": 0.268, "d22": null, "d64": null, "eta": 169.238, "theta": -149.269, "eta_prime": 166.545, "theta_prime": -141.564, "eta_base": -168.777, "theta_base": -94.401, "v0": 25.570, "v1": -35.342, "v2": 31.788, "v3": -17.864, "v4": -4.711, "amplitude": 35.373, "phase_angle": 333.980, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.048, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 13.870, 87.589, 9.798 ], "x_axis": [ 0.751, -0.278, -0.599 ], "y_axis": [ 0.387, -0.550, 0.740 ], "z_axis": [ -0.536, -0.787, -0.306 ], "quaternion": [ 0.473, 0.807, 0.034, -0.351 ] } }, { "index": 89, "index_chain": 76, "chain_name": "P", "nt_resnum": 76, "nt_name": "U", "nt_code": "U", "nt_id": "///P/76", "linked_nts": [ "///P/75", "///P/77" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -159.430, "beta": -128.672, "gamma": 95.635, "delta": 75.720, "epsilon": -147.953, "zeta": -93.468, "epsilon_zeta": -54.485, "bb_type": "BI", "chi": -168.022, "glyco_bond": "anti", "C5prime_xyz": [ -1.581, 8.737, 1.027 ], "P_xyz": [ 1.056, 8.690, 1.143 ], "form": "A", "ssZp": 4.664, "Dp": 4.742, "splay_angle": 17.630, "splay_distance": 2.764, "splay_ratio": 0.156, "d22": 4.767, "d64": 4.595, "eta": 134.407, "theta": -154.457, "eta_prime": 165.179, "theta_prime": -155.755, "eta_base": -128.108, "theta_base": -148.090, "v0": 5.156, "v1": -31.173, "v2": 43.820, "v3": -41.842, "v4": 23.293, "amplitude": 44.808, "phase_angle": 12.057, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.008, "origin": [ 14.203, 83.717, 7.253 ], "x_axis": [ 0.856, -0.301, 0.419 ], "y_axis": [ -0.459, -0.072, 0.886 ], "z_axis": [ -0.237, -0.951, -0.200 ], "quaternion": [ 0.629, 0.730, -0.260, 0.063 ] } }, { "index": 90, "index_chain": 77, "chain_name": "P", "nt_resnum": 77, "nt_name": "C", "nt_code": "C", "nt_id": "///P/77", "linked_nts": [ "///P/76", "///P/78" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -47.471, "beta": 155.552, "gamma": 47.757, "delta": 79.092, "epsilon": -148.889, "zeta": -112.973, "epsilon_zeta": -35.916, "bb_type": "BI", "chi": -152.730, "glyco_bond": "anti", "C5prime_xyz": [ -1.306, 8.883, 0.097 ], "P_xyz": [ 1.336, 9.023, -0.244 ], "form": "A", "ssZp": 4.275, "Dp": 4.710, "splay_angle": 19.410, "splay_distance": 3.137, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 170.490, "theta": -138.462, "eta_prime": 178.715, "theta_prime": -145.946, "eta_base": -160.367, "theta_base": -137.974, "v0": 7.140, "v1": -31.785, "v2": 42.998, "v3": -39.716, "v4": 20.692, "amplitude": 43.561, "phase_angle": 9.221, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.466, "filter_rmsd": 0.068, "frame": { "rmsd": 0.008, "origin": [ 14.132, 81.944, 5.134 ], "x_axis": [ 0.583, -0.380, 0.719 ], "y_axis": [ -0.811, -0.223, 0.540 ], "z_axis": [ -0.045, -0.898, -0.438 ], "quaternion": [ 0.480, 0.749, -0.398, 0.225 ] } }, { "index": 91, "index_chain": 78, "chain_name": "P", "nt_resnum": 78, "nt_name": "A", "nt_code": "A", "nt_id": "///P/78", "linked_nts": [ "///P/77", "///P/79" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": 147.647, "beta": -121.338, "gamma": 157.731, "delta": 75.820, "epsilon": -138.745, "zeta": -92.385, "epsilon_zeta": -46.360, "bb_type": "BI", "chi": -175.250, "glyco_bond": "anti", "C5prime_xyz": [ -1.683, 8.570, 1.430 ], "P_xyz": [ 0.284, 9.401, -0.129 ], "form": "A", "ssZp": 4.768, "Dp": 4.793, "splay_angle": 26.778, "splay_distance": 4.042, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": 151.987, "theta": -149.970, "eta_prime": 169.166, "theta_prime": -154.752, "eta_base": -163.325, "theta_base": -116.272, "v0": 4.313, "v1": -29.935, "v2": 42.599, "v3": -41.031, "v4": 23.381, "amplitude": 43.712, "phase_angle": 12.957, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 15.140, 79.502, 3.442 ], "x_axis": [ 0.269, -0.170, 0.948 ], "y_axis": [ -0.942, -0.249, 0.223 ], "z_axis": [ 0.199, -0.953, -0.227 ], "quaternion": [ 0.445, 0.661, -0.421, 0.434 ] } }, { "index": 92, "index_chain": 79, "chain_name": "P", "nt_resnum": 79, "nt_name": "C", "nt_code": "C", "nt_id": "///P/79", "linked_nts": [ "///P/78", "///P/80" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -23.431, "beta": 146.742, "gamma": 32.041, "delta": 76.302, "epsilon": -128.565, "zeta": -87.093, "epsilon_zeta": -41.473, "bb_type": "--", "chi": -162.093, "glyco_bond": "anti", "C5prime_xyz": [ -1.127, 8.714, 0.708 ], "P_xyz": [ 1.552, 8.693, 0.749 ], "form": "A", "ssZp": 4.425, "Dp": 4.795, "splay_angle": 23.457, "splay_distance": 3.665, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 173.066, "theta": -145.453, "eta_prime": -173.492, "theta_prime": -142.647, "eta_base": -116.874, "theta_base": -125.678, "v0": 12.793, "v1": -37.103, "v2": 46.288, "v3": -40.156, "v4": 17.215, "amplitude": 46.351, "phase_angle": 3.003, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.007, "origin": [ 17.079, 76.083, 4.384 ], "x_axis": [ -0.436, -0.419, 0.796 ], "y_axis": [ -0.849, -0.101, -0.518 ], "z_axis": [ 0.297, -0.902, -0.312 ], "quaternion": [ -0.194, -0.494, 0.642, -0.553 ] } }, { "index": 93, "index_chain": 80, "chain_name": "P", "nt_resnum": 80, "nt_name": "A", "nt_code": "A", "nt_id": "///P/80", "linked_nts": [ "///P/79", "///P/81" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -64.850, "beta": 165.261, "gamma": 53.773, "delta": 75.242, "epsilon": -122.337, "zeta": -87.505, "epsilon_zeta": -34.832, "bb_type": "--", "chi": -166.990, "glyco_bond": "anti", "C5prime_xyz": [ -1.263, 8.631, 0.977 ], "P_xyz": [ 1.310, 9.046, 0.942 ], "form": "A", "ssZp": 4.543, "Dp": 4.830, "splay_angle": 20.961, "splay_distance": 3.307, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 167.055, "theta": -149.537, "eta_prime": 172.661, "theta_prime": -147.750, "eta_base": -160.818, "theta_base": -128.088, "v0": 8.371, "v1": -33.869, "v2": 45.196, "v3": -41.873, "v4": 21.075, "amplitude": 45.694, "phase_angle": 8.468, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.624, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 18.885, 72.933, 4.882 ], "x_axis": [ -0.853, 0.029, 0.522 ], "y_axis": [ -0.522, 0.008, -0.853 ], "z_axis": [ -0.029, -1.000, 0.009 ], "quaternion": [ 0.202, 0.181, -0.680, 0.681 ] } }, { "index": 94, "index_chain": 81, "chain_name": "P", "nt_resnum": 81, "nt_name": "A", "nt_code": "A", "nt_id": "///P/81", "linked_nts": [ "///P/80", "///P/82" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,ribose-zipper", "alpha": -77.048, "beta": 143.437, "gamma": 80.133, "delta": 74.896, "epsilon": -159.438, "zeta": -68.014, "epsilon_zeta": -91.424, "bb_type": "BI", "chi": -166.286, "glyco_bond": "anti", "C5prime_xyz": [ -1.261, 8.635, 0.931 ], "P_xyz": [ 0.953, 9.184, -0.368 ], "form": ".", "ssZp": 4.630, "Dp": 4.704, "splay_angle": 28.372, "splay_distance": 4.681, "splay_ratio": 0.258, "d22": null, "d64": null, "eta": 157.334, "theta": -127.423, "eta_prime": 174.447, "theta_prime": -140.615, "eta_base": -148.730, "theta_base": -117.281, "v0": 10.205, "v1": -35.576, "v2": 46.120, "v3": -41.185, "v4": 19.755, "amplitude": 46.382, "phase_angle": 6.096, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.276, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 18.956, 70.082, 6.557 ], "x_axis": [ -0.989, 0.095, 0.117 ], "y_axis": [ -0.136, -0.233, -0.963 ], "z_axis": [ -0.065, -0.968, 0.244 ], "quaternion": [ 0.074, 0.017, -0.615, 0.785 ] } }, { "index": 95, "index_chain": 82, "chain_name": "P", "nt_resnum": 82, "nt_name": "C", "nt_code": "C", "nt_id": "///P/82", "linked_nts": [ "///P/81", "///P/83" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper", "alpha": 164.962, "beta": -173.166, "gamma": 173.123, "delta": 84.153, "epsilon": -174.964, "zeta": -67.094, "epsilon_zeta": -107.871, "bb_type": "BI", "chi": -179.338, "glyco_bond": "anti", "C5prime_xyz": [ -0.948, 8.050, 1.790 ], "P_xyz": [ 0.970, 9.704, 1.172 ], "form": "A", "ssZp": 4.564, "Dp": 4.600, "splay_angle": 26.907, "splay_distance": 4.090, "splay_ratio": 0.237, "d22": 4.424, "d64": 4.764, "eta": 169.704, "theta": -154.245, "eta_prime": -172.644, "theta_prime": -148.969, "eta_base": -121.095, "theta_base": -121.126, "v0": 23.716, "v1": -42.413, "v2": 43.906, "v3": -30.862, "v4": 4.714, "amplitude": 45.014, "phase_angle": 347.259, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.795, "filter_rmsd": 0.068, "frame": { "rmsd": 0.009, "origin": [ 16.382, 67.516, 9.507 ], "x_axis": [ -0.845, 0.068, -0.531 ], "y_axis": [ 0.498, -0.266, -0.826 ], "z_axis": [ -0.197, -0.961, 0.191 ], "quaternion": [ -0.142, -0.240, -0.589, 0.759 ] } }, { "index": 96, "index_chain": 83, "chain_name": "P", "nt_resnum": 83, "nt_name": "C", "nt_code": "C", "nt_id": "///P/83", "linked_nts": [ "///P/82", "///P/84" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor", "alpha": -160.456, "beta": -124.450, "gamma": 114.283, "delta": 72.710, "epsilon": -140.698, "zeta": -90.485, "epsilon_zeta": -50.213, "bb_type": "BI", "chi": -179.979, "glyco_bond": "anti", "C5prime_xyz": [ -2.100, 8.734, 1.513 ], "P_xyz": [ 0.489, 8.857, 1.667 ], "form": "A", "ssZp": 4.507, "Dp": 4.553, "splay_angle": 19.505, "splay_distance": 3.071, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": 168.972, "theta": -150.242, "eta_prime": -172.601, "theta_prime": -145.776, "eta_base": -132.633, "theta_base": -130.815, "v0": -4.677, "v1": -24.429, "v2": 42.926, "v3": -46.239, "v4": 32.369, "amplitude": 46.993, "phase_angle": 24.013, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.071, "frame": { "rmsd": 0.012, "origin": [ 13.976, 64.695, 11.235 ], "x_axis": [ -0.394, -0.056, -0.917 ], "y_axis": [ 0.906, -0.191, -0.378 ], "z_axis": [ -0.155, -0.980, 0.126 ], "quaternion": [ -0.368, -0.410, -0.519, 0.654 ] } }, { "index": 97, "index_chain": 84, "chain_name": "P", "nt_resnum": 84, "nt_name": "G", "nt_code": "G", "nt_id": "///P/84", "linked_nts": [ "///P/83", "///P/85" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -44.981, "beta": 166.639, "gamma": 59.200, "delta": 131.625, "epsilon": -86.956, "zeta": 58.663, "epsilon_zeta": 214.381, "bb_type": "--", "chi": -129.679, "glyco_bond": "anti", "C5prime_xyz": [ -1.606, 8.675, -0.839 ], "P_xyz": [ 0.934, 9.103, -0.285 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -145.045, "theta": 108.148, "eta_prime": -132.195, "theta_prime": 113.421, "eta_base": -118.136, "theta_base": null, "v0": -15.067, "v1": 23.602, "v2": -22.961, "v3": 14.917, "v4": -0.039, "amplitude": 24.219, "phase_angle": 161.450, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.307, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 12.257, 62.350, 12.222 ], "x_axis": [ 0.150, -0.095, -0.984 ], "y_axis": [ 0.916, -0.362, 0.174 ], "z_axis": [ -0.373, -0.927, 0.033 ], "quaternion": [ 0.453, 0.608, 0.337, -0.558 ] } }, { "index": 98, "index_chain": 85, "chain_name": "P", "nt_resnum": 85, "nt_name": "C", "nt_code": "C", "nt_id": "///P/85", "linked_nts": [ "///P/84", "///P/86" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,non-stack,ss-non-loop", "alpha": 146.377, "beta": -101.637, "gamma": 174.247, "delta": 106.436, "epsilon": -93.896, "zeta": 101.859, "epsilon_zeta": 164.245, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -97.708, "theta": 69.322, "eta_prime": -113.482, "theta_prime": 67.028, "eta_base": null, "theta_base": null, "v0": -37.888, "v1": 29.713, "v2": -11.660, "v3": -9.768, "v4": 30.078, "amplitude": 36.807, "phase_angle": 108.469, "puckering": "C1'-exo", "sugar_class": "--", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null }, { "index": 99, "index_chain": 86, "chain_name": "P", "nt_resnum": 86, "nt_name": "A", "nt_code": "A", "nt_id": "///P/86", "linked_nts": [ "///P/85", "///P/87" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,A-minor", "alpha": 143.412, "beta": -177.292, "gamma": 118.878, "delta": 100.753, "epsilon": -164.496, "zeta": -61.512, "epsilon_zeta": -102.983, "bb_type": "BI", "chi": -121.617, "glyco_bond": "anti", "C5prime_xyz": [ -0.577, 7.738, -1.603 ], "P_xyz": [ 1.007, 6.490, -3.376 ], "form": ".", "ssZp": 2.861, "Dp": 4.492, "splay_angle": 19.357, "splay_distance": 3.252, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 130.858, "theta": -133.571, "eta_prime": 148.766, "theta_prime": -149.281, "eta_base": null, "theta_base": -138.073, "v0": 31.042, "v1": -41.740, "v2": 36.687, "v3": -18.793, "v4": -7.776, "amplitude": 41.817, "phase_angle": 331.320, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.045, "frame": { "rmsd": 0.014, "origin": [ 18.526, 65.457, 18.032 ], "x_axis": [ 0.182, 0.611, 0.770 ], "y_axis": [ 0.981, -0.170, -0.096 ], "z_axis": [ 0.072, 0.773, -0.630 ], "quaternion": [ -0.309, 0.704, 0.565, 0.299 ] } }, { "index": 100, "index_chain": 87, "chain_name": "P", "nt_resnum": 87, "nt_name": "A", "nt_code": "A", "nt_id": "///P/87", "linked_nts": [ "///P/86", "///P/88" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,ribose-zipper,cap-acceptor,splayed-apart", "alpha": -82.864, "beta": 171.847, "gamma": 73.406, "delta": 96.799, "epsilon": -144.639, "zeta": -169.146, "epsilon_zeta": 24.507, "bb_type": "--", "chi": -124.324, "glyco_bond": "anti", "C5prime_xyz": [ -1.388, 8.438, -1.443 ], "P_xyz": [ 1.083, 8.262, -2.405 ], "form": ".", "ssZp": 2.761, "Dp": 4.261, "splay_angle": 149.738, "splay_distance": 19.051, "splay_ratio": 0.965, "d22": null, "d64": null, "eta": 173.021, "theta": 164.046, "eta_prime": -165.280, "theta_prime": 173.564, "eta_base": -135.222, "theta_base": -133.939, "v0": 2.634, "v1": -16.409, "v2": 23.182, "v3": -21.967, "v4": 12.350, "amplitude": 23.708, "phase_angle": 12.083, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.019, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 19.676, 68.148, 16.614 ], "x_axis": [ 0.553, 0.406, 0.728 ], "y_axis": [ 0.827, -0.167, -0.536 ], "z_axis": [ -0.096, 0.899, -0.428 ], "quaternion": [ -0.490, 0.733, 0.421, 0.215 ] } }, { "index": 101, "index_chain": 88, "chain_name": "P", "nt_resnum": 88, "nt_name": "G", "nt_code": "G", "nt_id": "///P/88", "linked_nts": [ "///P/87", "///P/89" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,ribose-zipper,splayed-apart", "alpha": 47.829, "beta": 146.272, "gamma": 72.905, "delta": 77.717, "epsilon": -128.453, "zeta": -67.877, "epsilon_zeta": -60.576, "bb_type": "BI", "chi": -179.646, "glyco_bond": "anti", "C5prime_xyz": [ -1.970, 8.711, 1.551 ], "P_xyz": [ 0.553, 9.544, 1.444 ], "form": ".", "ssZp": 4.625, "Dp": 4.628, "splay_angle": 23.696, "splay_distance": 3.826, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": -63.160, "theta": -130.384, "eta_prime": -85.494, "theta_prime": -133.721, "eta_base": -134.112, "theta_base": -80.610, "v0": -3.963, "v1": -20.592, "v2": 35.693, "v3": -38.703, "v4": 27.146, "amplitude": 39.113, "phase_angle": 24.135, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3d", "suiteness": 0.087, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 30.256, 72.813, 1.473 ], "x_axis": [ 0.723, 0.202, 0.661 ], "y_axis": [ -0.568, -0.371, 0.735 ], "z_axis": [ 0.394, -0.906, -0.154 ], "quaternion": [ 0.547, 0.750, -0.122, 0.352 ] } }, { "index": 102, "index_chain": 89, "chain_name": "P", "nt_resnum": 89, "nt_name": "C", "nt_code": "C", "nt_id": "///P/89", "linked_nts": [ "///P/88", "///P/90" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -88.041, "beta": 156.232, "gamma": 74.354, "delta": 76.611, "epsilon": -147.151, "zeta": -75.935, "epsilon_zeta": -71.216, "bb_type": "BI", "chi": -165.961, "glyco_bond": "anti", "C5prime_xyz": [ -1.439, 8.835, 0.892 ], "P_xyz": [ 1.018, 9.430, 0.171 ], "form": "A", "ssZp": 4.606, "Dp": 4.713, "splay_angle": 22.063, "splay_distance": 3.573, "splay_ratio": 0.196, "d22": 5.017, "d64": 5.035, "eta": 149.084, "theta": -152.434, "eta_prime": 173.047, "theta_prime": -154.962, "eta_base": -109.203, "theta_base": -142.920, "v0": 4.597, "v1": -30.384, "v2": 43.086, "v3": -41.358, "v4": 23.351, "amplitude": 44.155, "phase_angle": 12.636, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.189, "filter_rmsd": 0.066, "frame": { "rmsd": 0.007, "origin": [ 33.225, 70.849, 2.874 ], "x_axis": [ 0.035, -0.188, 0.982 ], "y_axis": [ -0.834, -0.547, -0.074 ], "z_axis": [ 0.551, -0.816, -0.176 ], "quaternion": [ 0.279, 0.663, -0.385, 0.578 ] } }, { "index": 103, "index_chain": 90, "chain_name": "P", "nt_resnum": 90, "nt_name": "U", "nt_code": "U", "nt_id": "///P/90", "linked_nts": [ "///P/89", "///P/91" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -75.415, "beta": 172.960, "gamma": 65.644, "delta": 76.347, "epsilon": -126.225, "zeta": -113.727, "epsilon_zeta": -12.498, "bb_type": "--", "chi": -150.462, "glyco_bond": "anti", "C5prime_xyz": [ -1.393, 8.848, -0.051 ], "P_xyz": [ 1.060, 9.426, -0.717 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 174.156, "theta": -136.999, "eta_prime": -179.207, "theta_prime": -135.760, "eta_base": -157.415, "theta_base": null, "v0": 4.850, "v1": -30.846, "v2": 43.453, "v3": -41.728, "v4": 23.480, "amplitude": 44.499, "phase_angle": 12.445, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.664, "filter_rmsd": 0.108, "frame": { "rmsd": 0.010, "origin": [ 36.510, 69.453, 2.697 ], "x_axis": [ -0.299, -0.412, 0.861 ], "y_axis": [ -0.615, -0.607, -0.503 ], "z_axis": [ 0.730, -0.680, -0.072 ], "quaternion": [ 0.075, 0.587, -0.437, 0.677 ] } }, { "index": 104, "index_chain": 91, "chain_name": "P", "nt_resnum": 91, "nt_name": "U", "nt_code": "U", "nt_id": "///P/91", "linked_nts": [ "///P/90", "///P/92" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-stack,internal-loop", "alpha": 18.654, "beta": 111.724, "gamma": -17.642, "delta": 91.476, "epsilon": 45.121, "zeta": 130.057, "epsilon_zeta": -84.937, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 159.867, "theta": -146.655, "eta_prime": -177.688, "theta_prime": -154.376, "eta_base": null, "theta_base": null, "v0": 18.599, "v1": -32.274, "v2": 33.432, "v3": -23.607, "v4": 3.342, "amplitude": 34.323, "phase_angle": 346.911, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null }, { "index": 105, "index_chain": 92, "chain_name": "P", "nt_resnum": 92, "nt_name": "U", "nt_code": "U", "nt_id": "///P/92", "linked_nts": [ "///P/91", "///P/93" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,non-stack,canonical,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -167.550, "beta": 87.810, "gamma": 115.461, "delta": 84.242, "epsilon": -134.416, "zeta": -63.950, "epsilon_zeta": -70.466, "bb_type": "BI", "chi": -171.178, "glyco_bond": "anti", "C5prime_xyz": [ -1.358, 8.561, 1.245 ], "P_xyz": [ -0.263, 9.243, -1.084 ], "form": ".", "ssZp": 4.703, "Dp": 4.763, "splay_angle": 40.584, "splay_distance": 6.215, "splay_ratio": 0.347, "d22": 3.872, "d64": 4.198, "eta": 160.475, "theta": -139.605, "eta_prime": 173.603, "theta_prime": -147.239, "eta_base": null, "theta_base": -113.926, "v0": 11.022, "v1": -31.907, "v2": 39.343, "v3": -33.456, "v4": 14.462, "amplitude": 39.376, "phase_angle": 2.360, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.010, "origin": [ 39.362, 64.827, 7.081 ], "x_axis": [ -0.913, -0.396, 0.102 ], "y_axis": [ 0.110, -0.479, -0.871 ], "z_axis": [ 0.394, -0.783, 0.481 ], "quaternion": [ -0.149, 0.146, -0.488, 0.848 ] } }, { "index": 106, "index_chain": 93, "chain_name": "P", "nt_resnum": 93, "nt_name": "U", "nt_code": "U", "nt_id": "///P/93", "linked_nts": [ "///P/92", "///P/94" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.445, "beta": -176.764, "gamma": 50.258, "delta": 79.871, "epsilon": -125.014, "zeta": -93.800, "epsilon_zeta": -31.214, "bb_type": "--", "chi": 171.245, "glyco_bond": "anti", "C5prime_xyz": [ -1.741, 8.214, 2.140 ], "P_xyz": [ 0.575, 8.331, 3.420 ], "form": ".", "ssZp": 4.753, "Dp": 4.780, "splay_angle": 16.027, "splay_distance": 2.642, "splay_ratio": 0.149, "d22": null, "d64": null, "eta": 165.364, "theta": -156.264, "eta_prime": -176.778, "theta_prime": -154.222, "eta_base": -122.274, "theta_base": -175.788, "v0": 9.455, "v1": -33.108, "v2": 43.070, "v3": -38.288, "v4": 18.288, "amplitude": 43.310, "phase_angle": 6.035, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.818, "filter_rmsd": 0.107, "frame": { "rmsd": 0.010, "origin": [ 38.594, 59.170, 9.537 ], "x_axis": [ -0.666, -0.118, -0.736 ], "y_axis": [ 0.655, 0.380, -0.653 ], "z_axis": [ 0.357, -0.917, -0.176 ], "quaternion": [ 0.367, 0.180, 0.745, -0.527 ] } }, { "index": 107, "index_chain": 94, "chain_name": "P", "nt_resnum": 94, "nt_name": "A", "nt_code": "A", "nt_id": "///P/94", "linked_nts": [ "///P/93", "///P/95" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -84.746, "beta": 138.421, "gamma": 88.356, "delta": 83.293, "epsilon": -158.510, "zeta": -58.115, "epsilon_zeta": -100.394, "bb_type": "BI", "chi": -158.259, "glyco_bond": "anti", "C5prime_xyz": [ -1.559, 8.798, 0.405 ], "P_xyz": [ 0.578, 9.252, -1.095 ], "form": "A", "ssZp": 4.310, "Dp": 4.473, "splay_angle": 21.660, "splay_distance": 3.527, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 159.900, "theta": -137.262, "eta_prime": 174.803, "theta_prime": -147.394, "eta_base": 163.755, "theta_base": -107.071, "v0": -0.271, "v1": -22.092, "v2": 34.685, "v3": -35.704, "v4": 22.781, "amplitude": 36.674, "phase_angle": 18.956, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.033, "frame": { "rmsd": 0.006, "origin": [ 38.389, 58.370, 12.046 ], "x_axis": [ -0.419, -0.268, -0.868 ], "y_axis": [ 0.906, -0.194, -0.377 ], "z_axis": [ -0.067, -0.944, 0.324 ], "quaternion": [ -0.422, -0.336, -0.475, 0.696 ] } }, { "index": 108, "index_chain": 95, "chain_name": "P", "nt_resnum": 95, "nt_name": "C", "nt_code": "C", "nt_id": "///P/95", "linked_nts": [ "///P/94", "///P/96" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -85.413, "beta": 176.412, "gamma": 60.395, "delta": 74.483, "epsilon": -140.938, "zeta": -81.719, "epsilon_zeta": -59.219, "bb_type": "BI", "chi": -154.714, "glyco_bond": "anti", "C5prime_xyz": [ -1.435, 8.917, 0.240 ], "P_xyz": [ 1.122, 9.482, -0.091 ], "form": "A", "ssZp": 4.260, "Dp": 4.758, "splay_angle": 26.492, "splay_distance": 4.056, "splay_ratio": 0.230, "d22": 3.608, "d64": 3.374, "eta": 158.116, "theta": -148.985, "eta_prime": 175.693, "theta_prime": -144.830, "eta_base": -121.390, "theta_base": -101.182, "v0": 6.974, "v1": -33.281, "v2": 45.693, "v3": -42.579, "v4": 22.581, "amplitude": 46.404, "phase_angle": 10.043, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.539, "filter_rmsd": 0.069, "frame": { "rmsd": 0.009, "origin": [ 36.864, 55.322, 11.139 ], "x_axis": [ 0.298, -0.308, -0.903 ], "y_axis": [ 0.925, -0.139, 0.353 ], "z_axis": [ -0.234, -0.941, 0.243 ], "quaternion": [ 0.592, 0.546, 0.283, -0.521 ] } }, { "index": 109, "index_chain": 96, "chain_name": "P", "nt_resnum": 96, "nt_name": "U", "nt_code": "U", "nt_id": "///P/96", "linked_nts": [ "///P/95", "///P/97" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop,splayed-apart", "alpha": -43.691, "beta": 161.216, "gamma": 41.502, "delta": 82.419, "epsilon": -147.317, "zeta": 76.822, "epsilon_zeta": 135.861, "bb_type": "--", "chi": -161.813, "glyco_bond": "anti", "C5prime_xyz": [ -0.992, 8.562, 0.700 ], "P_xyz": [ 1.668, 8.516, 0.738 ], "form": ".", "ssZp": 4.526, "Dp": 4.712, "splay_angle": 168.888, "splay_distance": 18.482, "splay_ratio": 0.995, "d22": 11.135, "d64": 14.443, "eta": 168.093, "theta": 35.285, "eta_prime": -177.023, "theta_prime": 28.306, "eta_base": -118.728, "theta_base": -99.074, "v0": 16.000, "v1": -37.235, "v2": 43.288, "v3": -34.997, "v4": 12.101, "amplitude": 43.334, "phase_angle": 357.362, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.453, "filter_rmsd": 0.111, "frame": { "rmsd": 0.010, "origin": [ 37.125, 51.544, 9.686 ], "x_axis": [ 0.894, -0.062, -0.444 ], "y_axis": [ 0.446, 0.016, 0.895 ], "z_axis": [ -0.049, -0.998, 0.042 ], "quaternion": [ 0.698, 0.678, 0.142, -0.182 ] } }, { "index": 110, "index_chain": 97, "chain_name": "P", "nt_resnum": 97, "nt_name": "U", "nt_code": "U", "nt_id": "///P/97", "linked_nts": [ "///P/96", "///P/98" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,internal-loop,splayed-apart", "alpha": 67.236, "beta": 135.476, "gamma": -40.265, "delta": 156.328, "epsilon": -104.397, "zeta": -58.225, "epsilon_zeta": -46.172, "bb_type": "--", "chi": -161.969, "glyco_bond": "anti", "C5prime_xyz": [ -2.176, 8.449, 1.254 ], "P_xyz": [ -2.318, 8.946, 3.843 ], "form": ".", "ssZp": 0.331, "Dp": 1.012, "splay_angle": 106.037, "splay_distance": 16.398, "splay_ratio": 0.799, "d22": null, "d64": null, "eta": -127.729, "theta": -55.016, "eta_prime": -98.424, "theta_prime": -68.426, "eta_base": 29.677, "theta_base": -83.698, "v0": -18.573, "v1": 40.065, "v2": -44.831, "v3": 35.498, "v4": -10.867, "amplitude": 45.008, "phase_angle": 174.917, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "5r", "suiteness": 0.102, "filter_rmsd": 0.104, "frame": { "rmsd": 0.008, "origin": [ 39.646, 40.875, 24.566 ], "x_axis": [ -0.349, 0.485, 0.801 ], "y_axis": [ 0.120, 0.872, -0.476 ], "z_axis": [ -0.929, -0.070, -0.363 ], "quaternion": [ 0.538, -0.188, -0.804, 0.170 ] } }, { "index": 111, "index_chain": 98, "chain_name": "P", "nt_resnum": 98, "nt_name": "A", "nt_code": "A", "nt_id": "///P/98", "linked_nts": [ "///P/97", "///P/99" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,ribose-zipper,splayed-apart", "alpha": -84.628, "beta": 139.763, "gamma": -177.501, "delta": 91.597, "epsilon": -129.294, "zeta": -83.296, "epsilon_zeta": -45.997, "bb_type": "BI", "chi": -151.010, "glyco_bond": "anti", "C5prime_xyz": [ -1.065, 8.530, 0.069 ], "P_xyz": [ -0.665, 10.675, -1.385 ], "form": ".", "ssZp": 3.912, "Dp": 4.608, "splay_angle": 17.884, "splay_distance": 2.907, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": -99.615, "theta": 173.847, "eta_prime": -65.820, "theta_prime": -173.026, "eta_base": -30.781, "theta_base": -134.115, "v0": 12.432, "v1": -31.146, "v2": 37.007, "v3": -30.474, "v4": 11.565, "amplitude": 37.010, "phase_angle": 359.226, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "2h", "suiteness": 0.270, "filter_rmsd": 0.035, "frame": { "rmsd": 0.010, "origin": [ 36.154, 38.719, 8.689 ], "x_axis": [ 0.730, -0.105, -0.675 ], "y_axis": [ 0.662, 0.352, 0.662 ], "z_axis": [ 0.168, -0.930, 0.326 ], "quaternion": [ 0.776, 0.513, 0.272, -0.247 ] } }, { "index": 112, "index_chain": 99, "chain_name": "P", "nt_resnum": 99, "nt_name": "A", "nt_code": "A", "nt_id": "///P/99", "linked_nts": [ "///P/98", "///P/100" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,A-minor,ribose-zipper", "alpha": -71.691, "beta": 161.614, "gamma": 52.446, "delta": 81.735, "epsilon": -157.097, "zeta": -70.054, "epsilon_zeta": -87.044, "bb_type": "BI", "chi": -144.965, "glyco_bond": "anti", "C5prime_xyz": [ -1.327, 8.673, -0.448 ], "P_xyz": [ 1.154, 8.782, -1.207 ], "form": "A", "ssZp": 3.924, "Dp": 4.600, "splay_angle": 19.933, "splay_distance": 3.212, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 150.026, "theta": -144.978, "eta_prime": 169.866, "theta_prime": -150.291, "eta_base": -142.890, "theta_base": -135.330, "v0": 3.572, "v1": -28.574, "v2": 41.496, "v3": -40.011, "v4": 23.181, "amplitude": 42.704, "phase_angle": 13.664, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.569, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 37.408, 36.113, 8.991 ], "x_axis": [ 0.930, 0.261, -0.261 ], "y_axis": [ 0.249, 0.076, 0.965 ], "z_axis": [ 0.272, -0.962, 0.005 ], "quaternion": [ 0.709, 0.680, 0.188, 0.004 ] } }, { "index": 113, "index_chain": 100, "chain_name": "P", "nt_resnum": 100, "nt_name": "A", "nt_code": "A", "nt_id": "///P/100", "linked_nts": [ "///P/99", "///P/101" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -75.953, "beta": 163.822, "gamma": 70.840, "delta": 81.120, "epsilon": -148.080, "zeta": -58.890, "epsilon_zeta": -89.190, "bb_type": "BI", "chi": -157.849, "glyco_bond": "anti", "C5prime_xyz": [ -1.507, 8.813, 0.319 ], "P_xyz": [ 0.931, 9.348, -0.579 ], "form": ".", "ssZp": 4.451, "Dp": 4.735, "splay_angle": 34.582, "splay_distance": 5.456, "splay_ratio": 0.299, "d22": null, "d64": null, "eta": 164.907, "theta": -131.598, "eta_prime": 179.674, "theta_prime": -132.800, "eta_base": -146.449, "theta_base": -101.282, "v0": 5.765, "v1": -30.673, "v2": 42.449, "v3": -39.138, "v4": 21.451, "amplitude": 43.168, "phase_angle": 10.474, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.474, "filter_rmsd": 0.042, "frame": { "rmsd": 0.010, "origin": [ 38.748, 33.475, 7.741 ], "x_axis": [ 0.906, 0.397, 0.145 ], "y_axis": [ -0.067, -0.204, 0.977 ], "z_axis": [ 0.417, -0.895, -0.159 ], "quaternion": [ 0.621, 0.753, 0.109, 0.187 ] } }, { "index": 114, "index_chain": 101, "chain_name": "P", "nt_resnum": 101, "nt_name": "U", "nt_code": "U", "nt_id": "///P/101", "linked_nts": [ "///P/100", "///P/102" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -67.109, "beta": 167.494, "gamma": 62.294, "delta": 79.483, "epsilon": -136.112, "zeta": -38.128, "epsilon_zeta": -97.984, "bb_type": "BI", "chi": -175.036, "glyco_bond": "anti", "C5prime_xyz": [ -1.686, 8.540, 1.427 ], "P_xyz": [ 0.831, 9.257, 1.535 ], "form": ".", "ssZp": 4.781, "Dp": 4.799, "splay_angle": 49.527, "splay_distance": 7.372, "splay_ratio": 0.420, "d22": 3.165, "d64": 3.964, "eta": 172.558, "theta": -103.398, "eta_prime": -165.809, "theta_prime": -100.360, "eta_base": -110.462, "theta_base": -47.423, "v0": 6.357, "v1": -30.969, "v2": 42.202, "v3": -39.364, "v4": 21.156, "amplitude": 42.869, "phase_angle": 10.125, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.790, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 43.744, 31.283, 7.655 ], "x_axis": [ 0.517, 0.272, 0.812 ], "y_axis": [ -0.742, -0.330, 0.583 ], "z_axis": [ 0.427, -0.904, 0.031 ], "quaternion": [ 0.552, 0.674, -0.174, 0.459 ] } }, { "index": 115, "index_chain": 102, "chain_name": "P", "nt_resnum": 102, "nt_name": "C", "nt_code": "C", "nt_id": "///P/102", "linked_nts": [ "///P/101", "///P/103" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -83.686, "beta": -172.770, "gamma": 49.666, "delta": 82.591, "epsilon": -126.571, "zeta": -77.016, "epsilon_zeta": -49.555, "bb_type": "--", "chi": -165.686, "glyco_bond": "anti", "C5prime_xyz": [ -1.052, 8.635, 0.894 ], "P_xyz": [ 1.515, 8.803, 1.452 ], "form": "A", "ssZp": 4.566, "Dp": 4.811, "splay_angle": 24.956, "splay_distance": 3.946, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 156.517, "theta": -134.191, "eta_prime": -172.136, "theta_prime": -131.099, "eta_base": -90.590, "theta_base": -101.342, "v0": 13.826, "v1": -37.342, "v2": 45.243, "v3": -37.906, "v4": 15.418, "amplitude": 45.248, "phase_angle": 0.888, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.262, "filter_rmsd": 0.071, "frame": { "rmsd": 0.010, "origin": [ 44.758, 28.939, 14.571 ], "x_axis": [ -0.790, -0.133, 0.598 ], "y_axis": [ -0.516, -0.383, -0.767 ], "z_axis": [ 0.331, -0.914, 0.234 ], "quaternion": [ 0.123, 0.299, -0.542, 0.776 ] } }, { "index": 116, "index_chain": 103, "chain_name": "P", "nt_resnum": 103, "nt_name": "A", "nt_code": "A", "nt_id": "///P/103", "linked_nts": [ "///P/102", "///P/104" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -78.615, "beta": 152.180, "gamma": 71.646, "delta": 77.445, "epsilon": -130.897, "zeta": -76.473, "epsilon_zeta": -54.424, "bb_type": "BI", "chi": -175.506, "glyco_bond": "anti", "C5prime_xyz": [ -1.689, 8.523, 1.443 ], "P_xyz": [ 0.812, 9.204, 0.915 ], "form": "A", "ssZp": 4.782, "Dp": 4.827, "splay_angle": 23.237, "splay_distance": 3.688, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 159.673, "theta": -136.063, "eta_prime": 177.784, "theta_prime": -134.913, "eta_base": -135.569, "theta_base": -92.984, "v0": 6.083, "v1": -31.619, "v2": 43.879, "v3": -41.288, "v4": 22.364, "amplitude": 44.681, "phase_angle": 10.877, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.319, "filter_rmsd": 0.035, "frame": { "rmsd": 0.009, "origin": [ 44.854, 25.975, 17.175 ], "x_axis": [ -0.995, -0.096, -0.002 ], "y_axis": [ 0.031, -0.296, -0.955 ], "z_axis": [ 0.091, -0.950, 0.297 ], "quaternion": [ -0.040, 0.028, -0.592, 0.804 ] } }, { "index": 117, "index_chain": 104, "chain_name": "P", "nt_resnum": 104, "nt_name": "U", "nt_code": "U", "nt_id": "///P/104", "linked_nts": [ "///P/103", "///P/105" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -72.714, "beta": 161.619, "gamma": 68.973, "delta": 78.393, "epsilon": -162.066, "zeta": -69.271, "epsilon_zeta": -92.795, "bb_type": "BI", "chi": -162.074, "glyco_bond": "anti", "C5prime_xyz": [ -1.855, 8.821, 0.617 ], "P_xyz": [ 0.683, 9.319, 0.251 ], "form": ".", "ssZp": 4.369, "Dp": 4.485, "splay_angle": 21.773, "splay_distance": 3.588, "splay_ratio": 0.191, "d22": 4.781, "d64": 4.726, "eta": 166.397, "theta": -151.099, "eta_prime": -172.173, "theta_prime": -146.169, "eta_base": -110.542, "theta_base": -156.558, "v0": -2.330, "v1": -23.768, "v2": 39.126, "v3": -41.489, "v4": 27.950, "amplitude": 42.120, "phase_angle": 21.734, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.507, "filter_rmsd": 0.105, "frame": { "rmsd": 0.007, "origin": [ 42.339, 23.627, 18.502 ], "x_axis": [ -0.703, -0.205, -0.680 ], "y_axis": [ 0.699, -0.371, -0.611 ], "z_axis": [ -0.127, -0.906, 0.405 ], "quaternion": [ -0.287, -0.257, -0.482, 0.787 ] } }, { "index": 118, "index_chain": 105, "chain_name": "P", "nt_resnum": 105, "nt_name": "U", "nt_code": "U", "nt_id": "///P/105", "linked_nts": [ "///P/104", "///P/106" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -76.841, "beta": -157.922, "gamma": 59.411, "delta": 136.750, "epsilon": -170.342, "zeta": -86.044, "epsilon_zeta": -84.298, "bb_type": "BI", "chi": -106.225, "glyco_bond": "anti", "C5prime_xyz": [ -2.513, 8.291, -1.823 ], "P_xyz": [ -0.287, 9.584, -1.236 ], "form": ".", "ssZp": 2.149, "Dp": 2.104, "splay_angle": 23.212, "splay_distance": 4.091, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 174.949, "theta": -130.699, "eta_prime": -162.881, "theta_prime": -164.733, "eta_base": -167.094, "theta_base": -137.734, "v0": -27.262, "v1": 38.552, "v2": -34.410, "v3": 19.984, "v4": 4.375, "amplitude": 38.081, "phase_angle": 154.636, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.468, "filter_rmsd": 0.110, "frame": { "rmsd": 0.012, "origin": [ 41.214, 22.009, 21.501 ], "x_axis": [ -0.387, 0.044, -0.921 ], "y_axis": [ 0.758, -0.554, -0.344 ], "z_axis": [ -0.525, -0.831, 0.181 ], "quaternion": [ -0.245, -0.497, -0.404, 0.728 ] } }, { "index": 119, "index_chain": 106, "chain_name": "P", "nt_resnum": 106, "nt_name": "A", "nt_code": "A", "nt_id": "///P/106", "linked_nts": [ "///P/105", "///P/107" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -144.097, "beta": 125.200, "gamma": 130.650, "delta": 73.275, "epsilon": -140.616, "zeta": -74.588, "epsilon_zeta": -66.028, "bb_type": "BI", "chi": -171.419, "glyco_bond": "anti", "C5prime_xyz": [ -1.612, 8.648, 1.297 ], "P_xyz": [ -0.482, 10.360, -0.355 ], "form": "A", "ssZp": 4.561, "Dp": 4.641, "splay_angle": 23.684, "splay_distance": 3.608, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 147.546, "theta": -175.456, "eta_prime": 147.279, "theta_prime": -169.908, "eta_base": -169.194, "theta_base": -129.079, "v0": 2.045, "v1": -27.900, "v2": 42.039, "v3": -42.014, "v4": 25.001, "amplitude": 43.730, "phase_angle": 15.988, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.009, "origin": [ 38.388, 19.598, 23.213 ], "x_axis": [ -0.024, -0.199, -0.980 ], "y_axis": [ 0.910, -0.411, 0.061 ], "z_axis": [ -0.415, -0.890, 0.191 ], "quaternion": [ -0.435, -0.547, -0.325, 0.637 ] } }, { "index": 120, "index_chain": 107, "chain_name": "P", "nt_resnum": 107, "nt_name": "A", "nt_code": "A", "nt_id": "///P/107", "linked_nts": [ "///P/106", "///P/108" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.841, "beta": 177.419, "gamma": 50.110, "delta": 80.297, "epsilon": -145.028, "zeta": -74.523, "epsilon_zeta": -70.505, "bb_type": "BI", "chi": -156.798, "glyco_bond": "anti", "C5prime_xyz": [ -1.098, 8.542, 0.388 ], "P_xyz": [ 1.494, 8.740, 0.456 ], "form": "A", "ssZp": 4.337, "Dp": 4.724, "splay_angle": 24.302, "splay_distance": 3.928, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 169.437, "theta": -144.043, "eta_prime": -178.304, "theta_prime": -143.520, "eta_base": -127.942, "theta_base": -128.471, "v0": 14.361, "v1": -38.249, "v2": 46.161, "v3": -39.305, "v4": 15.899, "amplitude": 46.169, "phase_angle": 1.046, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.787, "filter_rmsd": 0.031, "frame": { "rmsd": 0.013, "origin": [ 36.276, 16.797, 22.368 ], "x_axis": [ 0.574, -0.408, -0.710 ], "y_axis": [ 0.663, -0.278, 0.696 ], "z_axis": [ -0.481, -0.870, 0.111 ], "quaternion": [ 0.593, 0.660, 0.097, -0.451 ] } }, { "index": 121, "index_chain": 108, "chain_name": "P", "nt_resnum": 108, "nt_name": "G", "nt_code": "G", "nt_id": "///P/108", "linked_nts": [ "///P/107", "///P/109" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -54.446, "beta": 160.702, "gamma": 52.232, "delta": 75.929, "epsilon": -144.548, "zeta": -64.325, "epsilon_zeta": -80.223, "bb_type": "BI", "chi": -164.199, "glyco_bond": "anti", "C5prime_xyz": [ -1.495, 8.801, 0.809 ], "P_xyz": [ 1.047, 9.455, 0.765 ], "form": "A", "ssZp": 4.543, "Dp": 4.714, "splay_angle": 23.045, "splay_distance": 3.768, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 169.929, "theta": -139.569, "eta_prime": -177.718, "theta_prime": -138.993, "eta_base": -148.071, "theta_base": -104.387, "v0": 2.303, "v1": -28.668, "v2": 42.064, "v3": -42.345, "v4": 25.186, "amplitude": 43.709, "phase_angle": 15.770, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.814, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 33.911, 14.013, 20.924 ], "x_axis": [ 0.881, -0.315, -0.352 ], "y_axis": [ 0.334, -0.112, 0.936 ], "z_axis": [ -0.334, -0.942, 0.006 ], "quaternion": [ 0.666, 0.705, 0.007, -0.243 ] } }, { "index": 122, "index_chain": 109, "chain_name": "P", "nt_resnum": 109, "nt_name": "G", "nt_code": "G", "nt_id": "///P/109", "linked_nts": [ "///P/108", "///P/110" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor", "alpha": -75.502, "beta": -179.587, "gamma": 51.968, "delta": 73.851, "epsilon": -135.508, "zeta": -43.268, "epsilon_zeta": -92.240, "bb_type": "BI", "chi": -158.453, "glyco_bond": "anti", "C5prime_xyz": [ -1.439, 8.844, 0.353 ], "P_xyz": [ 1.067, 9.560, 0.233 ], "form": ".", "ssZp": 4.442, "Dp": 4.934, "splay_angle": 78.367, "splay_distance": 11.451, "splay_ratio": 0.632, "d22": null, "d64": null, "eta": 162.048, "theta": -111.804, "eta_prime": 174.689, "theta_prime": -156.024, "eta_base": -136.377, "theta_base": 152.927, "v0": 3.301, "v1": -29.740, "v2": 42.751, "v3": -42.046, "v4": 25.019, "amplitude": 44.157, "phase_angle": 14.499, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.751, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 34.579, 10.785, 19.100 ], "x_axis": [ 0.938, -0.159, 0.309 ], "y_axis": [ -0.322, -0.066, 0.944 ], "z_axis": [ -0.130, -0.985, -0.113 ], "quaternion": [ 0.663, 0.727, -0.166, 0.061 ] } }, { "index": 123, "index_chain": 110, "chain_name": "P", "nt_resnum": 110, "nt_name": "U", "nt_code": "U", "nt_id": "///P/110", "linked_nts": [ "///P/109", "///P/111" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -179.362, "beta": 121.115, "gamma": 53.355, "delta": 78.697, "epsilon": -132.365, "zeta": -65.514, "epsilon_zeta": -66.851, "bb_type": "BI", "chi": -175.155, "glyco_bond": "anti", "C5prime_xyz": [ -2.030, 8.823, 1.153 ], "P_xyz": [ 0.587, 9.050, 1.166 ], "form": ".", "ssZp": 4.371, "Dp": 4.416, "splay_angle": 28.580, "splay_distance": 4.541, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": 16.993, "theta": -120.020, "eta_prime": 47.685, "theta_prime": -121.500, "eta_base": 26.508, "theta_base": -61.320, "v0": -11.214, "v1": -14.267, "v2": 32.640, "v3": -39.882, "v4": 32.328, "amplitude": 39.627, "phase_angle": 34.545, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.227, "filter_rmsd": 0.108, "frame": { "rmsd": 0.008, "origin": [ 24.739, 5.065, 17.840 ], "x_axis": [ -0.702, 0.511, 0.496 ], "y_axis": [ 0.566, -0.021, 0.824 ], "z_axis": [ 0.431, 0.859, -0.275 ], "quaternion": [ -0.023, 0.385, 0.699, 0.602 ] } }, { "index": 124, "index_chain": 111, "chain_name": "P", "nt_resnum": 111, "nt_name": "G", "nt_code": "G", "nt_id": "///P/111", "linked_nts": [ "///P/110", "///P/112" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,ribose-zipper,cap-donor,phosphate", "alpha": -65.543, "beta": 158.916, "gamma": 63.336, "delta": 78.162, "epsilon": -163.254, "zeta": -65.173, "epsilon_zeta": -98.081, "bb_type": "BI", "chi": -138.610, "glyco_bond": "anti", "C5prime_xyz": [ -1.129, 8.809, -0.716 ], "P_xyz": [ 1.365, 8.950, -1.368 ], "form": ".", "ssZp": 3.456, "Dp": 4.366, "splay_angle": 17.090, "splay_distance": 2.916, "splay_ratio": 0.155, "d22": null, "d64": null, "eta": 164.421, "theta": -150.453, "eta_prime": -168.123, "theta_prime": -153.094, "eta_base": -87.086, "theta_base": -138.823, "v0": 3.159, "v1": -26.629, "v2": 38.578, "v3": -37.155, "v4": 22.005, "amplitude": 39.741, "phase_angle": 13.895, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.694, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 24.603, 9.007, 20.089 ], "x_axis": [ 0.202, 0.346, 0.916 ], "y_axis": [ 0.973, -0.176, -0.148 ], "z_axis": [ 0.110, 0.922, -0.372 ], "quaternion": [ -0.404, 0.661, 0.498, 0.388 ] } }, { "index": 125, "index_chain": 112, "chain_name": "P", "nt_resnum": 112, "nt_name": "A", "nt_code": "A", "nt_id": "///P/112", "linked_nts": [ "///P/111", "///P/113" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,phosphate", "alpha": -91.972, "beta": -174.573, "gamma": 64.904, "delta": 85.666, "epsilon": -134.962, "zeta": -71.740, "epsilon_zeta": -63.223, "bb_type": "BI", "chi": -128.930, "glyco_bond": "anti", "C5prime_xyz": [ -1.460, 8.522, -1.345 ], "P_xyz": [ 1.060, 8.692, -2.080 ], "form": ".", "ssZp": 2.792, "Dp": 4.591, "splay_angle": 60.949, "splay_distance": 9.779, "splay_ratio": 0.508, "d22": null, "d64": null, "eta": 167.531, "theta": -88.083, "eta_prime": 178.512, "theta_prime": -81.732, "eta_base": -157.945, "theta_base": -56.257, "v0": -1.030, "v1": -21.774, "v2": 34.544, "v3": -36.022, "v4": 23.605, "amplitude": 36.781, "phase_angle": 20.089, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.340, "filter_rmsd": 0.041, "frame": { "rmsd": 0.006, "origin": [ 25.085, 11.609, 18.865 ], "x_axis": [ 0.555, 0.167, 0.815 ], "y_axis": [ 0.826, 0.001, -0.563 ], "z_axis": [ -0.095, 0.986, -0.137 ], "quaternion": [ 0.596, -0.650, -0.382, -0.277 ] } }, { "index": 126, "index_chain": 113, "chain_name": "P", "nt_resnum": 113, "nt_name": "C", "nt_code": "C", "nt_id": "///P/113", "linked_nts": [ "///P/112", "///P/114" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": 139.956, "beta": -124.400, "gamma": 179.483, "delta": 83.920, "epsilon": -152.566, "zeta": -63.363, "epsilon_zeta": -89.203, "bb_type": "BI", "chi": -177.471, "glyco_bond": "anti", "C5prime_xyz": [ -0.899, 8.224, 1.613 ], "P_xyz": [ 0.664, 9.352, -0.174 ], "form": "A", "ssZp": 4.798, "Dp": 4.763, "splay_angle": 25.578, "splay_distance": 3.909, "splay_ratio": 0.224, "d22": 4.702, "d64": 4.969, "eta": 167.524, "theta": -157.495, "eta_prime": -144.215, "theta_prime": -162.315, "eta_base": -86.351, "theta_base": -145.888, "v0": 18.029, "v1": -36.294, "v2": 40.218, "v3": -30.698, "v4": 8.287, "amplitude": 40.526, "phase_angle": 352.936, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.212, "filter_rmsd": 0.075, "frame": { "rmsd": 0.014, "origin": [ 34.395, 13.916, 20.770 ], "x_axis": [ 0.891, -0.274, -0.361 ], "y_axis": [ -0.360, 0.055, -0.931 ], "z_axis": [ 0.275, 0.960, -0.049 ], "quaternion": [ 0.689, -0.687, 0.231, 0.031 ] } }, { "index": 127, "index_chain": 114, "chain_name": "P", "nt_resnum": 114, "nt_name": "U", "nt_code": "U", "nt_id": "///P/114", "linked_nts": [ "///P/113", "///P/115" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.004, "beta": -178.221, "gamma": 50.533, "delta": 81.169, "epsilon": -152.485, "zeta": -68.586, "epsilon_zeta": -83.899, "bb_type": "BI", "chi": -165.073, "glyco_bond": "anti", "C5prime_xyz": [ -1.187, 8.564, 0.888 ], "P_xyz": [ 1.337, 8.834, 1.352 ], "form": "A", "ssZp": 4.546, "Dp": 4.675, "splay_angle": 23.041, "splay_distance": 3.563, "splay_ratio": 0.201, "d22": 4.313, "d64": 4.252, "eta": 175.265, "theta": -147.838, "eta_prime": -171.350, "theta_prime": -145.119, "eta_base": -139.501, "theta_base": -120.685, "v0": 12.040, "v1": -34.781, "v2": 43.235, "v3": -37.181, "v4": 16.090, "amplitude": 43.285, "phase_angle": 2.775, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.920, "filter_rmsd": 0.113, "frame": { "rmsd": 0.013, "origin": [ 36.245, 16.895, 22.498 ], "x_axis": [ 0.604, -0.163, -0.780 ], "y_axis": [ -0.755, 0.196, -0.626 ], "z_axis": [ 0.255, 0.967, -0.004 ], "quaternion": [ 0.670, -0.594, 0.386, 0.221 ] } }, { "index": 128, "index_chain": 115, "chain_name": "P", "nt_resnum": 115, "nt_name": "U", "nt_code": "U", "nt_id": "///P/115", "linked_nts": [ "///P/114", "///P/116" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -72.637, "beta": 175.960, "gamma": 54.830, "delta": 82.439, "epsilon": -150.351, "zeta": -70.434, "epsilon_zeta": -79.917, "bb_type": "BI", "chi": -164.108, "glyco_bond": "anti", "C5prime_xyz": [ -1.298, 8.614, 0.807 ], "P_xyz": [ 1.295, 8.901, 0.976 ], "form": "A", "ssZp": 4.510, "Dp": 4.632, "splay_angle": 21.934, "splay_distance": 3.495, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 165.577, "theta": -141.415, "eta_prime": 179.156, "theta_prime": -141.063, "eta_base": -141.710, "theta_base": -116.549, "v0": 8.819, "v1": -32.464, "v2": 42.439, "v3": -38.850, "v4": 18.850, "amplitude": 42.773, "phase_angle": 7.164, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.936, "filter_rmsd": 0.111, "frame": { "rmsd": 0.011, "origin": [ 38.487, 19.641, 22.848 ], "x_axis": [ 0.084, -0.136, -0.987 ], "y_axis": [ -0.944, 0.305, -0.123 ], "z_axis": [ 0.317, 0.943, -0.102 ], "quaternion": [ 0.567, -0.470, 0.575, 0.357 ] } }, { "index": 129, "index_chain": 116, "chain_name": "P", "nt_resnum": 116, "nt_name": "A", "nt_code": "A", "nt_id": "///P/116", "linked_nts": [ "///P/115", "///P/117" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -74.001, "beta": 170.628, "gamma": 62.108, "delta": 77.804, "epsilon": -155.400, "zeta": -78.100, "epsilon_zeta": -77.300, "bb_type": "BI", "chi": -169.501, "glyco_bond": "anti", "C5prime_xyz": [ -1.717, 8.696, 1.003 ], "P_xyz": [ 0.843, 9.274, 0.839 ], "form": "A", "ssZp": 4.664, "Dp": 4.686, "splay_angle": 24.663, "splay_distance": 3.883, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 162.526, "theta": -156.677, "eta_prime": 179.219, "theta_prime": -159.012, "eta_base": -136.425, "theta_base": -144.489, "v0": 1.253, "v1": -28.821, "v2": 43.776, "v3": -43.945, "v4": 26.977, "amplitude": 45.744, "phase_angle": 16.866, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.818, "filter_rmsd": 0.036, "frame": { "rmsd": 0.007, "origin": [ 40.981, 21.701, 21.524 ], "x_axis": [ -0.433, -0.006, -0.901 ], "y_axis": [ -0.821, 0.416, 0.391 ], "z_axis": [ 0.373, 0.909, -0.185 ], "quaternion": [ 0.447, -0.290, 0.713, 0.456 ] } }, { "index": 130, "index_chain": 117, "chain_name": "P", "nt_resnum": 117, "nt_name": "G", "nt_code": "G", "nt_id": "///P/117", "linked_nts": [ "///P/116", "///P/118" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.211, "beta": 167.391, "gamma": 58.873, "delta": 74.351, "epsilon": -153.193, "zeta": -62.275, "epsilon_zeta": -90.918, "bb_type": "BI", "chi": -168.444, "glyco_bond": "anti", "C5prime_xyz": [ -1.498, 8.616, 1.067 ], "P_xyz": [ 0.990, 9.195, 1.011 ], "form": "A", "ssZp": 4.615, "Dp": 4.698, "splay_angle": 27.712, "splay_distance": 4.266, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": 174.612, "theta": -145.522, "eta_prime": -177.650, "theta_prime": -142.706, "eta_base": -149.830, "theta_base": -109.853, "v0": 6.232, "v1": -33.911, "v2": 46.839, "v3": -44.912, "v4": 24.550, "amplitude": 47.798, "phase_angle": 11.496, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.806, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 44.051, 23.530, 20.007 ], "x_axis": [ -0.714, 0.187, -0.675 ], "y_axis": [ -0.555, 0.436, 0.708 ], "z_axis": [ 0.427, 0.880, -0.208 ], "quaternion": [ 0.359, -0.120, 0.768, 0.517 ] } }, { "index": 131, "index_chain": 118, "chain_name": "P", "nt_resnum": 118, "nt_name": "U", "nt_code": "U", "nt_id": "///P/118", "linked_nts": [ "///P/117", "///P/119" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.246, "beta": -176.648, "gamma": 55.242, "delta": 78.867, "epsilon": -147.365, "zeta": -72.606, "epsilon_zeta": -74.759, "bb_type": "BI", "chi": -170.686, "glyco_bond": "anti", "C5prime_xyz": [ -1.481, 8.623, 1.128 ], "P_xyz": [ 1.041, 8.940, 1.644 ], "form": "A", "ssZp": 4.638, "Dp": 4.697, "splay_angle": 21.521, "splay_distance": 3.493, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 173.322, "theta": -146.337, "eta_prime": -173.061, "theta_prime": -144.354, "eta_base": -125.114, "theta_base": -124.602, "v0": 5.700, "v1": -32.104, "v2": 44.917, "v3": -42.479, "v4": 23.345, "amplitude": 45.831, "phase_angle": 11.459, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.800, "filter_rmsd": 0.111, "frame": { "rmsd": 0.009, "origin": [ 44.766, 26.463, 16.993 ], "x_axis": [ -0.959, 0.280, -0.048 ], "y_axis": [ 0.004, 0.184, 0.983 ], "z_axis": [ 0.284, 0.942, -0.177 ], "quaternion": [ 0.109, 0.093, 0.762, 0.632 ] } }, { "index": 132, "index_chain": 119, "chain_name": "P", "nt_resnum": 119, "nt_name": "G", "nt_code": "G", "nt_id": "///P/119", "linked_nts": [ "///P/118", "///P/120" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -57.954, "beta": 179.008, "gamma": 39.736, "delta": 74.084, "epsilon": -144.683, "zeta": -82.885, "epsilon_zeta": -61.798, "bb_type": "BI", "chi": -158.094, "glyco_bond": "anti", "C5prime_xyz": [ -1.520, 8.780, 0.458 ], "P_xyz": [ 0.921, 9.397, 1.007 ], "form": "A", "ssZp": 4.312, "Dp": 4.700, "splay_angle": 20.910, "splay_distance": 3.289, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 168.698, "theta": -158.194, "eta_prime": 176.750, "theta_prime": -153.553, "eta_base": -152.309, "theta_base": -127.945, "v0": 4.031, "v1": -31.400, "v2": 45.383, "v3": -44.556, "v4": 25.498, "amplitude": 46.757, "phase_angle": 13.922, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.605, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 44.887, 28.910, 14.503 ], "x_axis": [ -0.860, 0.176, 0.479 ], "y_axis": [ 0.502, 0.125, 0.856 ], "z_axis": [ 0.091, 0.976, -0.196 ], "quaternion": [ -0.131, 0.229, 0.738, 0.620 ] } }, { "index": 133, "index_chain": 120, "chain_name": "P", "nt_resnum": 120, "nt_name": "G", "nt_code": "G", "nt_id": "///P/120", "linked_nts": [ "///P/119", "///P/121" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -49.740, "beta": 163.001, "gamma": 44.090, "delta": 83.210, "epsilon": -148.951, "zeta": -48.873, "epsilon_zeta": -100.078, "bb_type": "BI", "chi": -156.886, "glyco_bond": "anti", "C5prime_xyz": [ -1.245, 8.715, 0.309 ], "P_xyz": [ 1.372, 9.068, 0.128 ], "form": ".", "ssZp": 4.358, "Dp": 4.665, "splay_angle": 22.521, "splay_distance": 3.949, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 166.740, "theta": -140.140, "eta_prime": 177.044, "theta_prime": -151.642, "eta_base": -147.737, "theta_base": -160.332, "v0": 7.671, "v1": -30.582, "v2": 40.583, "v3": -37.360, "v4": 18.787, "amplitude": 40.997, "phase_angle": 8.153, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.605, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 44.024, 31.811, 13.216 ], "x_axis": [ -0.521, 0.075, 0.850 ], "y_axis": [ 0.846, 0.177, 0.502 ], "z_axis": [ -0.113, 0.981, -0.156 ], "quaternion": [ -0.354, 0.338, 0.681, 0.545 ] } }, { "index": 134, "index_chain": 121, "chain_name": "P", "nt_resnum": 121, "nt_name": "A", "nt_code": "A", "nt_id": "///P/121", "linked_nts": [ "///P/120", "///P/122" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -125.250, "beta": 109.615, "gamma": 152.461, "delta": 89.946, "epsilon": -110.549, "zeta": -89.641, "epsilon_zeta": -20.908, "bb_type": "--", "chi": -171.933, "glyco_bond": "anti", "C5prime_xyz": [ -0.966, 8.173, 1.403 ], "P_xyz": [ -0.253, 10.162, -0.113 ], "form": "A", "ssZp": 4.525, "Dp": 4.753, "splay_angle": 19.718, "splay_distance": 3.173, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": -171.194, "theta": -174.922, "eta_prime": -172.610, "theta_prime": -162.684, "eta_base": -169.502, "theta_base": -125.365, "v0": 17.433, "v1": -33.014, "v2": 35.751, "v3": -26.469, "v4": 5.878, "amplitude": 36.232, "phase_angle": 350.659, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.200, "filter_rmsd": 0.036, "frame": { "rmsd": 0.005, "origin": [ 41.883, 33.939, 10.669 ], "x_axis": [ -0.432, 0.113, 0.895 ], "y_axis": [ 0.865, 0.334, 0.375 ], "z_axis": [ -0.257, 0.936, -0.242 ], "quaternion": [ -0.406, 0.345, 0.708, 0.463 ] } }, { "index": 135, "index_chain": 122, "chain_name": "P", "nt_resnum": 122, "nt_name": "C", "nt_code": "C", "nt_id": "///P/122", "linked_nts": [ "///P/121", "///P/123" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop", "alpha": -51.989, "beta": 142.254, "gamma": 54.275, "delta": 77.541, "epsilon": -145.034, "zeta": -63.147, "epsilon_zeta": -81.887, "bb_type": "BI", "chi": -155.400, "glyco_bond": "anti", "C5prime_xyz": [ -1.736, 8.967, 0.227 ], "P_xyz": [ 0.772, 9.311, -0.449 ], "form": ".", "ssZp": 4.271, "Dp": 4.677, "splay_angle": 46.405, "splay_distance": 8.135, "splay_ratio": 0.401, "d22": null, "d64": null, "eta": 158.696, "theta": -132.226, "eta_prime": -179.217, "theta_prime": -142.241, "eta_base": -131.581, "theta_base": -142.674, "v0": -0.517, "v1": -26.299, "v2": 41.031, "v3": -42.149, "v4": 27.293, "amplitude": 43.414, "phase_angle": 19.072, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.853, "filter_rmsd": 0.066, "frame": { "rmsd": 0.011, "origin": [ 39.938, 36.431, 10.947 ], "x_axis": [ 0.116, 0.254, 0.960 ], "y_axis": [ 0.872, 0.436, -0.221 ], "z_axis": [ -0.475, 0.863, -0.171 ], "quaternion": [ 0.588, -0.461, -0.611, -0.263 ] } }, { "index": 136, "index_chain": 123, "chain_name": "P", "nt_resnum": 123, "nt_name": "A", "nt_code": "A", "nt_id": "///P/123", "linked_nts": [ "///P/122", "///P/124" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper", "alpha": -155.013, "beta": 145.985, "gamma": 177.172, "delta": 82.882, "epsilon": -122.087, "zeta": -95.953, "epsilon_zeta": -26.134, "bb_type": "--", "chi": -165.471, "glyco_bond": "anti", "C5prime_xyz": [ -1.527, 8.627, 0.900 ], "P_xyz": [ -1.070, 10.922, -0.280 ], "form": ".", "ssZp": 4.315, "Dp": 4.612, "splay_angle": 19.064, "splay_distance": 3.046, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": -160.527, "theta": 170.631, "eta_prime": -161.301, "theta_prime": -176.768, "eta_base": -154.126, "theta_base": -131.397, "v0": 1.847, "v1": -24.209, "v2": 36.003, "v3": -36.114, "v4": 21.712, "amplitude": 37.454, "phase_angle": 15.998, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1f", "suiteness": 0.252, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 34.393, 42.356, 10.386 ], "x_axis": [ 0.264, 0.361, 0.894 ], "y_axis": [ 0.941, 0.107, -0.321 ], "z_axis": [ -0.212, 0.926, -0.312 ], "quaternion": [ 0.515, -0.606, -0.537, -0.281 ] } }, { "index": 137, "index_chain": 124, "chain_name": "P", "nt_resnum": 124, "nt_name": "A", "nt_code": "A", "nt_id": "///P/124", "linked_nts": [ "///P/123", "///P/125" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,A-minor,ribose-zipper", "alpha": -46.202, "beta": 147.544, "gamma": 39.056, "delta": 76.581, "epsilon": -164.620, "zeta": -64.905, "epsilon_zeta": -99.715, "bb_type": "BI", "chi": -148.778, "glyco_bond": "anti", "C5prime_xyz": [ -1.143, 8.716, -0.094 ], "P_xyz": [ 1.462, 8.793, -0.512 ], "form": "A", "ssZp": 4.156, "Dp": 4.639, "splay_angle": 18.411, "splay_distance": 2.897, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 154.591, "theta": -150.216, "eta_prime": 171.014, "theta_prime": -153.056, "eta_base": -136.029, "theta_base": -141.088, "v0": 7.386, "v1": -32.657, "v2": 43.669, "v3": -40.946, "v4": 21.346, "amplitude": 44.263, "phase_angle": 9.400, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.252, "filter_rmsd": 0.041, "frame": { "rmsd": 0.009, "origin": [ 33.888, 45.360, 10.402 ], "x_axis": [ 0.803, 0.282, 0.525 ], "y_axis": [ 0.525, 0.085, -0.847 ], "z_axis": [ -0.283, 0.956, -0.080 ], "quaternion": [ 0.672, -0.670, -0.301, -0.090 ] } }, { "index": 138, "index_chain": 125, "chain_name": "P", "nt_resnum": 125, "nt_name": "A", "nt_code": "A", "nt_id": "///P/125", "linked_nts": [ "///P/124", "///P/126" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,A-minor", "alpha": -72.344, "beta": 169.778, "gamma": 59.957, "delta": 79.149, "epsilon": -137.702, "zeta": -72.024, "epsilon_zeta": -65.678, "bb_type": "BI", "chi": -148.274, "glyco_bond": "anti", "C5prime_xyz": [ -1.289, 8.692, -0.199 ], "P_xyz": [ 1.200, 9.032, -0.872 ], "form": ".", "ssZp": 3.952, "Dp": 4.788, "splay_angle": 26.616, "splay_distance": 4.190, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 171.638, "theta": -139.213, "eta_prime": -178.148, "theta_prime": -136.748, "eta_base": -152.597, "theta_base": -97.604, "v0": 6.050, "v1": -31.669, "v2": 43.533, "v3": -40.689, "v4": 22.202, "amplitude": 44.295, "phase_angle": 10.641, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.743, "filter_rmsd": 0.036, "frame": { "rmsd": 0.014, "origin": [ 32.690, 47.844, 11.289 ], "x_axis": [ 0.938, 0.303, 0.170 ], "y_axis": [ 0.104, 0.221, -0.970 ], "z_axis": [ -0.332, 0.927, 0.176 ], "quaternion": [ 0.764, -0.621, -0.164, 0.065 ] } }, { "index": 139, "index_chain": 126, "chain_name": "P", "nt_resnum": 126, "nt_name": "G", "nt_code": "G", "nt_id": "///P/126", "linked_nts": [ "///P/125", "///P/127" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,internal-loop", "alpha": -62.979, "beta": 156.643, "gamma": 58.088, "delta": 79.115, "epsilon": -145.250, "zeta": -66.751, "epsilon_zeta": -78.499, "bb_type": "BI", "chi": -161.076, "glyco_bond": "anti", "C5prime_xyz": [ -1.312, 8.687, 0.628 ], "P_xyz": [ 1.213, 8.965, 0.047 ], "form": "A", "ssZp": 4.484, "Dp": 4.747, "splay_angle": 27.998, "splay_distance": 4.339, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": 163.328, "theta": -137.515, "eta_prime": -175.706, "theta_prime": -137.164, "eta_base": -117.098, "theta_base": -107.074, "v0": 8.518, "v1": -33.172, "v2": 43.928, "v3": -40.280, "v4": 20.031, "amplitude": 44.342, "phase_angle": 7.842, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.813, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 34.582, 51.533, 11.897 ], "x_axis": [ 0.829, 0.145, -0.539 ], "y_axis": [ -0.556, 0.113, -0.824 ], "z_axis": [ -0.058, 0.983, 0.174 ], "quaternion": [ 0.728, -0.621, 0.165, 0.241 ] } }, { "index": 140, "index_chain": 127, "chain_name": "P", "nt_resnum": 127, "nt_name": "G", "nt_code": "G", "nt_id": "///P/127", "linked_nts": [ "///P/126", "///P/128" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.927, "beta": 160.279, "gamma": 71.431, "delta": 77.746, "epsilon": -136.978, "zeta": -79.873, "epsilon_zeta": -57.105, "bb_type": "BI", "chi": -176.048, "glyco_bond": "anti", "C5prime_xyz": [ -1.669, 8.474, 1.466 ], "P_xyz": [ 0.861, 9.027, 1.275 ], "form": "A", "ssZp": 4.697, "Dp": 4.739, "splay_angle": 25.100, "splay_distance": 3.844, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 173.985, "theta": -148.089, "eta_prime": -167.013, "theta_prime": -148.423, "eta_base": -115.631, "theta_base": -119.994, "v0": 5.014, "v1": -29.940, "v2": 42.080, "v3": -40.729, "v4": 22.579, "amplitude": 43.076, "phase_angle": 12.349, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.461, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 36.853, 55.226, 11.720 ], "x_axis": [ 0.326, 0.066, -0.943 ], "y_axis": [ -0.945, -0.014, -0.327 ], "z_axis": [ -0.035, 0.998, 0.058 ], "quaternion": [ 0.585, -0.566, 0.388, 0.432 ] } }, { "index": 141, "index_chain": 128, "chain_name": "P", "nt_resnum": 128, "nt_name": "U", "nt_code": "U", "nt_id": "///P/128", "linked_nts": [ "///P/127", "///P/129" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.457, "beta": 168.170, "gamma": 54.246, "delta": 77.463, "epsilon": -137.849, "zeta": -80.639, "epsilon_zeta": -57.210, "bb_type": "BI", "chi": -167.694, "glyco_bond": "anti", "C5prime_xyz": [ -1.271, 8.552, 1.019 ], "P_xyz": [ 1.298, 8.856, 1.011 ], "form": "A", "ssZp": 4.692, "Dp": 4.845, "splay_angle": 18.859, "splay_distance": 2.986, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 170.550, "theta": -149.307, "eta_prime": -179.159, "theta_prime": -149.323, "eta_base": -135.809, "theta_base": -134.305, "v0": 10.488, "v1": -35.194, "v2": 44.596, "v3": -40.246, "v4": 18.963, "amplitude": 44.812, "phase_angle": 5.629, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.858, "filter_rmsd": 0.110, "frame": { "rmsd": 0.010, "origin": [ 38.428, 58.724, 11.483 ], "x_axis": [ -0.295, 0.066, -0.953 ], "y_axis": [ -0.956, -0.024, 0.294 ], "z_axis": [ -0.003, 0.998, 0.070 ], "quaternion": [ 0.434, -0.406, 0.548, 0.589 ] } }, { "index": 142, "index_chain": 129, "chain_name": "P", "nt_resnum": 129, "nt_name": "G", "nt_code": "G", "nt_id": "///P/129", "linked_nts": [ "///P/128", "///P/130" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.567, "beta": 170.945, "gamma": 42.580, "delta": 76.902, "epsilon": -153.771, "zeta": -52.073, "epsilon_zeta": -101.698, "bb_type": "BI", "chi": -161.592, "glyco_bond": "anti", "C5prime_xyz": [ -1.182, 8.704, 0.605 ], "P_xyz": [ 1.394, 9.101, 0.647 ], "form": "A", "ssZp": 4.570, "Dp": 4.759, "splay_angle": 23.405, "splay_distance": 3.795, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 157.375, "theta": -143.567, "eta_prime": 166.728, "theta_prime": -151.093, "eta_base": -162.055, "theta_base": -139.423, "v0": 10.885, "v1": -36.424, "v2": 46.113, "v3": -40.993, "v4": 19.284, "amplitude": 46.305, "phase_angle": 5.221, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.713, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 39.939, 61.214, 10.828 ], "x_axis": [ -0.719, -0.172, -0.674 ], "y_axis": [ -0.695, 0.163, 0.700 ], "z_axis": [ -0.011, 0.972, -0.237 ], "quaternion": [ 0.228, -0.298, 0.728, 0.574 ] } }, { "index": 143, "index_chain": 130, "chain_name": "P", "nt_resnum": 130, "nt_name": "A", "nt_code": "A", "nt_id": "///P/130", "linked_nts": [ "///P/129", "///P/131" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -138.963, "beta": 131.131, "gamma": 142.514, "delta": 91.291, "epsilon": -109.190, "zeta": -72.506, "epsilon_zeta": -36.684, "bb_type": "--", "chi": 174.264, "glyco_bond": "anti", "C5prime_xyz": [ -0.717, 7.565, 1.987 ], "P_xyz": [ 0.836, 9.449, 0.896 ], "form": ".", "ssZp": 4.840, "Dp": 4.851, "splay_angle": 33.020, "splay_distance": 4.853, "splay_ratio": 0.286, "d22": null, "d64": null, "eta": 174.972, "theta": -143.301, "eta_prime": -178.782, "theta_prime": -137.195, "eta_base": -149.652, "theta_base": -94.860, "v0": 29.774, "v1": -44.142, "v2": 41.841, "v3": -25.680, "v4": -2.480, "amplitude": 44.969, "phase_angle": 338.504, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 41.210, 63.723, 8.280 ], "x_axis": [ -0.915, -0.152, -0.374 ], "y_axis": [ -0.403, 0.283, 0.870 ], "z_axis": [ -0.026, 0.947, -0.320 ], "quaternion": [ 0.110, -0.175, 0.793, 0.573 ] } }, { "index": 144, "index_chain": 131, "chain_name": "P", "nt_resnum": 131, "nt_name": "A", "nt_code": "A", "nt_id": "///P/131", "linked_nts": [ "///P/130", "///P/132" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop", "alpha": -56.768, "beta": -173.838, "gamma": 38.568, "delta": 85.791, "epsilon": -150.478, "zeta": -78.749, "epsilon_zeta": -71.729, "bb_type": "BI", "chi": -168.681, "glyco_bond": "anti", "C5prime_xyz": [ -1.042, 8.390, 1.114 ], "P_xyz": [ 1.414, 8.421, 2.084 ], "form": ".", "ssZp": 4.663, "Dp": 4.712, "splay_angle": 26.647, "splay_distance": 4.308, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": 161.869, "theta": -153.824, "eta_prime": -176.810, "theta_prime": -153.379, "eta_base": -118.621, "theta_base": -156.373, "v0": 14.828, "v1": -33.832, "v2": 38.758, "v3": -31.235, "v4": 10.551, "amplitude": 38.823, "phase_angle": 356.702, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.160, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 38.239, 66.511, 5.645 ], "x_axis": [ -0.769, -0.193, 0.610 ], "y_axis": [ 0.559, 0.261, 0.787 ], "z_axis": [ -0.311, 0.946, -0.093 ], "quaternion": [ -0.316, 0.126, 0.729, 0.595 ] } }, { "index": 145, "index_chain": 132, "chain_name": "P", "nt_resnum": 132, "nt_name": "A", "nt_code": "A", "nt_id": "///P/132", "linked_nts": [ "///P/131", "///P/133" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -64.773, "beta": 174.198, "gamma": 47.723, "delta": 73.065, "epsilon": -156.474, "zeta": -54.252, "epsilon_zeta": -102.223, "bb_type": "BI", "chi": -159.316, "glyco_bond": "anti", "C5prime_xyz": [ -1.425, 8.787, 0.482 ], "P_xyz": [ 1.087, 9.530, 0.490 ], "form": ".", "ssZp": 4.457, "Dp": 4.689, "splay_angle": 32.362, "splay_distance": 5.199, "splay_ratio": 0.286, "d22": null, "d64": null, "eta": 163.413, "theta": -140.651, "eta_prime": 170.196, "theta_prime": -142.270, "eta_base": 178.918, "theta_base": -117.554, "v0": 5.353, "v1": -32.424, "v2": 45.448, "v3": -43.626, "v4": 24.283, "amplitude": 46.490, "phase_angle": 12.157, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.763, "filter_rmsd": 0.036, "frame": { "rmsd": 0.008, "origin": [ 37.438, 68.714, 2.031 ], "x_axis": [ -0.635, -0.101, 0.766 ], "y_axis": [ 0.662, 0.441, 0.606 ], "z_axis": [ -0.399, 0.892, -0.213 ], "quaternion": [ -0.385, 0.185, 0.756, 0.495 ] } }, { "index": 146, "index_chain": 133, "chain_name": "P", "nt_resnum": 133, "nt_name": "G", "nt_code": "G", "nt_id": "///P/133", "linked_nts": [ "///P/132", "///P/134" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -143.700, "beta": 158.749, "gamma": 141.774, "delta": 84.136, "epsilon": -122.120, "zeta": -76.056, "epsilon_zeta": -46.064, "bb_type": "--", "chi": 171.642, "glyco_bond": "anti", "C5prime_xyz": [ -0.998, 7.832, 2.159 ], "P_xyz": [ 0.892, 9.556, 1.388 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 176.449, "theta": -150.578, "eta_prime": -170.030, "theta_prime": -155.791, "eta_base": -125.904, "theta_base": null, "v0": 22.905, "v1": -42.186, "v2": 44.740, "v3": -32.280, "v4": 6.023, "amplitude": 45.579, "phase_angle": 348.991, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 33.076, 71.542, 1.940 ], "x_axis": [ -0.143, 0.089, 0.986 ], "y_axis": [ 0.943, 0.315, 0.108 ], "z_axis": [ -0.301, 0.945, -0.129 ], "quaternion": [ 0.511, -0.409, -0.630, -0.418 ] } }, { "index": 147, "index_chain": 134, "chain_name": "P", "nt_resnum": 134, "nt_name": "U", "nt_code": "U", "nt_id": "///P/134", "linked_nts": [ "///P/133", "///P/135" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,BI,non-stack,ss-non-loop", "alpha": -100.510, "beta": 168.399, "gamma": 57.296, "delta": 92.440, "epsilon": -157.922, "zeta": -80.892, "epsilon_zeta": -77.031, "bb_type": "BI", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 130.117, "theta": -153.898, "eta_prime": 151.519, "theta_prime": -153.308, "eta_base": null, "theta_base": null, "v0": 20.293, "v1": -35.140, "v2": 35.985, "v3": -25.158, "v4": 3.270, "amplitude": 37.039, "phase_angle": 346.296, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.098, "filter_rmsd": null }, { "index": 148, "index_chain": 135, "chain_name": "P", "nt_resnum": 135, "nt_name": "G", "nt_code": "G", "nt_id": "///P/135", "linked_nts": [ "///P/134", "///P/136" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -67.293, "beta": -151.205, "gamma": 54.041, "delta": 76.094, "epsilon": -158.339, "zeta": -61.426, "epsilon_zeta": -96.914, "bb_type": "BI", "chi": -157.790, "glyco_bond": "anti", "C5prime_xyz": [ -1.466, 8.855, 0.387 ], "P_xyz": [ 1.012, 9.478, 1.136 ], "form": ".", "ssZp": 4.418, "Dp": 4.653, "splay_angle": 75.152, "splay_distance": 12.467, "splay_ratio": 0.618, "d22": null, "d64": null, "eta": -163.713, "theta": -167.000, "eta_prime": -167.615, "theta_prime": 179.596, "eta_base": null, "theta_base": 172.624, "v0": 4.110, "v1": -29.477, "v2": 42.281, "v3": -41.024, "v4": 23.388, "amplitude": 43.451, "phase_angle": 13.327, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.516, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 26.109, 73.901, 5.346 ], "x_axis": [ 0.810, 0.189, 0.555 ], "y_axis": [ 0.477, 0.338, -0.811 ], "z_axis": [ -0.341, 0.922, 0.184 ], "quaternion": [ 0.764, -0.567, -0.294, -0.094 ] } }, { "index": 149, "index_chain": 136, "chain_name": "P", "nt_resnum": 136, "nt_name": "U", "nt_code": "U", "nt_id": "///P/136", "linked_nts": [ "///P/135", "///P/137" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -159.484, "beta": 93.424, "gamma": -168.716, "delta": 63.537, "epsilon": 78.242, "zeta": 62.729, "epsilon_zeta": 15.513, "bb_type": "--", "chi": -156.184, "glyco_bond": "anti", "C5prime_xyz": [ -1.706, 8.889, 0.342 ], "P_xyz": [ -3.320, 10.862, -0.263 ], "form": "A", "ssZp": 3.833, "Dp": 3.962, "splay_angle": 22.174, "splay_distance": 3.913, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": -148.110, "theta": 163.858, "eta_prime": -176.581, "theta_prime": 175.740, "eta_base": 152.897, "theta_base": -141.616, "v0": 4.008, "v1": -33.819, "v2": 48.832, "v3": -48.134, "v4": 28.041, "amplitude": 50.397, "phase_angle": 14.314, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1f", "suiteness": 0.010, "filter_rmsd": 0.109, "frame": { "rmsd": 0.012, "origin": [ 15.236, 79.210, 2.342 ], "x_axis": [ 0.008, -0.004, 1.000 ], "y_axis": [ 0.996, 0.091, -0.008 ], "z_axis": [ -0.091, 0.996, 0.005 ], "quaternion": [ 0.525, -0.478, -0.519, -0.476 ] } }, { "index": 150, "index_chain": 137, "chain_name": "P", "nt_resnum": 137, "nt_name": "G", "nt_code": "G", "nt_id": "///P/137", "linked_nts": [ "///P/136", "///P/138" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 61.953, "beta": -166.690, "gamma": -172.741, "delta": 83.772, "epsilon": -161.670, "zeta": -58.822, "epsilon_zeta": -102.848, "bb_type": "BI", "chi": -171.472, "glyco_bond": "anti", "C5prime_xyz": [ -0.973, 8.346, 1.227 ], "P_xyz": [ 0.267, 10.353, 0.016 ], "form": "A", "ssZp": 4.651, "Dp": 4.657, "splay_angle": 23.653, "splay_distance": 3.629, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 143.515, "theta": -166.539, "eta_prime": 166.662, "theta_prime": -159.810, "eta_base": -135.529, "theta_base": -126.625, "v0": 19.918, "v1": -40.184, "v2": 44.511, "v3": -34.009, "v4": 9.144, "amplitude": 44.850, "phase_angle": 352.947, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 13.990, 82.397, 4.240 ], "x_axis": [ 0.576, -0.047, 0.816 ], "y_axis": [ 0.814, 0.130, -0.566 ], "z_axis": [ -0.079, 0.990, 0.113 ], "quaternion": [ 0.674, -0.577, -0.332, -0.319 ] } }, { "index": 151, "index_chain": 138, "chain_name": "P", "nt_resnum": 138, "nt_name": "A", "nt_code": "A", "nt_id": "///P/138", "linked_nts": [ "///P/137", "///P/139" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -104.666, "beta": -149.143, "gamma": 66.995, "delta": 77.331, "epsilon": -140.698, "zeta": -78.049, "epsilon_zeta": -62.649, "bb_type": "BI", "chi": -154.386, "glyco_bond": "anti", "C5prime_xyz": [ -1.365, 8.739, 0.188 ], "P_xyz": [ 1.285, 8.935, 0.353 ], "form": "A", "ssZp": 4.267, "Dp": 4.795, "splay_angle": 22.785, "splay_distance": 3.611, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 168.273, "theta": -142.494, "eta_prime": 179.109, "theta_prime": -139.301, "eta_base": -140.522, "theta_base": -110.040, "v0": 6.528, "v1": -32.683, "v2": 44.820, "v3": -42.341, "v4": 22.656, "amplitude": 45.596, "phase_angle": 10.588, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.104, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 13.352, 84.871, 6.817 ], "x_axis": [ 0.965, -0.032, 0.259 ], "y_axis": [ 0.256, 0.308, -0.916 ], "z_axis": [ -0.050, 0.951, 0.305 ], "quaternion": [ 0.803, -0.581, -0.096, -0.090 ] } }, { "index": 152, "index_chain": 139, "chain_name": "P", "nt_resnum": 139, "nt_name": "U", "nt_code": "U", "nt_id": "///P/139", "linked_nts": [ "///P/138", "///P/140" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.224, "beta": 159.732, "gamma": 63.058, "delta": 77.827, "epsilon": -167.086, "zeta": -70.318, "epsilon_zeta": -96.767, "bb_type": "BI", "chi": -163.184, "glyco_bond": "anti", "C5prime_xyz": [ -1.550, 8.788, 0.724 ], "P_xyz": [ 1.009, 9.240, 0.234 ], "form": "A", "ssZp": 4.505, "Dp": 4.568, "splay_angle": 24.456, "splay_distance": 3.757, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 161.671, "theta": -133.563, "eta_prime": -179.726, "theta_prime": -138.029, "eta_base": -132.107, "theta_base": -101.176, "v0": 4.511, "v1": -30.150, "v2": 43.163, "v3": -41.403, "v4": 23.310, "amplitude": 44.254, "phase_angle": 12.747, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.750, "filter_rmsd": 0.107, "frame": { "rmsd": 0.008, "origin": [ 14.884, 87.302, 9.004 ], "x_axis": [ 0.928, -0.117, -0.353 ], "y_axis": [ -0.275, 0.423, -0.863 ], "z_axis": [ 0.250, 0.899, 0.361 ], "quaternion": [ 0.823, -0.535, 0.183, 0.048 ] } }, { "index": 153, "index_chain": 140, "chain_name": "P", "nt_resnum": 140, "nt_name": "G", "nt_code": "G", "nt_id": "///P/140", "linked_nts": [ "///P/139", "///P/141" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -148.293, "beta": -146.501, "gamma": 105.218, "delta": 81.535, "epsilon": -173.885, "zeta": -98.277, "epsilon_zeta": -75.608, "bb_type": "BI", "chi": -167.489, "glyco_bond": "anti", "C5prime_xyz": [ -1.528, 8.666, 1.002 ], "P_xyz": [ 1.073, 8.965, 0.618 ], "form": ".", "ssZp": 4.467, "Dp": 4.468, "splay_angle": 23.259, "splay_distance": 3.574, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 151.516, "theta": -155.651, "eta_prime": 172.826, "theta_prime": -159.600, "eta_base": -126.671, "theta_base": -168.376, "v0": 5.598, "v1": -29.252, "v2": 40.553, "v3": -38.453, "v4": 20.681, "amplitude": 41.313, "phase_angle": 11.010, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 17.928, 89.378, 9.741 ], "x_axis": [ 0.356, -0.043, -0.933 ], "y_axis": [ -0.791, 0.517, -0.326 ], "z_axis": [ 0.497, 0.855, 0.150 ], "quaternion": [ 0.711, -0.415, 0.503, 0.263 ] } }, { "index": 154, "index_chain": 141, "chain_name": "P", "nt_resnum": 141, "nt_name": "A", "nt_code": "A", "nt_id": "///P/141", "linked_nts": [ "///P/140", null ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -157.051, "beta": -143.819, "gamma": 125.889, "delta": 83.398, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -155.073, "glyco_bond": "anti", "C5prime_xyz": [ -1.365, 8.767, 0.248 ], "P_xyz": [ 0.971, 8.948, -0.925 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 2.044, "v1": -23.457, "v2": 34.503, "v3": -34.178, "v4": 20.491, "amplitude": 35.781, "phase_angle": 15.359, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.004, "origin": [ 20.276, 90.086, 12.340 ], "x_axis": [ 0.076, 0.102, -0.992 ], "y_axis": [ -0.629, 0.777, 0.032 ], "z_axis": [ 0.774, 0.621, 0.123 ], "quaternion": [ 0.703, -0.210, 0.628, 0.260 ] } }, { "index": 155, "index_chain": 1, "chain_name": "F", "nt_resnum": -1, "nt_name": "A", "nt_code": "A", "nt_id": "///F/-1", "linked_nts": [ null, "///F/0" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor", "alpha": null, "beta": null, "gamma": 51.746, "delta": 137.598, "epsilon": -148.753, "zeta": 70.755, "epsilon_zeta": 140.492, "bb_type": "--", "chi": 57.708, "glyco_bond": "syn", "C5prime_xyz": [ -5.494, 4.111, 0.961 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": -2.606, "Dp": 2.525, "splay_angle": 78.424, "splay_distance": 12.881, "splay_ratio": 0.633, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -29.048, "v1": 38.614, "v2": -31.457, "v3": 15.794, "v4": 8.166, "amplitude": 37.014, "phase_angle": 148.197, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.034, "frame": { "rmsd": 0.008, "origin": [ 18.653, 35.395, 18.873 ], "x_axis": [ -0.601, -0.352, -0.718 ], "y_axis": [ -0.798, 0.218, 0.562 ], "z_axis": [ -0.041, 0.910, -0.412 ], "quaternion": [ 0.226, -0.385, 0.747, 0.493 ] } }, { "index": 156, "index_chain": 2, "chain_name": "F", "nt_resnum": 0, "nt_name": "A2M", "nt_code": "a", "is_modified": true, "nt_id": "///F/0", "linked_nts": [ "///F/-1", "///F/1" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate,splayed-apart", "alpha": 57.632, "beta": 161.008, "gamma": -167.448, "delta": 147.375, "epsilon": 177.481, "zeta": 142.657, "epsilon_zeta": 34.824, "bb_type": "--", "chi": -122.276, "glyco_bond": "anti", "C5prime_xyz": [ -2.326, 8.576, -1.060 ], "P_xyz": [ -2.180, 9.898, -3.406 ], "form": ".", "ssZp": 2.346, "Dp": 2.470, "splay_angle": 113.857, "splay_distance": 14.602, "splay_ratio": 0.838, "d22": null, "d64": null, "eta": 144.326, "theta": 37.289, "eta_prime": 146.904, "theta_prime": 50.579, "eta_base": 167.899, "theta_base": 119.650, "v0": -28.178, "v1": 42.255, "v2": -38.848, "v3": 23.445, "v4": 2.854, "amplitude": 42.089, "phase_angle": 157.370, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.048, "origin": [ 25.912, 40.936, 27.957 ], "x_axis": [ 0.042, 0.375, -0.926 ], "y_axis": [ -0.997, -0.038, -0.061 ], "z_axis": [ -0.058, 0.926, 0.372 ], "quaternion": [ 0.587, -0.421, 0.370, 0.585 ] } }, { "index": 157, "index_chain": 3, "chain_name": "F", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///F/1", "linked_nts": [ "///F/0", "///F/2" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-canonical,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -42.864, "beta": 108.562, "gamma": 177.402, "delta": 150.468, "epsilon": -92.643, "zeta": 94.981, "epsilon_zeta": 172.375, "bb_type": "--", "chi": -62.918, "glyco_bond": "--", "C5prime_xyz": [ -2.655, 6.499, -3.253 ], "P_xyz": [ -3.674, 5.607, -5.511 ], "form": ".", "ssZp": -0.489, "Dp": 0.910, "splay_angle": 45.927, "splay_distance": 8.324, "splay_ratio": 0.391, "d22": null, "d64": null, "eta": -8.506, "theta": 65.467, "eta_prime": -37.650, "theta_prime": 54.178, "eta_base": -104.501, "theta_base": 61.950, "v0": -15.035, "v1": 31.474, "v2": -34.997, "v3": 27.036, "v4": -7.680, "amplitude": 35.206, "phase_angle": 173.752, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ 21.165, 37.253, 41.266 ], "x_axis": [ -0.455, 0.418, 0.786 ], "y_axis": [ -0.863, 0.012, -0.506 ], "z_axis": [ -0.221, -0.908, 0.355 ], "quaternion": [ 0.478, 0.211, -0.527, 0.670 ] } }, { "index": 158, "index_chain": 4, "chain_name": "F", "nt_resnum": 2, "nt_name": "C", "nt_code": "C", "nt_id": "///F/2", "linked_nts": [ "///F/1", "///F/3" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor,phosphate", "alpha": 47.506, "beta": 173.133, "gamma": -159.872, "delta": 84.796, "epsilon": -140.687, "zeta": -84.417, "epsilon_zeta": -56.270, "bb_type": "BI", "chi": -169.966, "glyco_bond": "anti", "C5prime_xyz": [ -1.382, 8.504, 1.237 ], "P_xyz": [ -0.704, 10.921, 0.580 ], "form": "A", "ssZp": 4.514, "Dp": 4.629, "splay_angle": 24.805, "splay_distance": 3.853, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 128.265, "theta": 166.628, "eta_prime": 105.885, "theta_prime": 179.132, "eta_base": 122.736, "theta_base": -149.845, "v0": 10.779, "v1": -33.193, "v2": 41.324, "v3": -36.277, "v4": 16.259, "amplitude": 41.418, "phase_angle": 3.852, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "6n", "suiteness": 0.191, "filter_rmsd": 0.069, "frame": { "rmsd": 0.010, "origin": [ 26.681, 37.506, 35.037 ], "x_axis": [ -0.203, 0.111, 0.973 ], "y_axis": [ -0.974, -0.123, -0.189 ], "z_axis": [ 0.099, -0.986, 0.134 ], "quaternion": [ 0.449, 0.443, -0.486, 0.604 ] } }, { "index": 159, "index_chain": 5, "chain_name": "F", "nt_resnum": 3, "nt_name": "G", "nt_code": "G", "nt_id": "///F/3", "linked_nts": [ "///F/2", "///F/4" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -54.340, "beta": 173.410, "gamma": 41.199, "delta": 78.428, "epsilon": -152.669, "zeta": -68.490, "epsilon_zeta": -84.178, "bb_type": "BI", "chi": -162.777, "glyco_bond": "anti", "C5prime_xyz": [ -1.012, 8.643, 0.798 ], "P_xyz": [ 1.541, 8.881, 1.322 ], "form": "A", "ssZp": 4.522, "Dp": 4.684, "splay_angle": 22.137, "splay_distance": 3.491, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 169.724, "theta": -148.511, "eta_prime": 178.659, "theta_prime": -143.817, "eta_base": -148.575, "theta_base": -120.144, "v0": 15.807, "v1": -38.969, "v2": 45.926, "v3": -37.467, "v4": 13.979, "amplitude": 45.938, "phase_angle": 358.650, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.631, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ 28.697, 34.308, 35.779 ], "x_axis": [ -0.697, 0.131, 0.705 ], "y_axis": [ -0.717, -0.153, -0.680 ], "z_axis": [ 0.019, -0.979, 0.201 ], "quaternion": [ 0.296, 0.253, -0.579, 0.716 ] } }, { "index": 160, "index_chain": 6, "chain_name": "F", "nt_resnum": 4, "nt_name": "C", "nt_code": "C", "nt_id": "///F/4", "linked_nts": [ "///F/3", "///F/5" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.193, "beta": 166.938, "gamma": 61.212, "delta": 85.146, "epsilon": -145.102, "zeta": -71.274, "epsilon_zeta": -73.829, "bb_type": "BI", "chi": -163.357, "glyco_bond": "anti", "C5prime_xyz": [ -1.541, 8.812, 0.674 ], "P_xyz": [ 1.079, 9.151, 0.768 ], "form": "A", "ssZp": 4.282, "Dp": 4.469, "splay_angle": 22.131, "splay_distance": 3.727, "splay_ratio": 0.196, "d22": 4.166, "d64": 4.246, "eta": 173.987, "theta": -134.026, "eta_prime": -168.322, "theta_prime": -128.930, "eta_base": -131.988, "theta_base": -110.607, "v0": 3.578, "v1": -27.785, "v2": 40.243, "v3": -38.667, "v4": 22.173, "amplitude": 41.366, "phase_angle": 13.387, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.847, "filter_rmsd": 0.076, "frame": { "rmsd": 0.018, "origin": [ 29.356, 31.582, 37.859 ], "x_axis": [ -0.956, 0.065, 0.286 ], "y_axis": [ -0.292, -0.270, -0.917 ], "z_axis": [ 0.018, -0.961, 0.277 ], "quaternion": [ 0.113, 0.096, -0.594, 0.791 ] } }, { "index": 161, "index_chain": 7, "chain_name": "F", "nt_resnum": 5, "nt_name": "C", "nt_code": "C", "nt_id": "///F/5", "linked_nts": [ "///F/4", "///F/6" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -58.895, "beta": 177.805, "gamma": 60.662, "delta": 139.640, "epsilon": -140.304, "zeta": -163.560, "epsilon_zeta": 23.256, "bb_type": "--", "chi": -126.873, "glyco_bond": "anti", "C5prime_xyz": [ -2.399, 8.830, -1.017 ], "P_xyz": [ -0.085, 9.882, -0.425 ], "form": ".", "ssZp": 2.121, "Dp": 2.084, "splay_angle": 69.693, "splay_distance": 11.798, "splay_ratio": 0.573, "d22": null, "d64": null, "eta": 179.983, "theta": 178.385, "eta_prime": -148.579, "theta_prime": 154.917, "eta_base": -120.896, "theta_base": 124.329, "v0": -33.831, "v1": 41.769, "v2": -33.954, "v3": 15.272, "v4": 11.936, "amplitude": 41.282, "phase_angle": 145.336, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.914, "filter_rmsd": 0.071, "frame": { "rmsd": 0.013, "origin": [ 28.455, 28.939, 40.327 ], "x_axis": [ -0.932, 0.210, -0.295 ], "y_axis": [ 0.192, -0.407, -0.893 ], "z_axis": [ -0.308, -0.889, 0.339 ], "quaternion": [ 0.006, -0.184, -0.545, 0.818 ] } }, { "index": 162, "index_chain": 8, "chain_name": "F", "nt_resnum": 6, "nt_name": "A", "nt_code": "A", "nt_id": "///F/6", "linked_nts": [ "///F/5", "///F/7" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-stack,non-pair-contact,bulge,phosphate,splayed-apart", "alpha": -64.565, "beta": -167.994, "gamma": -47.729, "delta": 157.333, "epsilon": -143.277, "zeta": -91.867, "epsilon_zeta": -51.411, "bb_type": "BI", "chi": -108.456, "glyco_bond": "anti", "C5prime_xyz": [ -1.854, 8.173, -1.385 ], "P_xyz": [ -1.273, 10.708, -1.250 ], "form": ".", "ssZp": 1.646, "Dp": 1.583, "splay_angle": 89.345, "splay_distance": 13.414, "splay_ratio": 0.703, "d22": null, "d64": null, "eta": 127.229, "theta": -129.759, "eta_prime": 114.866, "theta_prime": -122.978, "eta_base": 89.999, "theta_base": -89.888, "v0": -12.492, "v1": 35.612, "v2": -42.683, "v3": 37.445, "v4": -16.037, "amplitude": 42.718, "phase_angle": 182.344, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.016, "origin": [ 40.111, 30.399, 41.425 ], "x_axis": [ -0.328, 0.781, -0.531 ], "y_axis": [ -0.634, -0.599, -0.489 ], "z_axis": [ -0.700, 0.176, 0.692 ], "quaternion": [ 0.437, -0.380, -0.097, 0.809 ] } }, { "index": 163, "index_chain": 9, "chain_name": "F", "nt_resnum": 7, "nt_name": "G", "nt_code": "G", "nt_id": "///F/7", "linked_nts": [ "///F/6", "///F/8" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,junction-loop,splayed-apart", "alpha": -82.548, "beta": -176.836, "gamma": 67.226, "delta": 81.318, "epsilon": -135.622, "zeta": -68.690, "epsilon_zeta": -66.933, "bb_type": "BI", "chi": -179.475, "glyco_bond": "anti", "C5prime_xyz": [ -1.913, 8.579, 1.632 ], "P_xyz": [ 0.636, 9.009, 2.278 ], "form": ".", "ssZp": 4.650, "Dp": 4.673, "splay_angle": 31.547, "splay_distance": 4.735, "splay_ratio": 0.272, "d22": null, "d64": null, "eta": 179.211, "theta": -124.872, "eta_prime": -154.908, "theta_prime": -121.207, "eta_base": -111.404, "theta_base": -58.729, "v0": 4.657, "v1": -28.814, "v2": 41.138, "v3": -38.721, "v4": 21.735, "amplitude": 42.062, "phase_angle": 12.032, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.061, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 28.016, 25.528, 44.573 ], "x_axis": [ -0.317, -0.170, -0.933 ], "y_axis": [ 0.940, -0.184, -0.286 ], "z_axis": [ -0.123, -0.968, 0.218 ], "quaternion": [ -0.423, -0.403, -0.478, 0.656 ] } }, { "index": 164, "index_chain": 10, "chain_name": "F", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///F/8", "linked_nts": [ "///F/7", "///F/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop", "alpha": -53.689, "beta": 167.357, "gamma": 41.244, "delta": 80.438, "epsilon": -163.567, "zeta": -59.061, "epsilon_zeta": -104.506, "bb_type": "BI", "chi": -158.055, "glyco_bond": "anti", "C5prime_xyz": [ -0.948, 8.613, 0.522 ], "P_xyz": [ 1.613, 8.552, 1.082 ], "form": "A", "ssZp": 4.266, "Dp": 4.517, "splay_angle": 22.134, "splay_distance": 3.437, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 163.016, "theta": -140.280, "eta_prime": -173.491, "theta_prime": -137.278, "eta_base": -89.755, "theta_base": -105.216, "v0": 10.509, "v1": -33.690, "v2": 42.656, "v3": -37.058, "v4": 17.072, "amplitude": 42.778, "phase_angle": 4.326, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.653, "filter_rmsd": 0.042, "frame": { "rmsd": 0.011, "origin": [ 27.934, 21.839, 41.605 ], "x_axis": [ 0.755, -0.164, -0.635 ], "y_axis": [ 0.644, -0.001, 0.765 ], "z_axis": [ -0.126, -0.986, 0.105 ], "quaternion": [ 0.682, 0.642, 0.187, -0.296 ] } }, { "index": 165, "index_chain": 11, "chain_name": "F", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///F/9", "linked_nts": [ "///F/8", "///F/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -88.446, "beta": -177.802, "gamma": 64.777, "delta": 83.842, "epsilon": -155.589, "zeta": -66.681, "epsilon_zeta": -88.908, "bb_type": "BI", "chi": -149.851, "glyco_bond": "anti", "C5prime_xyz": [ -1.292, 8.631, 0.066 ], "P_xyz": [ 1.345, 8.673, -0.026 ], "form": "A", "ssZp": 4.118, "Dp": 4.563, "splay_angle": 20.493, "splay_distance": 3.257, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 164.529, "theta": -137.803, "eta_prime": -176.413, "theta_prime": -140.977, "eta_base": -128.620, "theta_base": -115.015, "v0": 13.209, "v1": -35.524, "v2": 43.186, "v3": -36.479, "v4": 14.787, "amplitude": 43.194, "phase_angle": 1.092, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.420, "filter_rmsd": 0.036, "frame": { "rmsd": 0.011, "origin": [ 27.991, 18.444, 41.074 ], "x_axis": [ 0.992, -0.108, -0.071 ], "y_axis": [ 0.068, -0.024, 0.997 ], "z_axis": [ -0.110, -0.994, -0.017 ], "quaternion": [ 0.698, 0.713, -0.014, -0.063 ] } }, { "index": 166, "index_chain": 12, "chain_name": "F", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///F/10", "linked_nts": [ "///F/9", "///F/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper,phosphate", "alpha": -81.226, "beta": 178.140, "gamma": 61.202, "delta": 75.852, "epsilon": -154.780, "zeta": -65.274, "epsilon_zeta": -89.507, "bb_type": "BI", "chi": -153.068, "glyco_bond": "anti", "C5prime_xyz": [ -1.367, 8.851, 0.144 ], "P_xyz": [ 1.197, 9.186, -0.103 ], "form": "A", "ssZp": 4.211, "Dp": 4.671, "splay_angle": 28.111, "splay_distance": 4.482, "splay_ratio": 0.244, "d22": 4.152, "d64": 4.332, "eta": 163.453, "theta": -147.613, "eta_prime": 176.533, "theta_prime": -145.897, "eta_base": -139.868, "theta_base": -124.994, "v0": 4.759, "v1": -31.999, "v2": 45.004, "v3": -43.566, "v4": 24.745, "amplitude": 46.157, "phase_angle": 12.833, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.686, "filter_rmsd": 0.070, "frame": { "rmsd": 0.010, "origin": [ 28.811, 15.438, 40.128 ], "x_axis": [ 0.870, 0.044, 0.492 ], "y_axis": [ -0.484, -0.123, 0.866 ], "z_axis": [ 0.098, -0.991, -0.086 ], "quaternion": [ 0.644, 0.721, -0.153, 0.205 ] } }, { "index": 167, "index_chain": 13, "chain_name": "F", "nt_resnum": 11, "nt_name": "U", "nt_code": "U", "nt_id": "///F/11", "linked_nts": [ "///F/10", null ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,ribose-zipper", "alpha": -73.700, "beta": 177.691, "gamma": 66.835, "delta": 86.324, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -161.715, "glyco_bond": "anti", "C5prime_xyz": [ -1.416, 8.704, 0.665 ], "P_xyz": [ 1.088, 9.274, 0.907 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 4.172, "v1": -24.060, "v2": 33.398, "v3": -32.218, "v4": 17.811, "amplitude": 34.141, "phase_angle": 11.972, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.614, "filter_rmsd": 0.110, "frame": { "rmsd": 0.009, "origin": [ 30.891, 11.511, 39.539 ], "x_axis": [ 0.456, 0.328, 0.827 ], "y_axis": [ -0.858, -0.085, 0.507 ], "z_axis": [ 0.237, -0.941, 0.242 ], "quaternion": [ 0.635, 0.570, -0.233, 0.467 ] } }, { "index": 168, "index_chain": 1, "chain_name": "Q", "nt_resnum": 12, "nt_name": "GTP", "nt_code": "g", "is_modified": true, "nt_id": "///Q/12", "linked_nts": [ null, "///Q/13" ], "nt_type": "RNA", "dbn": "(", "summary": "modified,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 169.337, "delta": 98.788, "epsilon": -111.612, "zeta": -82.822, "epsilon_zeta": -28.790, "bb_type": "--", "chi": 176.968, "glyco_bond": "anti", "C5prime_xyz": [ -1.149, 7.641, 2.073 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.484, "Dp": 4.538, "splay_angle": 24.646, "splay_distance": 3.885, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 18.572, "v1": -27.046, "v2": 25.100, "v3": -15.302, "v4": -1.939, "amplitude": 27.200, "phase_angle": 337.337, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.057, "frame": { "rmsd": 0.057, "origin": [ 33.597, 9.488, 39.866 ], "x_axis": [ 0.034, 0.241, 0.970 ], "y_axis": [ -0.930, -0.347, 0.119 ], "z_axis": [ 0.365, -0.906, 0.212 ], "quaternion": [ 0.474, 0.541, -0.319, 0.617 ] } }, { "index": 169, "index_chain": 2, "chain_name": "Q", "nt_resnum": 13, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/13", "linked_nts": [ "///Q/12", "///Q/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -45.996, "beta": 179.728, "gamma": 41.721, "delta": 80.374, "epsilon": -159.030, "zeta": -62.621, "epsilon_zeta": -96.409, "bb_type": "BI", "chi": -160.270, "glyco_bond": "anti", "C5prime_xyz": [ -1.216, 8.693, 0.488 ], "P_xyz": [ 1.342, 9.169, 0.948 ], "form": "A", "ssZp": 4.400, "Dp": 4.586, "splay_angle": 21.521, "splay_distance": 3.412, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 163.357, "theta": -145.952, "eta_prime": -179.734, "theta_prime": -143.617, "eta_base": -137.599, "theta_base": -112.147, "v0": 6.194, "v1": -32.039, "v2": 44.170, "v3": -42.007, "v4": 22.588, "amplitude": 44.993, "phase_angle": 10.975, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.075, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 36.448, 7.306, 41.349 ], "x_axis": [ -0.554, 0.030, 0.832 ], "y_axis": [ -0.751, -0.449, -0.484 ], "z_axis": [ 0.359, -0.893, 0.271 ], "quaternion": [ 0.259, 0.395, -0.457, 0.754 ] } }, { "index": 170, "index_chain": 3, "chain_name": "Q", "nt_resnum": 14, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/14", "linked_nts": [ "///Q/13", "///Q/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -81.122, "beta": 178.537, "gamma": 59.944, "delta": 75.304, "epsilon": -147.964, "zeta": -77.167, "epsilon_zeta": -70.797, "bb_type": "BI", "chi": -158.958, "glyco_bond": "anti", "C5prime_xyz": [ -1.295, 8.835, 0.479 ], "P_xyz": [ 1.307, 9.199, 0.379 ], "form": "A", "ssZp": 4.440, "Dp": 4.740, "splay_angle": 20.593, "splay_distance": 3.210, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 163.694, "theta": -151.995, "eta_prime": 177.661, "theta_prime": -149.296, "eta_base": -136.491, "theta_base": -128.284, "v0": 8.672, "v1": -35.163, "v2": 47.256, "v3": -43.071, "v4": 21.900, "amplitude": 47.752, "phase_angle": 8.269, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.671, "filter_rmsd": 0.071, "frame": { "rmsd": 0.012, "origin": [ 37.671, 5.336, 43.852 ], "x_axis": [ -0.915, -0.150, 0.376 ], "y_axis": [ -0.255, -0.507, -0.823 ], "z_axis": [ 0.314, -0.849, 0.425 ], "quaternion": [ 0.031, 0.204, -0.496, 0.844 ] } }, { "index": 171, "index_chain": 4, "chain_name": "Q", "nt_resnum": 15, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/15", "linked_nts": [ "///Q/14", "///Q/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.089, "beta": 168.401, "gamma": 52.540, "delta": 81.225, "epsilon": -145.611, "zeta": -79.219, "epsilon_zeta": -66.393, "bb_type": "BI", "chi": -157.082, "glyco_bond": "anti", "C5prime_xyz": [ -1.428, 8.695, 0.438 ], "P_xyz": [ 1.169, 8.998, 0.527 ], "form": "A", "ssZp": 4.285, "Dp": 4.617, "splay_angle": 20.387, "splay_distance": 3.237, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 169.911, "theta": -145.406, "eta_prime": -179.416, "theta_prime": -145.751, "eta_base": -147.539, "theta_base": -119.784, "v0": 8.138, "v1": -31.386, "v2": 41.785, "v3": -37.733, "v4": 18.755, "amplitude": 42.147, "phase_angle": 7.514, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.871, "filter_rmsd": 0.037, "frame": { "rmsd": 0.016, "origin": [ 38.207, 3.371, 46.333 ], "x_axis": [ -0.970, -0.148, -0.193 ], "y_axis": [ 0.242, -0.503, -0.830 ], "z_axis": [ 0.025, -0.851, 0.524 ], "quaternion": [ -0.112, -0.049, -0.486, 0.866 ] } }, { "index": 172, "index_chain": 5, "chain_name": "Q", "nt_resnum": 16, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/16", "linked_nts": [ "///Q/15", "///Q/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.047, "beta": 162.979, "gamma": 56.126, "delta": 79.431, "epsilon": -156.487, "zeta": -72.316, "epsilon_zeta": -84.172, "bb_type": "BI", "chi": -157.900, "glyco_bond": "anti", "C5prime_xyz": [ -1.465, 8.858, 0.414 ], "P_xyz": [ 1.112, 9.192, -0.058 ], "form": "A", "ssZp": 4.441, "Dp": 4.656, "splay_angle": 26.328, "splay_distance": 4.169, "splay_ratio": 0.231, "d22": 3.999, "d64": 4.373, "eta": 159.607, "theta": -146.579, "eta_prime": 174.053, "theta_prime": -146.822, "eta_base": -142.481, "theta_base": -123.772, "v0": 3.471, "v1": -29.924, "v2": 43.411, "v3": -42.440, "v4": 24.549, "amplitude": 44.763, "phase_angle": 14.114, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.907, "filter_rmsd": 0.070, "frame": { "rmsd": 0.010, "origin": [ 37.142, 1.263, 48.546 ], "x_axis": [ -0.706, -0.323, -0.630 ], "y_axis": [ 0.694, -0.493, -0.525 ], "z_axis": [ -0.141, -0.808, 0.572 ], "quaternion": [ -0.305, -0.232, -0.400, 0.832 ] } }, { "index": 173, "index_chain": 6, "chain_name": "Q", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/17", "linked_nts": [ "///Q/16", "///Q/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop", "alpha": -72.328, "beta": 178.670, "gamma": 60.786, "delta": 79.932, "epsilon": -142.063, "zeta": -69.887, "epsilon_zeta": -72.176, "bb_type": "BI", "chi": -168.287, "glyco_bond": "anti", "C5prime_xyz": [ -1.663, 8.828, 0.946 ], "P_xyz": [ 0.900, 9.247, 1.280 ], "form": "A", "ssZp": 4.541, "Dp": 4.636, "splay_angle": 25.443, "splay_distance": 3.994, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 172.618, "theta": -134.682, "eta_prime": -176.594, "theta_prime": -134.207, "eta_base": -139.402, "theta_base": -94.095, "v0": -0.421, "v1": -27.155, "v2": 43.029, "v3": -43.741, "v4": 27.846, "amplitude": 45.430, "phase_angle": 18.711, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.853, "filter_rmsd": 0.071, "frame": { "rmsd": 0.012, "origin": [ 34.565, -1.457, 50.375 ], "x_axis": [ -0.183, -0.264, -0.947 ], "y_axis": [ 0.964, -0.238, -0.119 ], "z_axis": [ -0.194, -0.935, 0.298 ], "quaternion": [ -0.468, -0.435, -0.402, 0.655 ] } }, { "index": 174, "index_chain": 7, "chain_name": "Q", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/17", "linked_nts": [ "///Q/17", "///Q/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -76.771, "beta": 174.284, "gamma": 58.209, "delta": 75.627, "epsilon": -158.837, "zeta": -59.822, "epsilon_zeta": -99.015, "bb_type": "BI", "chi": -169.530, "glyco_bond": "anti", "C5prime_xyz": [ -1.657, 8.600, 1.035 ], "P_xyz": [ 0.861, 9.137, 0.940 ], "form": "A", "ssZp": 4.741, "Dp": 4.766, "splay_angle": 23.667, "splay_distance": 3.768, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 157.837, "theta": -142.581, "eta_prime": 175.573, "theta_prime": -142.168, "eta_base": -122.861, "theta_base": -108.866, "v0": 4.448, "v1": -32.459, "v2": 46.047, "v3": -44.177, "v4": 25.655, "amplitude": 47.273, "phase_angle": 13.079, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.811, "filter_rmsd": 0.037, "frame": { "rmsd": 0.016, "origin": [ 33.094, -4.959, 49.141 ], "x_axis": [ 0.533, -0.260, -0.805 ], "y_axis": [ 0.825, -0.051, 0.563 ], "z_axis": [ -0.187, -0.964, 0.188 ], "quaternion": [ 0.646, 0.591, 0.239, -0.420 ] } }, { "index": 175, "index_chain": 8, "chain_name": "Q", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/17", "linked_nts": [ "///Q/17", "///Q/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop", "alpha": -73.688, "beta": 179.646, "gamma": 60.088, "delta": 81.015, "epsilon": -145.375, "zeta": -76.834, "epsilon_zeta": -68.541, "bb_type": "BI", "chi": -162.376, "glyco_bond": "anti", "C5prime_xyz": [ -1.520, 8.761, 0.574 ], "P_xyz": [ 1.031, 9.294, 0.399 ], "form": ".", "ssZp": 4.555, "Dp": 4.764, "splay_angle": 55.393, "splay_distance": 8.707, "splay_ratio": 0.467, "d22": 6.248, "d64": 7.256, "eta": 173.478, "theta": -154.259, "eta_prime": -171.678, "theta_prime": -139.078, "eta_base": -120.967, "theta_base": -127.753, "v0": 1.970, "v1": -27.937, "v2": 41.350, "v3": -41.146, "v4": 24.956, "amplitude": 42.990, "phase_angle": 15.876, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.752, "filter_rmsd": 0.109, "frame": { "rmsd": 0.010, "origin": [ 32.566, -8.025, 47.014 ], "x_axis": [ 0.908, -0.306, -0.286 ], "y_axis": [ 0.285, -0.050, 0.957 ], "z_axis": [ -0.307, -0.951, 0.042 ], "quaternion": [ 0.689, 0.692, -0.007, -0.214 ] } }, { "index": 176, "index_chain": 9, "chain_name": "Q", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/17", "linked_nts": [ "///Q/17", "///Q/17" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor", "alpha": -65.644, "beta": -136.839, "gamma": 57.964, "delta": 140.991, "epsilon": -81.742, "zeta": 80.362, "epsilon_zeta": 197.896, "bb_type": "--", "chi": -132.391, "glyco_bond": "anti", "C5prime_xyz": [ -2.048, 8.771, -0.610 ], "P_xyz": [ -0.331, 9.768, 1.120 ], "form": ".", "ssZp": 0.772, "Dp": 0.707, "splay_angle": 32.106, "splay_distance": 5.430, "splay_ratio": 0.297, "d22": null, "d64": null, "eta": -127.854, "theta": 103.291, "eta_prime": -125.132, "theta_prime": 84.314, "eta_base": -128.922, "theta_base": 68.267, "v0": -25.053, "v1": 37.125, "v2": -34.274, "v3": 20.630, "v4": 2.654, "amplitude": 37.162, "phase_angle": 157.265, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.934, "filter_rmsd": 0.103, "frame": { "rmsd": 0.006, "origin": [ 31.112, -16.549, 45.996 ], "x_axis": [ 0.877, 0.412, -0.249 ], "y_axis": [ -0.030, 0.563, 0.826 ], "z_axis": [ 0.480, -0.717, 0.506 ], "quaternion": [ 0.858, 0.449, 0.212, 0.129 ] } }, { "index": 177, "index_chain": 10, "chain_name": "Q", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/17", "linked_nts": [ "///Q/17", "///Q/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart", "alpha": -135.169, "beta": 162.503, "gamma": 64.901, "delta": 83.012, "epsilon": -139.238, "zeta": -58.115, "epsilon_zeta": -81.124, "bb_type": "BI", "chi": -93.500, "glyco_bond": "anti", "C5prime_xyz": [ -2.218, 7.531, -2.923 ], "P_xyz": [ -0.347, 6.667, -4.574 ], "form": ".", "ssZp": 0.231, "Dp": 4.609, "splay_angle": 96.629, "splay_distance": 14.774, "splay_ratio": 0.747, "d22": null, "d64": null, "eta": 143.505, "theta": -134.180, "eta_prime": 149.195, "theta_prime": -129.030, "eta_base": 139.400, "theta_base": -109.195, "v0": 1.691, "v1": -23.542, "v2": 35.026, "v3": -34.634, "v4": 21.128, "amplitude": 36.404, "phase_angle": 15.812, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6g", "suiteness": 0.431, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 28.753, -11.957, 47.679 ], "x_axis": [ -0.262, -0.813, -0.520 ], "y_axis": [ -0.805, -0.113, 0.582 ], "z_axis": [ -0.532, 0.571, -0.625 ], "quaternion": [ -0.005, -0.608, 0.666, 0.433 ] } }, { "index": 178, "index_chain": 11, "chain_name": "Q", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/17", "linked_nts": [ "///Q/17", "///Q/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,hairpin-loop,splayed-apart", "alpha": -60.221, "beta": -114.572, "gamma": 65.853, "delta": 149.118, "epsilon": -128.432, "zeta": 128.851, "epsilon_zeta": 102.717, "bb_type": "--", "chi": -123.354, "glyco_bond": "anti", "C5prime_xyz": [ -2.010, 8.807, -0.988 ], "P_xyz": [ -0.289, 9.527, 0.816 ], "form": ".", "ssZp": 1.500, "Dp": 1.618, "splay_angle": 49.530, "splay_distance": 7.816, "splay_ratio": 0.421, "d22": null, "d64": null, "eta": -124.149, "theta": 141.382, "eta_prime": -106.016, "theta_prime": 125.180, "eta_base": -122.702, "theta_base": 145.304, "v0": -26.895, "v1": 42.734, "v2": -41.862, "v3": 27.476, "v4": -0.421, "amplitude": 44.004, "phase_angle": 162.052, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.564, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ 14.930, -17.138, 48.280 ], "x_axis": [ 0.584, -0.809, 0.068 ], "y_axis": [ 0.666, 0.526, 0.529 ], "z_axis": [ -0.464, -0.263, 0.846 ], "quaternion": [ 0.860, 0.230, -0.155, -0.429 ] } }, { "index": 179, "index_chain": 12, "chain_name": "Q", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/17", "linked_nts": [ "///Q/17", "///Q/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -69.069, "beta": 143.517, "gamma": 48.646, "delta": 80.424, "epsilon": -154.787, "zeta": -68.356, "epsilon_zeta": -86.431, "bb_type": "BI", "chi": -159.254, "glyco_bond": "anti", "C5prime_xyz": [ -1.608, 8.738, 0.484 ], "P_xyz": [ 1.009, 8.761, 0.357 ], "form": "A", "ssZp": 4.344, "Dp": 4.563, "splay_angle": 22.012, "splay_distance": 3.502, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 178.640, "theta": -136.091, "eta_prime": 178.121, "theta_prime": -139.231, "eta_base": -171.236, "theta_base": -106.644, "v0": 2.665, "v1": -27.395, "v2": 40.078, "v3": -39.269, "v4": 23.489, "amplitude": 41.462, "phase_angle": 14.846, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.809, "filter_rmsd": 0.037, "frame": { "rmsd": 0.013, "origin": [ 11.926, -10.527, 45.388 ], "x_axis": [ -0.493, -0.687, 0.534 ], "y_axis": [ 0.524, 0.255, 0.813 ], "z_axis": [ -0.694, 0.681, 0.234 ], "quaternion": [ -0.499, -0.066, 0.615, 0.607 ] } }, { "index": 180, "index_chain": 13, "chain_name": "Q", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/17", "linked_nts": [ "///Q/17", "///Q/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -66.493, "beta": 176.907, "gamma": 50.844, "delta": 83.135, "epsilon": -137.032, "zeta": 141.402, "epsilon_zeta": 81.566, "bb_type": "--", "chi": -151.710, "glyco_bond": "anti", "C5prime_xyz": [ -1.451, 8.879, 0.109 ], "P_xyz": [ 1.138, 9.205, 0.352 ], "form": ".", "ssZp": 4.064, "Dp": 4.613, "splay_angle": 150.760, "splay_distance": 16.546, "splay_ratio": 0.968, "d22": 12.363, "d64": 13.667, "eta": 172.753, "theta": 107.262, "eta_prime": -174.349, "theta_prime": 91.172, "eta_base": -126.136, "theta_base": -81.540, "v0": 2.028, "v1": -25.110, "v2": 37.321, "v3": -36.965, "v4": 22.085, "amplitude": 38.735, "phase_angle": 15.527, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.952, "filter_rmsd": 0.067, "frame": { "rmsd": 0.005, "origin": [ 8.691, -9.707, 46.449 ], "x_axis": [ 0.033, -0.446, 0.895 ], "y_axis": [ 0.631, 0.703, 0.327 ], "z_axis": [ -0.775, 0.554, 0.305 ], "quaternion": [ 0.714, -0.080, -0.584, -0.377 ] } }, { "index": 181, "index_chain": 14, "chain_name": "Q", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/17", "linked_nts": [ "///Q/17", "///Q/17" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 78.227, "beta": -136.605, "gamma": -36.393, "delta": 103.034, "epsilon": 50.114, "zeta": 76.557, "epsilon_zeta": -26.443, "bb_type": "--", "chi": 130.061, "glyco_bond": "--", "C5prime_xyz": [ -1.743, 5.568, 3.210 ], "P_xyz": [ -1.826, 4.688, 5.694 ], "form": ".", "ssZp": 2.586, "Dp": 3.300, "splay_angle": 57.191, "splay_distance": 8.968, "splay_ratio": 0.479, "d22": 7.364, "d64": 8.477, "eta": -24.840, "theta": -179.297, "eta_prime": -30.774, "theta_prime": -168.418, "eta_base": 140.342, "theta_base": -174.550, "v0": 38.081, "v1": -43.719, "v2": 33.548, "v3": -12.200, "v4": -16.134, "amplitude": 43.606, "phase_angle": 320.295, "puckering": "C1'-endo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.115, "frame": { "rmsd": 0.020, "origin": [ 10.268, 5.629, 52.457 ], "x_axis": [ -0.950, 0.300, -0.083 ], "y_axis": [ 0.073, -0.044, -0.996 ], "z_axis": [ -0.303, -0.953, 0.020 ], "quaternion": [ 0.080, -0.136, -0.687, 0.710 ] } }, { "index": 182, "index_chain": 15, "chain_name": "Q", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/17", "linked_nts": [ "///Q/17", "///Q/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -172.210, "beta": -177.657, "gamma": 79.908, "delta": 77.242, "epsilon": -135.427, "zeta": -68.506, "epsilon_zeta": -66.921, "bb_type": "BI", "chi": -156.054, "glyco_bond": "anti", "C5prime_xyz": [ -1.609, 8.932, 0.308 ], "P_xyz": [ 0.866, 9.586, -0.086 ], "form": ".", "ssZp": 4.200, "Dp": 4.667, "splay_angle": 28.195, "splay_distance": 4.666, "splay_ratio": 0.244, "d22": 4.059, "d64": 4.330, "eta": 165.661, "theta": -134.492, "eta_prime": 173.038, "theta_prime": -132.460, "eta_base": 161.030, "theta_base": -97.436, "v0": 0.051, "v1": -25.397, "v2": 39.434, "v3": -40.613, "v4": 25.766, "amplitude": 41.616, "phase_angle": 18.637, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ 18.650, 8.759, 51.843 ], "x_axis": [ -0.627, -0.333, 0.704 ], "y_axis": [ -0.238, -0.778, -0.581 ], "z_axis": [ 0.741, -0.532, 0.409 ], "quaternion": [ -0.028, 0.431, -0.332, 0.839 ] } }, { "index": 183, "index_chain": 16, "chain_name": "Q", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/17", "linked_nts": [ "///Q/17", "///Q/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -65.804, "beta": 166.082, "gamma": 58.325, "delta": 73.836, "epsilon": -148.936, "zeta": -94.705, "epsilon_zeta": -54.231, "bb_type": "BI", "chi": -154.095, "glyco_bond": "anti", "C5prime_xyz": [ -1.794, 8.966, 0.143 ], "P_xyz": [ 0.649, 9.697, -0.428 ], "form": ".", "ssZp": 4.257, "Dp": 4.694, "splay_angle": 147.414, "splay_distance": 17.654, "splay_ratio": 0.960, "d22": null, "d64": null, "eta": 162.254, "theta": 178.230, "eta_prime": -177.912, "theta_prime": 165.544, "eta_base": -125.447, "theta_base": 161.784, "v0": -0.846, "v1": -28.336, "v2": 44.924, "v3": -46.815, "v4": 29.774, "amplitude": 47.672, "phase_angle": 19.551, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.766, "filter_rmsd": 0.060, "frame": { "rmsd": 0.008, "origin": [ 19.298, 5.811, 55.401 ], "x_axis": [ -0.753, -0.651, 0.094 ], "y_axis": [ 0.298, -0.464, -0.834 ], "z_axis": [ 0.587, -0.600, 0.543 ], "quaternion": [ -0.286, 0.205, -0.432, 0.831 ] } }, { "index": 184, "index_chain": 17, "chain_name": "Q", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/17", "linked_nts": [ "///Q/17", "///Q/18" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart", "alpha": -55.176, "beta": -140.076, "gamma": 168.729, "delta": 88.050, "epsilon": -142.002, "zeta": -74.791, "epsilon_zeta": -67.210, "bb_type": "BI", "chi": -174.268, "glyco_bond": "anti", "C5prime_xyz": [ -1.072, 8.256, 1.407 ], "P_xyz": [ 0.652, 9.408, -0.206 ], "form": "A", "ssZp": 4.762, "Dp": 4.761, "splay_angle": 25.651, "splay_distance": 3.998, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": -22.313, "theta": -154.491, "eta_prime": -22.507, "theta_prime": -156.363, "eta_base": -29.879, "theta_base": -135.186, "v0": 17.097, "v1": -36.986, "v2": 41.465, "v3": -32.590, "v4": 9.810, "amplitude": 41.638, "phase_angle": 354.770, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 34.769, -1.255, 50.669 ], "x_axis": [ -0.168, -0.162, -0.972 ], "y_axis": [ -0.952, 0.284, 0.117 ], "z_axis": [ 0.257, 0.945, -0.202 ], "quaternion": [ 0.478, -0.433, 0.643, 0.413 ] } }, { "index": 185, "index_chain": 18, "chain_name": "Q", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/18", "linked_nts": [ "///Q/17", "///Q/19" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.072, "beta": 173.080, "gamma": 48.367, "delta": 84.425, "epsilon": -151.455, "zeta": -62.988, "epsilon_zeta": -88.468, "bb_type": "BI", "chi": -164.816, "glyco_bond": "anti", "C5prime_xyz": [ -1.434, 8.665, 0.916 ], "P_xyz": [ 1.091, 9.063, 1.401 ], "form": "A", "ssZp": 4.487, "Dp": 4.575, "splay_angle": 24.374, "splay_distance": 3.910, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 175.892, "theta": -138.509, "eta_prime": -168.572, "theta_prime": -139.104, "eta_base": -132.108, "theta_base": -112.265, "v0": 9.347, "v1": -30.124, "v2": 38.170, "v3": -33.966, "v4": 15.544, "amplitude": 38.309, "phase_angle": 4.884, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.805, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 37.320, 1.144, 48.740 ], "x_axis": [ -0.674, -0.041, -0.737 ], "y_axis": [ -0.703, 0.339, 0.625 ], "z_axis": [ 0.224, 0.940, -0.257 ], "quaternion": [ 0.319, -0.247, 0.753, 0.519 ] } }, { "index": 186, "index_chain": 19, "chain_name": "Q", "nt_resnum": 19, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/19", "linked_nts": [ "///Q/18", "///Q/20" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -81.054, "beta": -174.680, "gamma": 48.048, "delta": 78.991, "epsilon": -161.689, "zeta": -60.670, "epsilon_zeta": -101.019, "bb_type": "BI", "chi": -162.877, "glyco_bond": "anti", "C5prime_xyz": [ -1.351, 8.713, 0.727 ], "P_xyz": [ 1.126, 9.298, 1.225 ], "form": "A", "ssZp": 4.523, "Dp": 4.619, "splay_angle": 18.221, "splay_distance": 3.016, "splay_ratio": 0.166, "d22": null, "d64": null, "eta": 158.217, "theta": -150.049, "eta_prime": 171.178, "theta_prime": -148.510, "eta_base": -145.422, "theta_base": -125.984, "v0": 5.318, "v1": -30.598, "v2": 42.365, "v3": -40.695, "v4": 22.501, "amplitude": 43.282, "phase_angle": 11.817, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.715, "filter_rmsd": 0.110, "frame": { "rmsd": 0.011, "origin": [ 38.285, 3.934, 46.176 ], "x_axis": [ -0.987, -0.080, -0.141 ], "y_axis": [ -0.158, 0.306, 0.939 ], "z_axis": [ -0.032, 0.949, -0.314 ], "quaternion": [ 0.034, -0.074, 0.807, 0.584 ] } }, { "index": 187, "index_chain": 20, "chain_name": "Q", "nt_resnum": 20, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/20", "linked_nts": [ "///Q/19", "///Q/21" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -80.529, "beta": 170.002, "gamma": 67.089, "delta": 79.061, "epsilon": -145.961, "zeta": -79.651, "epsilon_zeta": -66.310, "bb_type": "BI", "chi": -164.013, "glyco_bond": "anti", "C5prime_xyz": [ -1.596, 8.771, 0.765 ], "P_xyz": [ 0.922, 9.487, 0.538 ], "form": "A", "ssZp": 4.523, "Dp": 4.685, "splay_angle": 21.544, "splay_distance": 3.447, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 166.933, "theta": -152.269, "eta_prime": -178.702, "theta_prime": -153.423, "eta_base": -141.939, "theta_base": -128.830, "v0": 5.149, "v1": -29.833, "v2": 41.620, "v3": -39.782, "v4": 22.018, "amplitude": 42.523, "phase_angle": 11.825, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.536, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 37.789, 5.529, 43.665 ], "x_axis": [ -0.947, 0.054, 0.317 ], "y_axis": [ 0.304, 0.472, 0.827 ], "z_axis": [ -0.105, 0.880, -0.464 ], "quaternion": [ -0.124, 0.105, 0.849, 0.503 ] } }, { "index": 188, "index_chain": 21, "chain_name": "Q", "nt_resnum": 21, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/21", "linked_nts": [ "///Q/20", "///Q/22" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.619, "beta": 162.391, "gamma": 57.186, "delta": 77.357, "epsilon": -157.563, "zeta": -62.480, "epsilon_zeta": -95.083, "bb_type": "BI", "chi": -162.916, "glyco_bond": "anti", "C5prime_xyz": [ -1.311, 8.810, 0.693 ], "P_xyz": [ 1.276, 9.290, 0.322 ], "form": "A", "ssZp": 4.580, "Dp": 4.691, "splay_angle": 23.439, "splay_distance": 3.736, "splay_ratio": 0.208, "d22": 4.113, "d64": 4.393, "eta": 162.987, "theta": -144.228, "eta_prime": 175.967, "theta_prime": -145.075, "eta_base": -142.760, "theta_base": -117.164, "v0": 6.589, "v1": -32.055, "v2": 43.677, "v3": -40.958, "v4": 21.768, "amplitude": 44.372, "phase_angle": 10.157, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.874, "filter_rmsd": 0.070, "frame": { "rmsd": 0.008, "origin": [ 36.281, 7.499, 41.272 ], "x_axis": [ -0.650, 0.262, 0.713 ], "y_axis": [ 0.725, 0.492, 0.481 ], "z_axis": [ -0.225, 0.830, -0.510 ], "quaternion": [ -0.288, 0.303, 0.814, 0.402 ] } }, { "index": 189, "index_chain": 22, "chain_name": "Q", "nt_resnum": 22, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/22", "linked_nts": [ "///Q/21", "///Q/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -70.023, "beta": 177.690, "gamma": 55.830, "delta": 76.730, "epsilon": -156.566, "zeta": -62.971, "epsilon_zeta": -93.595, "bb_type": "BI", "chi": -161.145, "glyco_bond": "anti", "C5prime_xyz": [ -1.357, 8.806, 0.641 ], "P_xyz": [ 1.216, 9.281, 0.763 ], "form": "A", "ssZp": 4.508, "Dp": 4.681, "splay_angle": 22.546, "splay_distance": 3.660, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 170.109, "theta": -147.916, "eta_prime": -175.660, "theta_prime": -147.189, "eta_base": -130.421, "theta_base": -128.491, "v0": 6.174, "v1": -32.641, "v2": 44.600, "v3": -42.448, "v4": 23.123, "amplitude": 45.439, "phase_angle": 11.030, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.848, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 33.460, 9.705, 40.210 ], "x_axis": [ -0.100, 0.428, 0.898 ], "y_axis": [ 0.939, 0.338, -0.056 ], "z_axis": [ -0.328, 0.838, -0.436 ], "quaternion": [ -0.448, 0.499, 0.685, 0.285 ] } }, { "index": 190, "index_chain": 23, "chain_name": "Q", "nt_resnum": 23, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/23", "linked_nts": [ "///Q/22", "///Q/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet", "alpha": -82.281, "beta": 172.604, "gamma": 74.069, "delta": 78.298, "epsilon": -148.478, "zeta": -79.708, "epsilon_zeta": -68.770, "bb_type": "BI", "chi": -166.686, "glyco_bond": "anti", "C5prime_xyz": [ -1.723, 8.696, 0.868 ], "P_xyz": [ 0.724, 9.491, 0.689 ], "form": "A", "ssZp": 4.533, "Dp": 4.662, "splay_angle": 22.907, "splay_distance": 3.570, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 169.922, "theta": -150.990, "eta_prime": -175.349, "theta_prime": -150.439, "eta_base": -141.142, "theta_base": -118.154, "v0": 3.110, "v1": -31.736, "v2": 45.585, "v3": -44.872, "v4": 26.658, "amplitude": 47.117, "phase_angle": 14.653, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.296, "filter_rmsd": 0.034, "frame": { "rmsd": 0.008, "origin": [ 30.679, 12.018, 39.653 ], "x_axis": [ 0.339, 0.469, 0.816 ], "y_axis": [ 0.862, 0.192, -0.469 ], "z_axis": [ -0.377, 0.862, -0.339 ], "quaternion": [ 0.546, -0.609, -0.546, -0.180 ] } }, { "index": 191, "index_chain": 24, "chain_name": "Q", "nt_resnum": 24, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/24", "linked_nts": [ "///Q/23", "///Q/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate", "alpha": -51.883, "beta": 160.672, "gamma": 49.934, "delta": 79.155, "epsilon": -154.696, "zeta": -64.224, "epsilon_zeta": -90.472, "bb_type": "BI", "chi": -162.998, "glyco_bond": "anti", "C5prime_xyz": [ -1.690, 8.642, 0.777 ], "P_xyz": [ 0.877, 9.070, 0.892 ], "form": "A", "ssZp": 4.405, "Dp": 4.568, "splay_angle": 23.860, "splay_distance": 3.756, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 169.011, "theta": -142.201, "eta_prime": -175.338, "theta_prime": -142.670, "eta_base": -126.521, "theta_base": -111.032, "v0": 8.359, "v1": -33.375, "v2": 44.233, "v3": -41.087, "v4": 20.630, "amplitude": 44.707, "phase_angle": 8.351, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.772, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 28.889, 15.053, 40.231 ], "x_axis": [ 0.772, 0.494, 0.400 ], "y_axis": [ 0.488, -0.059, -0.871 ], "z_axis": [ -0.407, 0.867, -0.287 ], "quaternion": [ 0.597, -0.728, -0.338, 0.002 ] } }, { "index": 192, "index_chain": 25, "chain_name": "Q", "nt_resnum": 25, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/25", "linked_nts": [ "///Q/24", "///Q/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -78.902, "beta": 178.836, "gamma": 64.499, "delta": 75.027, "epsilon": -147.581, "zeta": -76.918, "epsilon_zeta": -70.664, "bb_type": "BI", "chi": -162.661, "glyco_bond": "anti", "C5prime_xyz": [ -1.443, 8.730, 0.652 ], "P_xyz": [ 1.130, 9.183, 0.684 ], "form": "A", "ssZp": 4.458, "Dp": 4.707, "splay_angle": 21.375, "splay_distance": 3.304, "splay_ratio": 0.186, "d22": 4.335, "d64": 4.051, "eta": 168.289, "theta": -152.268, "eta_prime": -177.984, "theta_prime": -150.026, "eta_base": -129.184, "theta_base": -123.832, "v0": 6.616, "v1": -32.705, "v2": 45.446, "v3": -42.290, "v4": 22.789, "amplitude": 46.211, "phase_angle": 10.434, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.647, "filter_rmsd": 0.112, "frame": { "rmsd": 0.011, "origin": [ 28.208, 18.671, 40.970 ], "x_axis": [ 0.925, 0.318, -0.209 ], "y_axis": [ -0.113, -0.296, -0.949 ], "z_axis": [ -0.363, 0.901, -0.238 ], "quaternion": [ 0.590, -0.784, -0.066, 0.183 ] } }, { "index": 193, "index_chain": 26, "chain_name": "Q", "nt_resnum": 26, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/26", "linked_nts": [ "///Q/25", "///Q/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop", "alpha": -59.247, "beta": 168.845, "gamma": 54.791, "delta": 83.844, "epsilon": -133.807, "zeta": -66.635, "epsilon_zeta": -67.171, "bb_type": "BI", "chi": -156.022, "glyco_bond": "anti", "C5prime_xyz": [ -1.186, 8.702, 0.302 ], "P_xyz": [ 1.409, 8.901, 0.311 ], "form": ".", "ssZp": 4.123, "Dp": 4.636, "splay_angle": 29.907, "splay_distance": 4.715, "splay_ratio": 0.258, "d22": null, "d64": null, "eta": 176.991, "theta": -121.522, "eta_prime": -173.343, "theta_prime": -116.390, "eta_base": -138.451, "theta_base": -66.611, "v0": 5.731, "v1": -28.398, "v2": 39.103, "v3": -36.758, "v4": 19.641, "amplitude": 39.767, "phase_angle": 10.484, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.849, "filter_rmsd": 0.107, "frame": { "rmsd": 0.009, "origin": [ 28.006, 21.961, 41.199 ], "x_axis": [ 0.748, 0.007, -0.663 ], "y_axis": [ -0.635, -0.281, -0.719 ], "z_axis": [ -0.191, 0.960, -0.206 ], "quaternion": [ 0.562, -0.748, 0.210, 0.286 ] } }, { "index": 194, "index_chain": 27, "chain_name": "Q", "nt_resnum": 27, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/27", "linked_nts": [ "///Q/26", "///Q/28" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart", "alpha": -60.858, "beta": 165.698, "gamma": 52.778, "delta": 83.214, "epsilon": -132.215, "zeta": 149.669, "epsilon_zeta": 78.115, "bb_type": "BII", "chi": -140.968, "glyco_bond": "anti", "C5prime_xyz": [ -1.618, 8.732, -0.604 ], "P_xyz": [ 0.870, 8.900, -1.328 ], "form": ".", "ssZp": 3.624, "Dp": 4.794, "splay_angle": 130.672, "splay_distance": 16.213, "splay_ratio": 0.909, "d22": null, "d64": null, "eta": 166.381, "theta": 74.224, "eta_prime": -168.018, "theta_prime": 99.127, "eta_base": -101.858, "theta_base": 141.125, "v0": 5.990, "v1": -30.437, "v2": 41.046, "v3": -38.678, "v4": 20.934, "amplitude": 41.732, "phase_angle": 10.400, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.849, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 29.352, 23.928, 37.131 ], "x_axis": [ -0.008, -0.249, -0.968 ], "y_axis": [ -0.990, 0.141, -0.028 ], "z_axis": [ 0.144, 0.958, -0.248 ], "quaternion": [ 0.470, -0.524, 0.591, 0.393 ] } }, { "index": 195, "index_chain": 28, "chain_name": "Q", "nt_resnum": 28, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/28", "linked_nts": [ "///Q/27", "///Q/29" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,cap-acceptor,splayed-apart", "alpha": -71.610, "beta": -139.225, "gamma": 60.133, "delta": 152.465, "epsilon": -95.768, "zeta": 124.717, "epsilon_zeta": 139.515, "bb_type": "--", "chi": -74.099, "glyco_bond": "--", "C5prime_xyz": [ -1.841, 6.854, -2.949 ], "P_xyz": [ 0.477, 7.929, -2.354 ], "form": ".", "ssZp": -1.226, "Dp": 1.335, "splay_angle": 43.884, "splay_distance": 7.280, "splay_ratio": 0.378, "d22": null, "d64": null, "eta": -102.197, "theta": 167.826, "eta_prime": -105.947, "theta_prime": 148.572, "eta_base": -177.048, "theta_base": -175.249, "v0": 4.922, "v1": 17.533, "v2": -33.082, "v3": 35.109, "v4": -25.593, "amplitude": 36.586, "phase_angle": 205.283, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.233, "filter_rmsd": 0.047, "frame": { "rmsd": 0.017, "origin": [ 19.103, 35.043, 42.983 ], "x_axis": [ 0.962, 0.039, 0.270 ], "y_axis": [ 0.253, -0.500, -0.828 ], "z_axis": [ 0.103, 0.865, -0.491 ], "quaternion": [ -0.493, 0.859, 0.085, 0.108 ] } }, { "index": 196, "index_chain": 29, "chain_name": "Q", "nt_resnum": 29, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/29", "linked_nts": [ "///Q/28", "///Q/30" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,junction-loop,A-minor,ribose-zipper,phosphate", "alpha": 159.488, "beta": -130.772, "gamma": 70.176, "delta": 78.984, "epsilon": -138.352, "zeta": -122.908, "epsilon_zeta": -15.443, "bb_type": "--", "chi": -171.991, "glyco_bond": "anti", "C5prime_xyz": [ -1.416, 8.707, 1.122 ], "P_xyz": [ 0.930, 8.694, 2.174 ], "form": "A", "ssZp": 4.719, "Dp": 4.777, "splay_angle": 19.889, "splay_distance": 3.154, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 138.000, "theta": -148.864, "eta_prime": 120.130, "theta_prime": -151.460, "eta_base": 158.290, "theta_base": -139.538, "v0": -3.494, "v1": -25.181, "v2": 41.968, "v3": -44.897, "v4": 31.011, "amplitude": 45.516, "phase_angle": 22.772, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.075, "frame": { "rmsd": 0.017, "origin": [ 12.575, 36.426, 40.070 ], "x_axis": [ 0.959, 0.092, 0.269 ], "y_axis": [ 0.193, -0.904, -0.381 ], "z_axis": [ 0.208, 0.417, -0.885 ], "quaternion": [ -0.206, 0.968, 0.074, 0.123 ] } }, { "index": 197, "index_chain": 30, "chain_name": "Q", "nt_resnum": 30, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/30", "linked_nts": [ "///Q/29", "///Q/31" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper,phosphate", "alpha": 114.461, "beta": -120.678, "gamma": 178.843, "delta": 92.030, "epsilon": -137.970, "zeta": -72.283, "epsilon_zeta": -65.687, "bb_type": "BI", "chi": 175.578, "glyco_bond": "anti", "C5prime_xyz": [ -0.991, 7.991, 1.866 ], "P_xyz": [ 0.718, 9.230, 0.191 ], "form": "A", "ssZp": 4.630, "Dp": 4.690, "splay_angle": 25.890, "splay_distance": 3.912, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": 160.747, "theta": -146.823, "eta_prime": 179.447, "theta_prime": -155.046, "eta_base": -149.110, "theta_base": -134.963, "v0": 12.827, "v1": -31.517, "v2": 38.110, "v3": -31.613, "v4": 11.977, "amplitude": 38.111, "phase_angle": 359.632, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ 12.303, 39.044, 38.333 ], "x_axis": [ 0.992, -0.122, 0.013 ], "y_axis": [ -0.088, -0.782, -0.617 ], "z_axis": [ 0.085, 0.611, -0.787 ], "quaternion": [ -0.326, 0.944, -0.056, 0.026 ] } }, { "index": 198, "index_chain": 31, "chain_name": "Q", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/31", "linked_nts": [ "///Q/30", "///Q/32" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,A-minor", "alpha": -86.582, "beta": -166.763, "gamma": 60.660, "delta": 84.482, "epsilon": -140.883, "zeta": -65.642, "epsilon_zeta": -75.242, "bb_type": "BI", "chi": -168.226, "glyco_bond": "anti", "C5prime_xyz": [ -1.265, 8.471, 1.026 ], "P_xyz": [ 1.249, 8.735, 1.521 ], "form": ".", "ssZp": 4.569, "Dp": 4.696, "splay_angle": 30.840, "splay_distance": 4.701, "splay_ratio": 0.268, "d22": null, "d64": null, "eta": 165.542, "theta": -127.948, "eta_prime": 177.570, "theta_prime": -122.743, "eta_base": -145.336, "theta_base": -76.665, "v0": 11.798, "v1": -34.677, "v2": 42.485, "v3": -37.280, "v4": 16.322, "amplitude": 42.548, "phase_angle": 3.120, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.418, "filter_rmsd": 0.041, "frame": { "rmsd": 0.015, "origin": [ 13.378, 42.572, 37.028 ], "x_axis": [ 0.728, -0.627, -0.277 ], "y_axis": [ -0.667, -0.554, -0.499 ], "z_axis": [ 0.159, 0.548, -0.821 ], "quaternion": [ -0.297, 0.881, -0.367, -0.034 ] } }, { "index": 199, "index_chain": 32, "chain_name": "Q", "nt_resnum": 32, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/32", "linked_nts": [ "///Q/31", "///Q/33" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -57.526, "beta": 171.928, "gamma": 46.875, "delta": 83.998, "epsilon": -136.544, "zeta": -93.496, "epsilon_zeta": -43.047, "bb_type": "BI", "chi": -161.300, "glyco_bond": "anti", "C5prime_xyz": [ -1.269, 8.717, 0.604 ], "P_xyz": [ 1.345, 8.926, 0.809 ], "form": "A", "ssZp": 4.453, "Dp": 4.723, "splay_angle": 18.834, "splay_distance": 2.939, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": 169.507, "theta": -153.178, "eta_prime": -167.893, "theta_prime": -148.517, "eta_base": -102.524, "theta_base": -132.789, "v0": 9.637, "v1": -32.598, "v2": 42.131, "v3": -37.126, "v4": 17.687, "amplitude": 42.329, "phase_angle": 5.540, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.856, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 16.267, 42.039, 33.357 ], "x_axis": [ -0.108, -0.839, -0.533 ], "y_axis": [ -0.969, 0.210, -0.134 ], "z_axis": [ 0.224, 0.501, -0.836 ], "quaternion": [ 0.258, -0.616, 0.734, 0.125 ] } }, { "index": 200, "index_chain": 33, "chain_name": "Q", "nt_resnum": 33, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/33", "linked_nts": [ "///Q/32", "///Q/34" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -64.266, "beta": 154.451, "gamma": 64.736, "delta": 90.842, "epsilon": -146.246, "zeta": -95.742, "epsilon_zeta": -50.505, "bb_type": "BI", "chi": -146.724, "glyco_bond": "anti", "C5prime_xyz": [ -1.797, 8.746, -0.213 ], "P_xyz": [ 0.598, 8.887, -1.136 ], "form": ".", "ssZp": 3.995, "Dp": 4.505, "splay_angle": 51.999, "splay_distance": 8.475, "splay_ratio": 0.439, "d22": null, "d64": null, "eta": 173.694, "theta": -161.667, "eta_prime": -171.681, "theta_prime": -153.461, "eta_base": -146.779, "theta_base": -158.580, "v0": 0.255, "v1": -22.302, "v2": 33.956, "v3": -35.230, "v4": 22.163, "amplitude": 35.793, "phase_angle": 18.435, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.413, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 17.878, 43.125, 31.152 ], "x_axis": [ -0.425, -0.672, -0.606 ], "y_axis": [ -0.746, 0.639, -0.185 ], "z_axis": [ 0.512, 0.373, -0.774 ], "quaternion": [ 0.332, -0.421, 0.842, 0.056 ] } }, { "index": 201, "index_chain": 34, "chain_name": "Q", "nt_resnum": 34, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/34", "linked_nts": [ "///Q/33", "///Q/35" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -58.138, "beta": -146.708, "gamma": 53.265, "delta": 144.615, "epsilon": -92.689, "zeta": -157.893, "epsilon_zeta": 65.204, "bb_type": "BII", "chi": -87.320, "glyco_bond": "anti", "C5prime_xyz": [ -2.971, 7.755, -2.415 ], "P_xyz": [ -0.940, 9.463, -2.375 ], "form": ".", "ssZp": 0.771, "Dp": 0.792, "splay_angle": 124.851, "splay_distance": 16.800, "splay_ratio": 0.887, "d22": null, "d64": null, "eta": -132.878, "theta": -117.777, "eta_prime": -131.724, "theta_prime": -155.346, "eta_base": -149.104, "theta_base": 155.240, "v0": -23.526, "v1": 38.090, "v2": -37.776, "v3": 25.252, "v4": -1.219, "amplitude": 39.465, "phase_angle": 163.181, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.520, "filter_rmsd": 0.108, "frame": { "rmsd": 0.010, "origin": [ 23.489, 47.177, 26.261 ], "x_axis": [ -0.427, -0.795, -0.432 ], "y_axis": [ -0.868, 0.494, -0.053 ], "z_axis": [ 0.256, 0.352, -0.900 ], "quaternion": [ 0.205, -0.495, 0.840, 0.089 ] } }, { "index": 202, "index_chain": 35, "chain_name": "Q", "nt_resnum": 35, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/35", "linked_nts": [ "///Q/34", "///Q/36" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart", "alpha": 58.384, "beta": 172.129, "gamma": 52.418, "delta": 82.616, "epsilon": -156.804, "zeta": -71.579, "epsilon_zeta": -85.226, "bb_type": "BI", "chi": -173.050, "glyco_bond": "anti", "C5prime_xyz": [ -1.460, 8.479, 1.307 ], "P_xyz": [ 1.095, 8.530, 1.776 ], "form": "A", "ssZp": 4.678, "Dp": 4.674, "splay_angle": 24.145, "splay_distance": 3.697, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": -50.523, "theta": -141.360, "eta_prime": -25.630, "theta_prime": -140.407, "eta_base": 31.514, "theta_base": -115.431, "v0": 5.178, "v1": -29.335, "v2": 39.555, "v3": -38.314, "v4": 21.106, "amplitude": 40.375, "phase_angle": 11.563, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4d", "suiteness": 0.348, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 23.360, 63.477, 30.328 ], "x_axis": [ -0.523, -0.150, 0.839 ], "y_axis": [ -0.562, -0.680, -0.471 ], "z_axis": [ 0.641, -0.718, 0.271 ], "quaternion": [ 0.131, 0.471, -0.378, 0.786 ] } }, { "index": 203, "index_chain": 36, "chain_name": "Q", "nt_resnum": 36, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/36", "linked_nts": [ "///Q/35", "///Q/37" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -88.891, "beta": -170.965, "gamma": 63.119, "delta": 80.550, "epsilon": -153.098, "zeta": -69.167, "epsilon_zeta": -83.931, "bb_type": "BI", "chi": -168.459, "glyco_bond": "anti", "C5prime_xyz": [ -1.498, 8.656, 1.030 ], "P_xyz": [ 1.095, 8.843, 1.401 ], "form": "A", "ssZp": 4.643, "Dp": 4.665, "splay_angle": 23.836, "splay_distance": 3.867, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 165.133, "theta": -145.000, "eta_prime": 176.642, "theta_prime": -148.116, "eta_base": -141.824, "theta_base": -134.747, "v0": 0.622, "v1": -25.390, "v2": 38.891, "v3": -39.683, "v4": 24.700, "amplitude": 40.841, "phase_angle": 17.774, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.465, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 25.869, 62.153, 32.699 ], "x_axis": [ -0.828, -0.434, 0.355 ], "y_axis": [ -0.125, -0.475, -0.871 ], "z_axis": [ 0.547, -0.765, 0.339 ], "quaternion": [ -0.095, 0.277, -0.503, 0.813 ] } }, { "index": 204, "index_chain": 37, "chain_name": "Q", "nt_resnum": 37, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/37", "linked_nts": [ "///Q/36", "///Q/38" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -73.769, "beta": -178.722, "gamma": 54.636, "delta": 75.533, "epsilon": -154.338, "zeta": -59.846, "epsilon_zeta": -94.492, "bb_type": "BI", "chi": -170.026, "glyco_bond": "anti", "C5prime_xyz": [ -1.445, 8.632, 1.032 ], "P_xyz": [ 0.997, 9.419, 1.299 ], "form": "A", "ssZp": 4.766, "Dp": 4.805, "splay_angle": 25.969, "splay_distance": 4.146, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": 166.460, "theta": -145.604, "eta_prime": 174.422, "theta_prime": -141.752, "eta_base": -155.908, "theta_base": -109.029, "v0": 5.334, "v1": -33.004, "v2": 45.176, "v3": -44.422, "v4": 24.937, "amplitude": 46.287, "phase_angle": 12.578, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.858, "filter_rmsd": 0.025, "frame": { "rmsd": 0.025, "origin": [ 27.720, 60.806, 35.815 ], "x_axis": [ -0.856, -0.508, -0.101 ], "y_axis": [ 0.269, -0.269, -0.925 ], "z_axis": [ 0.442, -0.819, 0.366 ], "quaternion": [ -0.246, 0.108, -0.552, 0.789 ] } }, { "index": 205, "index_chain": 38, "chain_name": "Q", "nt_resnum": 38, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/38", "linked_nts": [ "///Q/37", "///Q/39" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -62.899, "beta": 172.902, "gamma": 50.528, "delta": 76.692, "epsilon": -155.416, "zeta": -66.939, "epsilon_zeta": -88.477, "bb_type": "BI", "chi": -167.904, "glyco_bond": "anti", "C5prime_xyz": [ -1.634, 8.704, 0.989 ], "P_xyz": [ 0.858, 9.310, 1.479 ], "form": "A", "ssZp": 4.560, "Dp": 4.636, "splay_angle": 24.973, "splay_distance": 3.850, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 170.802, "theta": -147.114, "eta_prime": -172.325, "theta_prime": -143.318, "eta_base": -123.697, "theta_base": -106.397, "v0": 2.913, "v1": -27.872, "v2": 40.729, "v3": -40.452, "v4": 23.889, "amplitude": 42.163, "phase_angle": 14.987, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.808, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 26.852, 57.545, 38.223 ], "x_axis": [ -0.559, -0.466, -0.686 ], "y_axis": [ 0.747, 0.077, -0.661 ], "z_axis": [ 0.361, -0.881, 0.305 ], "quaternion": [ -0.454, -0.122, -0.577, 0.668 ] } }, { "index": 206, "index_chain": 39, "chain_name": "Q", "nt_resnum": 39, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/39", "linked_nts": [ "///Q/38", "///Q/40" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -82.380, "beta": -178.472, "gamma": 63.834, "delta": 78.512, "epsilon": -150.411, "zeta": -64.985, "epsilon_zeta": -85.426, "bb_type": "BI", "chi": -164.487, "glyco_bond": "anti", "C5prime_xyz": [ -1.542, 8.680, 0.774 ], "P_xyz": [ 1.090, 8.942, 0.899 ], "form": "A", "ssZp": 4.463, "Dp": 4.640, "splay_angle": 20.546, "splay_distance": 3.235, "splay_ratio": 0.180, "d22": 4.004, "d64": 3.693, "eta": 167.536, "theta": -135.393, "eta_prime": -177.767, "theta_prime": -134.739, "eta_base": -126.822, "theta_base": -88.644, "v0": 7.101, "v1": -33.335, "v2": 45.677, "v3": -42.382, "v4": 22.484, "amplitude": 46.362, "phase_angle": 9.859, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.617, "filter_rmsd": 0.115, "frame": { "rmsd": 0.014, "origin": [ 26.481, 53.758, 38.811 ], "x_axis": [ 0.022, -0.250, -0.968 ], "y_axis": [ 0.945, 0.321, -0.062 ], "z_axis": [ 0.326, -0.913, 0.243 ], "quaternion": [ 0.630, 0.338, 0.514, -0.474 ] } }, { "index": 207, "index_chain": 40, "chain_name": "Q", "nt_resnum": 40, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/40", "linked_nts": [ "///Q/39", "///Q/41" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -62.523, "beta": 172.817, "gamma": 49.885, "delta": 77.720, "epsilon": -170.483, "zeta": -74.572, "epsilon_zeta": -95.910, "bb_type": "BI", "chi": -147.244, "glyco_bond": "anti", "C5prime_xyz": [ -1.276, 8.821, -0.248 ], "P_xyz": [ 1.367, 9.103, -0.411 ], "form": ".", "ssZp": 4.001, "Dp": 4.481, "splay_angle": 130.656, "splay_distance": 16.512, "splay_ratio": 0.909, "d22": 9.721, "d64": 12.941, "eta": 164.881, "theta": -156.851, "eta_prime": -175.060, "theta_prime": 161.700, "eta_base": -108.461, "theta_base": 131.029, "v0": 7.646, "v1": -33.871, "v2": 46.575, "v3": -42.342, "v4": 22.007, "amplitude": 47.162, "phase_angle": 9.050, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.924, "filter_rmsd": 0.110, "frame": { "rmsd": 0.012, "origin": [ 26.893, 51.002, 37.167 ], "x_axis": [ 0.682, -0.003, -0.731 ], "y_axis": [ 0.725, 0.133, 0.676 ], "z_axis": [ 0.096, -0.991, 0.093 ], "quaternion": [ 0.691, 0.603, 0.299, -0.264 ] } }, { "index": 208, "index_chain": 41, "chain_name": "Q", "nt_resnum": 41, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/41", "linked_nts": [ "///Q/40", "///Q/42" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -172.264, "beta": 156.806, "gamma": 26.996, "delta": 151.191, "epsilon": -71.488, "zeta": -98.935, "epsilon_zeta": 27.447, "bb_type": "--", "chi": -116.023, "glyco_bond": "anti", "C5prime_xyz": [ -1.562, 8.417, -1.349 ], "P_xyz": [ 0.733, 9.151, -0.377 ], "form": ".", "ssZp": -0.258, "Dp": 0.260, "splay_angle": 158.080, "splay_distance": 19.295, "splay_ratio": 0.982, "d22": null, "d64": null, "eta": 50.469, "theta": -55.715, "eta_prime": 69.090, "theta_prime": -86.523, "eta_base": 39.787, "theta_base": -48.587, "v0": -15.885, "v1": 33.565, "v2": -38.123, "v3": 29.731, "v4": -8.838, "amplitude": 38.287, "phase_angle": 174.702, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1z", "suiteness": 0.193, "filter_rmsd": 0.112, "frame": { "rmsd": 0.016, "origin": [ 28.163, 46.251, 52.929 ], "x_axis": [ 0.847, 0.430, 0.313 ], "y_axis": [ 0.248, 0.200, -0.948 ], "z_axis": [ -0.470, 0.880, 0.063 ], "quaternion": [ 0.726, -0.629, -0.270, 0.063 ] } }, { "index": 209, "index_chain": 42, "chain_name": "Q", "nt_resnum": 42, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/42", "linked_nts": [ "///Q/41", "///Q/43" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -47.245, "beta": -143.150, "gamma": 61.053, "delta": 139.460, "epsilon": -111.525, "zeta": 167.494, "epsilon_zeta": 80.982, "bb_type": "BII", "chi": -145.039, "glyco_bond": "anti", "C5prime_xyz": [ -2.151, 8.788, -0.152 ], "P_xyz": [ -0.523, 9.382, 1.790 ], "form": ".", "ssZp": 1.372, "Dp": 1.362, "splay_angle": 78.837, "splay_distance": 11.909, "splay_ratio": 0.636, "d22": null, "d64": null, "eta": -139.301, "theta": 168.126, "eta_prime": -93.256, "theta_prime": 172.288, "eta_base": -111.213, "theta_base": -155.233, "v0": -34.472, "v1": 43.349, "v2": -35.310, "v3": 16.257, "v4": 11.314, "amplitude": 42.515, "phase_angle": 146.154, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.168, "filter_rmsd": 0.043, "frame": { "rmsd": 0.011, "origin": [ 23.805, 47.661, 34.185 ], "x_axis": [ 0.973, 0.116, -0.198 ], "y_axis": [ 0.207, -0.069, 0.976 ], "z_axis": [ 0.100, -0.991, -0.091 ], "quaternion": [ 0.673, 0.730, 0.111, -0.034 ] } }, { "index": 210, "index_chain": 43, "chain_name": "Q", "nt_resnum": 43, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/43", "linked_nts": [ "///Q/42", "///Q/44" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,non-stack,canonical,helix-end,stem-end,hairpin-loop,A-minor,phosphate", "alpha": -75.398, "beta": 178.945, "gamma": 54.845, "delta": 84.830, "epsilon": -141.556, "zeta": -68.801, "epsilon_zeta": -72.755, "bb_type": "BI", "chi": -174.253, "glyco_bond": "anti", "C5prime_xyz": [ -1.446, 8.505, 1.251 ], "P_xyz": [ 1.164, 8.606, 1.692 ], "form": "A", "ssZp": 4.640, "Dp": 4.636, "splay_angle": 27.013, "splay_distance": 4.251, "splay_ratio": 0.238, "d22": 4.268, "d64": 4.631, "eta": -147.633, "theta": -133.408, "eta_prime": -160.356, "theta_prime": -132.522, "eta_base": -147.647, "theta_base": -103.439, "v0": 2.188, "v1": -25.320, "v2": 37.769, "v3": -37.392, "v4": 22.306, "amplitude": 39.190, "phase_angle": 15.478, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.714, "filter_rmsd": 0.118, "frame": { "rmsd": 0.018, "origin": [ 13.324, 42.627, 36.762 ], "x_axis": [ 0.662, -0.725, -0.193 ], "y_axis": [ 0.684, 0.478, 0.551 ], "z_axis": [ -0.307, -0.497, 0.812 ], "quaternion": [ 0.859, 0.305, -0.033, -0.410 ] } }, { "index": 211, "index_chain": 44, "chain_name": "Q", "nt_resnum": 44, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/44", "linked_nts": [ "///Q/43", "///Q/45" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,hairpin-loop,A-minor,ribose-zipper", "alpha": -81.457, "beta": -179.231, "gamma": 66.524, "delta": 80.160, "epsilon": -112.767, "zeta": -111.613, "epsilon_zeta": -1.154, "bb_type": "--", "chi": -167.619, "glyco_bond": "anti", "C5prime_xyz": [ -1.521, 8.620, 1.028 ], "P_xyz": [ 0.986, 9.233, 1.100 ], "form": "A", "ssZp": 4.518, "Dp": 4.820, "splay_angle": 21.877, "splay_distance": 3.416, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 172.563, "theta": -155.929, "eta_prime": -175.864, "theta_prime": -150.992, "eta_base": -131.866, "theta_base": -131.980, "v0": 10.190, "v1": -34.154, "v2": 43.275, "v3": -38.641, "v4": 18.195, "amplitude": 43.465, "phase_angle": 5.358, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.581, "filter_rmsd": 0.071, "frame": { "rmsd": 0.014, "origin": [ 12.536, 38.820, 38.481 ], "x_axis": [ 0.972, -0.211, 0.102 ], "y_axis": [ 0.119, 0.818, 0.562 ], "z_axis": [ -0.202, -0.535, 0.821 ], "quaternion": [ 0.950, 0.289, -0.080, -0.087 ] } }, { "index": 212, "index_chain": 45, "chain_name": "Q", "nt_resnum": 45, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/45", "linked_nts": [ "///Q/44", "///Q/46" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,junction-loop,A-minor,ribose-zipper", "alpha": -56.050, "beta": 105.934, "gamma": 92.309, "delta": 81.099, "epsilon": -140.354, "zeta": -79.913, "epsilon_zeta": -60.441, "bb_type": "BI", "chi": 174.615, "glyco_bond": "anti", "C5prime_xyz": [ -2.090, 8.491, 1.752 ], "P_xyz": [ 0.187, 9.068, 0.424 ], "form": "A", "ssZp": 4.465, "Dp": 4.582, "splay_angle": 25.301, "splay_distance": 3.856, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 160.591, "theta": -140.382, "eta_prime": -176.262, "theta_prime": -153.391, "eta_base": -142.802, "theta_base": -128.563, "v0": 1.170, "v1": -27.268, "v2": 41.504, "v3": -41.594, "v4": 25.625, "amplitude": 43.374, "phase_angle": 16.889, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.012, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 12.069, 36.022, 40.382 ], "x_axis": [ 0.970, 0.156, 0.189 ], "y_axis": [ -0.238, 0.779, 0.580 ], "z_axis": [ -0.057, -0.607, 0.792 ], "quaternion": [ 0.941, 0.315, -0.066, 0.105 ] } }, { "index": 213, "index_chain": 46, "chain_name": "Q", "nt_resnum": 46, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/46", "linked_nts": [ "///Q/45", "///Q/47" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,junction-loop", "alpha": -77.951, "beta": -175.190, "gamma": 52.913, "delta": 83.200, "epsilon": -138.422, "zeta": -73.857, "epsilon_zeta": -64.564, "bb_type": "BI", "chi": -168.199, "glyco_bond": "anti", "C5prime_xyz": [ -1.663, 8.458, 0.988 ], "P_xyz": [ 0.857, 8.811, 1.536 ], "form": ".", "ssZp": 4.537, "Dp": 4.687, "splay_angle": 28.767, "splay_distance": 4.331, "splay_ratio": 0.249, "d22": null, "d64": null, "eta": 165.191, "theta": -135.699, "eta_prime": 175.222, "theta_prime": -131.482, "eta_base": -140.191, "theta_base": -85.034, "v0": 9.513, "v1": -33.768, "v2": 44.118, "v3": -39.751, "v4": 19.301, "amplitude": 44.414, "phase_angle": 6.625, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.792, "filter_rmsd": 0.044, "frame": { "rmsd": 0.021, "origin": [ 12.898, 32.770, 42.283 ], "x_axis": [ 0.606, 0.631, 0.483 ], "y_axis": [ -0.791, 0.539, 0.288 ], "z_axis": [ -0.078, -0.557, 0.827 ], "quaternion": [ 0.862, 0.245, -0.163, 0.413 ] } }, { "index": 214, "index_chain": 47, "chain_name": "Q", "nt_resnum": 47, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/47", "linked_nts": [ "///Q/46", "///Q/48" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,junction-loop", "alpha": -58.870, "beta": 166.883, "gamma": 58.242, "delta": 87.386, "epsilon": -145.487, "zeta": -67.727, "epsilon_zeta": -77.760, "bb_type": "BI", "chi": -164.239, "glyco_bond": "anti", "C5prime_xyz": [ -1.159, 8.611, 0.820 ], "P_xyz": [ 1.461, 8.703, 0.885 ], "form": ".", "ssZp": 4.386, "Dp": 4.582, "splay_angle": 22.369, "splay_distance": 3.478, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 173.810, "theta": -134.666, "eta_prime": -166.352, "theta_prime": -128.230, "eta_base": -101.995, "theta_base": -89.735, "v0": 11.621, "v1": -33.791, "v2": 42.170, "v3": -35.380, "v4": 15.483, "amplitude": 42.207, "phase_angle": 2.405, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.823, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 14.366, 32.709, 46.357 ], "x_axis": [ -0.241, 0.833, 0.498 ], "y_axis": [ -0.970, -0.185, -0.159 ], "z_axis": [ -0.040, -0.521, 0.853 ], "quaternion": [ 0.597, 0.151, -0.225, 0.755 ] } }, { "index": 215, "index_chain": 48, "chain_name": "Q", "nt_resnum": 48, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/48", "linked_nts": [ "///Q/47", "///Q/49" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,junction-loop", "alpha": -68.580, "beta": 177.704, "gamma": 63.889, "delta": 143.896, "epsilon": -164.404, "zeta": -169.957, "epsilon_zeta": 5.552, "bb_type": "--", "chi": -130.236, "glyco_bond": "anti", "C5prime_xyz": [ -1.950, 8.590, -0.487 ], "P_xyz": [ 0.593, 8.919, -0.296 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 164.016, "theta": 172.985, "eta_prime": -155.728, "theta_prime": 138.424, "eta_base": -99.841, "theta_base": null, "v0": -18.273, "v1": 31.571, "v2": -31.450, "v3": 21.820, "v4": -2.082, "amplitude": 32.560, "phase_angle": 164.997, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.878, "filter_rmsd": 0.041, "frame": { "rmsd": 0.016, "origin": [ 13.836, 32.759, 49.794 ], "x_axis": [ -0.803, 0.542, 0.248 ], "y_axis": [ -0.594, -0.761, -0.260 ], "z_axis": [ 0.048, -0.356, 0.933 ], "quaternion": [ 0.304, 0.079, -0.165, 0.935 ] } }, { "index": 216, "index_chain": 49, "chain_name": "Q", "nt_resnum": 49, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/49", "linked_nts": [ "///Q/48", "///Q/50" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,non-stack,hairpin-loop,junction-loop", "alpha": -134.460, "beta": -162.599, "gamma": -50.409, "delta": 126.928, "epsilon": -101.354, "zeta": -79.221, "epsilon_zeta": -22.133, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 60.796, "theta": -108.686, "eta_prime": 44.426, "theta_prime": -139.282, "eta_base": null, "theta_base": null, "v0": 31.577, "v1": -24.183, "v2": 8.389, "v3": 9.584, "v4": -26.085, "amplitude": 30.869, "phase_angle": 285.769, "puckering": "O4'-exo", "sugar_class": "--", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null }, { "index": 217, "index_chain": 50, "chain_name": "Q", "nt_resnum": 50, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/50", "linked_nts": [ "///Q/49", "///Q/51" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,splayed-apart", "alpha": -115.155, "beta": 161.613, "gamma": -9.594, "delta": 164.729, "epsilon": -109.444, "zeta": 101.128, "epsilon_zeta": 149.428, "bb_type": "--", "chi": -128.814, "glyco_bond": "anti", "C5prime_xyz": [ -1.414, 8.544, -0.554 ], "P_xyz": [ 0.068, 9.816, 1.259 ], "form": ".", "ssZp": 0.171, "Dp": 0.503, "splay_angle": 160.597, "splay_distance": 18.582, "splay_ratio": 0.986, "d22": 11.457, "d64": 14.718, "eta": 52.898, "theta": 132.643, "eta_prime": 99.572, "theta_prime": 80.376, "eta_base": null, "theta_base": 71.360, "v0": -12.382, "v1": 35.657, "v2": -45.559, "v3": 39.226, "v4": -16.432, "amplitude": 45.626, "phase_angle": 183.111, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.009, "origin": [ 27.444, 22.502, 45.929 ], "x_axis": [ 0.309, -0.152, 0.939 ], "y_axis": [ -0.853, 0.392, 0.344 ], "z_axis": [ -0.420, -0.907, -0.008 ], "quaternion": [ 0.651, 0.481, -0.522, 0.269 ] } }, { "index": 218, "index_chain": 51, "chain_name": "Q", "nt_resnum": 51, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/51", "linked_nts": [ "///Q/50", "///Q/52" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,junction-loop,cap-donor,splayed-apart", "alpha": 55.735, "beta": -168.895, "gamma": 56.450, "delta": 152.131, "epsilon": -75.823, "zeta": -50.862, "epsilon_zeta": -24.960, "bb_type": "--", "chi": -141.991, "glyco_bond": "anti", "C5prime_xyz": [ -1.607, 8.663, 0.129 ], "P_xyz": [ 0.393, 8.858, 1.806 ], "form": ".", "ssZp": 0.264, "Dp": 0.245, "splay_angle": 129.630, "splay_distance": 17.296, "splay_ratio": 0.905, "d22": 8.943, "d64": 10.965, "eta": 5.416, "theta": 0.509, "eta_prime": 16.210, "theta_prime": -23.088, "eta_base": 13.556, "theta_base": 15.082, "v0": -18.014, "v1": 36.714, "v2": -40.738, "v3": 30.817, "v4": -8.399, "amplitude": 41.049, "phase_angle": 172.947, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.221, "filter_rmsd": 0.109, "frame": { "rmsd": 0.013, "origin": [ 12.187, 32.158, 41.535 ], "x_axis": [ -0.468, -0.719, -0.514 ], "y_axis": [ 0.840, -0.543, -0.005 ], "z_axis": [ -0.275, -0.434, 0.858 ], "quaternion": [ -0.460, -0.233, -0.130, 0.847 ] } }, { "index": 219, "index_chain": 52, "chain_name": "Q", "nt_resnum": 52, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/52", "linked_nts": [ "///Q/51", "///Q/53" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,bulge,junction-loop,phosphate,splayed-apart", "alpha": -87.028, "beta": -150.596, "gamma": 60.751, "delta": 80.248, "epsilon": -147.792, "zeta": -63.950, "epsilon_zeta": -83.842, "bb_type": "BI", "chi": -171.136, "glyco_bond": "anti", "C5prime_xyz": [ -1.403, 8.656, 1.179 ], "P_xyz": [ 1.073, 8.691, 2.049 ], "form": ".", "ssZp": 4.710, "Dp": 4.713, "splay_angle": 30.862, "splay_distance": 4.681, "splay_ratio": 0.267, "d22": null, "d64": null, "eta": 150.067, "theta": -129.261, "eta_prime": -171.648, "theta_prime": -123.966, "eta_base": -168.884, "theta_base": -77.794, "v0": 3.536, "v1": -30.262, "v2": 43.169, "v3": -42.370, "v4": 24.602, "amplitude": 44.494, "phase_angle": 14.019, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.393, "filter_rmsd": 0.075, "frame": { "rmsd": 0.018, "origin": [ 27.983, 25.517, 43.893 ], "x_axis": [ -0.255, 0.057, -0.965 ], "y_axis": [ -0.810, 0.533, 0.245 ], "z_axis": [ 0.529, 0.844, -0.090 ], "quaternion": [ 0.545, -0.275, 0.685, 0.397 ] } }, { "index": 220, "index_chain": 53, "chain_name": "Q", "nt_resnum": 53, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/53", "linked_nts": [ "///Q/52", "///Q/54" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,bulge", "alpha": -64.638, "beta": -175.454, "gamma": 42.208, "delta": 77.906, "epsilon": -156.448, "zeta": -60.227, "epsilon_zeta": -96.221, "bb_type": "BI", "chi": -161.256, "glyco_bond": "anti", "C5prime_xyz": [ -1.085, 8.689, 0.645 ], "P_xyz": [ 1.540, 8.777, 1.231 ], "form": "A", "ssZp": 4.458, "Dp": 4.658, "splay_angle": 24.310, "splay_distance": 3.974, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 164.853, "theta": -141.251, "eta_prime": -177.049, "theta_prime": -138.317, "eta_base": -112.126, "theta_base": -118.332, "v0": 9.845, "v1": -33.339, "v2": 43.831, "v3": -38.757, "v4": 18.313, "amplitude": 44.062, "phase_angle": 5.877, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.733, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 28.847, 28.528, 40.414 ], "x_axis": [ -0.887, 0.320, -0.332 ], "y_axis": [ -0.235, 0.306, 0.923 ], "z_axis": [ 0.396, 0.897, -0.196 ], "quaternion": [ 0.236, 0.027, 0.773, 0.589 ] } }, { "index": 221, "index_chain": 54, "chain_name": "Q", "nt_resnum": 54, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/54", "linked_nts": [ "///Q/53", "///Q/55" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -81.050, "beta": 179.034, "gamma": 67.019, "delta": 71.802, "epsilon": -142.114, "zeta": -68.892, "epsilon_zeta": -73.222, "bb_type": "BI", "chi": -163.799, "glyco_bond": "anti", "C5prime_xyz": [ -1.472, 8.879, 0.699 ], "P_xyz": [ 1.037, 9.569, 0.559 ], "form": "A", "ssZp": 4.433, "Dp": 4.683, "splay_angle": 22.932, "splay_distance": 3.732, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 168.674, "theta": -148.522, "eta_prime": -178.077, "theta_prime": -146.519, "eta_base": -143.882, "theta_base": -116.440, "v0": 0.504, "v1": -29.182, "v2": 46.258, "v3": -46.249, "v4": 28.657, "amplitude": 48.535, "phase_angle": 17.622, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.471, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 29.531, 31.236, 37.586 ], "x_axis": [ -0.929, 0.333, 0.161 ], "y_axis": [ 0.234, 0.193, 0.953 ], "z_axis": [ 0.286, 0.923, -0.257 ], "quaternion": [ 0.041, 0.184, 0.771, 0.608 ] } }, { "index": 222, "index_chain": 55, "chain_name": "Q", "nt_resnum": 55, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/55", "linked_nts": [ "///Q/54", "///Q/56" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -68.283, "beta": 175.888, "gamma": 57.090, "delta": 80.088, "epsilon": -152.492, "zeta": -69.708, "epsilon_zeta": -82.784, "bb_type": "BI", "chi": -164.085, "glyco_bond": "anti", "C5prime_xyz": [ -1.514, 8.771, 0.671 ], "P_xyz": [ 0.947, 9.513, 0.378 ], "form": "A", "ssZp": 4.662, "Dp": 4.799, "splay_angle": 24.744, "splay_distance": 3.926, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 166.554, "theta": -150.404, "eta_prime": -179.779, "theta_prime": -148.795, "eta_base": -134.649, "theta_base": -122.762, "v0": 6.046, "v1": -32.092, "v2": 43.779, "v3": -40.724, "v4": 22.601, "amplitude": 44.537, "phase_angle": 10.588, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.724, "filter_rmsd": 0.066, "frame": { "rmsd": 0.011, "origin": [ 28.309, 34.232, 35.726 ], "x_axis": [ -0.693, 0.302, 0.655 ], "y_axis": [ 0.709, 0.117, 0.696 ], "z_axis": [ 0.133, 0.946, -0.294 ], "quaternion": [ -0.180, 0.348, 0.725, 0.566 ] } }, { "index": 223, "index_chain": 56, "chain_name": "Q", "nt_resnum": 56, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/56", "linked_nts": [ "///Q/55", "///Q/57" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor", "alpha": -67.649, "beta": 173.973, "gamma": 61.192, "delta": 77.525, "epsilon": -155.818, "zeta": -47.226, "epsilon_zeta": -108.592, "bb_type": "BI", "chi": -166.506, "glyco_bond": "anti", "C5prime_xyz": [ -1.585, 8.711, 0.834 ], "P_xyz": [ 0.940, 9.298, 0.807 ], "form": ".", "ssZp": 4.584, "Dp": 4.678, "splay_angle": 22.818, "splay_distance": 4.060, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 174.096, "theta": -127.389, "eta_prime": -171.874, "theta_prime": -133.724, "eta_base": -130.933, "theta_base": -108.921, "v0": 0.578, "v1": -27.982, "v2": 43.156, "v3": -43.801, "v4": 27.458, "amplitude": 45.332, "phase_angle": 17.821, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.869, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 26.438, 37.556, 34.795 ], "x_axis": [ -0.230, 0.226, 0.947 ], "y_axis": [ 0.973, 0.023, 0.230 ], "z_axis": [ 0.030, 0.974, -0.225 ], "quaternion": [ -0.377, 0.493, 0.608, 0.495 ] } }, { "index": 224, "index_chain": 57, "chain_name": "Q", "nt_resnum": 57, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/57", "linked_nts": [ "///Q/56", "///Q/58" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -138.112, "beta": 160.404, "gamma": 132.008, "delta": 75.652, "epsilon": -130.050, "zeta": -62.807, "epsilon_zeta": -67.243, "bb_type": "BI", "chi": -177.655, "glyco_bond": "anti", "C5prime_xyz": [ -1.725, 8.608, 1.525 ], "P_xyz": [ 0.038, 10.248, 0.440 ], "form": ".", "ssZp": 4.626, "Dp": 4.694, "splay_angle": 29.097, "splay_distance": 4.556, "splay_ratio": 0.253, "d22": null, "d64": null, "eta": 168.614, "theta": -145.095, "eta_prime": -173.972, "theta_prime": -141.697, "eta_base": -127.449, "theta_base": -87.844, "v0": 1.172, "v1": -28.532, "v2": 43.338, "v3": -42.773, "v4": 26.677, "amplitude": 45.221, "phase_angle": 16.594, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 24.123, 40.692, 35.930 ], "x_axis": [ 0.309, 0.161, 0.937 ], "y_axis": [ 0.947, 0.039, -0.319 ], "z_axis": [ -0.088, 0.986, -0.140 ], "quaternion": [ 0.550, -0.594, -0.466, -0.358 ] } }, { "index": 225, "index_chain": 58, "chain_name": "Q", "nt_resnum": 58, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/58", "linked_nts": [ "///Q/57", "///Q/59" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -66.739, "beta": 177.556, "gamma": 49.156, "delta": 80.566, "epsilon": -122.648, "zeta": -149.817, "epsilon_zeta": 27.169, "bb_type": "--", "chi": -160.802, "glyco_bond": "anti", "C5prime_xyz": [ -1.401, 8.714, 0.528 ], "P_xyz": [ 1.144, 9.199, 0.613 ], "form": ".", "ssZp": 4.368, "Dp": 4.812, "splay_angle": 101.902, "splay_distance": 14.165, "splay_ratio": 0.777, "d22": null, "d64": null, "eta": 163.481, "theta": 179.225, "eta_prime": -175.921, "theta_prime": 151.619, "eta_base": -104.621, "theta_base": 107.618, "v0": 2.533, "v1": -30.658, "v2": 45.185, "v3": -44.346, "v4": 26.447, "amplitude": 46.807, "phase_angle": 15.131, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.736, "filter_rmsd": 0.041, "frame": { "rmsd": 0.012, "origin": [ 25.324, 44.189, 38.592 ], "x_axis": [ 0.950, 0.140, 0.279 ], "y_axis": [ 0.281, 0.002, -0.960 ], "z_axis": [ -0.135, 0.990, -0.037 ], "quaternion": [ 0.692, -0.704, -0.149, -0.051 ] } }, { "index": 226, "index_chain": 59, "chain_name": "Q", "nt_resnum": 59, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/59", "linked_nts": [ "///Q/58", "///Q/60" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 66.113, "beta": -174.656, "gamma": 164.880, "delta": 158.951, "epsilon": -94.510, "zeta": -58.564, "epsilon_zeta": -35.947, "bb_type": "--", "chi": -144.917, "glyco_bond": "anti", "C5prime_xyz": [ -1.496, 8.437, 0.530 ], "P_xyz": [ 0.825, 9.268, -0.047 ], "form": ".", "ssZp": 0.617, "Dp": 0.698, "splay_angle": 120.036, "splay_distance": 16.628, "splay_ratio": 0.867, "d22": null, "d64": null, "eta": 122.710, "theta": -79.176, "eta_prime": 114.155, "theta_prime": -76.352, "eta_base": 87.422, "theta_base": -48.194, "v0": -11.526, "v1": 32.848, "v2": -40.320, "v3": 35.243, "v4": -15.142, "amplitude": 40.367, "phase_angle": 182.773, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.102, "frame": { "rmsd": 0.006, "origin": [ 17.264, 44.510, 26.947 ], "x_axis": [ 0.614, -0.722, -0.320 ], "y_axis": [ 0.773, 0.465, 0.432 ], "z_axis": [ -0.163, -0.512, 0.843 ], "quaternion": [ 0.855, 0.276, 0.046, -0.437 ] } }, { "index": 227, "index_chain": 60, "chain_name": "Q", "nt_resnum": 60, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/60", "linked_nts": [ "///Q/59", "///Q/61" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -64.459, "beta": 178.648, "gamma": 63.566, "delta": 87.258, "epsilon": -143.344, "zeta": -68.257, "epsilon_zeta": -75.087, "bb_type": "BI", "chi": -177.926, "glyco_bond": "anti", "C5prime_xyz": [ -1.865, 8.476, 1.465 ], "P_xyz": [ 0.572, 8.851, 2.224 ], "form": ".", "ssZp": 4.330, "Dp": 4.404, "splay_angle": 23.135, "splay_distance": 3.601, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 164.508, "theta": -129.018, "eta_prime": -148.389, "theta_prime": -127.262, "eta_base": -123.063, "theta_base": -75.047, "v0": -1.097, "v1": -22.024, "v2": 35.760, "v3": -37.578, "v4": 24.211, "amplitude": 38.145, "phase_angle": 20.369, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.423, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 25.308, 50.983, 39.981 ], "x_axis": [ 0.751, 0.155, -0.642 ], "y_axis": [ -0.632, -0.113, -0.767 ], "z_axis": [ -0.191, 0.981, 0.013 ], "quaternion": [ 0.642, -0.680, 0.175, 0.306 ] } }, { "index": 228, "index_chain": 61, "chain_name": "Q", "nt_resnum": 61, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/61", "linked_nts": [ "///Q/60", "///Q/62" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.987, "beta": 177.237, "gamma": 53.442, "delta": 80.706, "epsilon": -142.696, "zeta": -73.947, "epsilon_zeta": -68.749, "bb_type": "BI", "chi": -151.519, "glyco_bond": "anti", "C5prime_xyz": [ -1.488, 8.710, 0.071 ], "P_xyz": [ 1.107, 9.057, 0.292 ], "form": "A", "ssZp": 4.076, "Dp": 4.622, "splay_angle": 20.966, "splay_distance": 3.347, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 161.088, "theta": -142.850, "eta_prime": -178.668, "theta_prime": -143.375, "eta_base": -108.268, "theta_base": -112.143, "v0": 7.340, "v1": -32.930, "v2": 44.882, "v3": -40.902, "v4": 21.510, "amplitude": 45.455, "phase_angle": 9.107, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.857, "filter_rmsd": 0.039, "frame": { "rmsd": 0.021, "origin": [ 26.476, 54.085, 38.574 ], "x_axis": [ -0.038, 0.024, -0.999 ], "y_axis": [ -0.998, -0.058, 0.036 ], "z_axis": [ -0.057, 0.998, 0.027 ], "quaternion": [ 0.482, -0.498, 0.488, 0.530 ] } }, { "index": 229, "index_chain": 62, "chain_name": "Q", "nt_resnum": 62, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/62", "linked_nts": [ "///Q/61", "///Q/63" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.420, "beta": 167.079, "gamma": 46.371, "delta": 78.733, "epsilon": -160.250, "zeta": -59.542, "epsilon_zeta": -100.708, "bb_type": "BI", "chi": -152.463, "glyco_bond": "anti", "C5prime_xyz": [ -1.176, 8.744, 0.117 ], "P_xyz": [ 1.348, 9.092, -0.136 ], "form": "A", "ssZp": 4.283, "Dp": 4.680, "splay_angle": 24.655, "splay_distance": 3.857, "splay_ratio": 0.214, "d22": 3.834, "d64": 3.893, "eta": 160.402, "theta": -143.671, "eta_prime": 173.954, "theta_prime": -142.512, "eta_base": -138.742, "theta_base": -111.550, "v0": 9.864, "v1": -33.743, "v2": 42.939, "v3": -38.436, "v4": 18.470, "amplitude": 43.156, "phase_angle": 5.747, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.883, "filter_rmsd": 0.071, "frame": { "rmsd": 0.013, "origin": [ 26.714, 57.227, 37.444 ], "x_axis": [ -0.591, -0.169, -0.789 ], "y_axis": [ -0.806, 0.085, 0.586 ], "z_axis": [ -0.032, 0.982, -0.186 ], "quaternion": [ 0.277, -0.357, 0.682, 0.575 ] } }, { "index": 230, "index_chain": 63, "chain_name": "Q", "nt_resnum": 63, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/63", "linked_nts": [ "///Q/62", "///Q/64" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.972, "beta": -177.081, "gamma": 49.106, "delta": 80.323, "epsilon": -165.282, "zeta": -63.707, "epsilon_zeta": -101.576, "bb_type": "BI", "chi": -156.708, "glyco_bond": "anti", "C5prime_xyz": [ -1.280, 8.682, 0.359 ], "P_xyz": [ 1.314, 9.032, 0.551 ], "form": "A", "ssZp": 4.419, "Dp": 4.636, "splay_angle": 19.825, "splay_distance": 3.141, "splay_ratio": 0.175, "d22": 4.162, "d64": 4.203, "eta": 167.367, "theta": -146.846, "eta_prime": -176.302, "theta_prime": -148.996, "eta_base": -128.063, "theta_base": -129.889, "v0": 10.585, "v1": -34.861, "v2": 43.787, "v3": -39.007, "v4": 18.234, "amplitude": 43.954, "phase_angle": 5.002, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.808, "filter_rmsd": 0.112, "frame": { "rmsd": 0.011, "origin": [ 25.980, 60.056, 34.927 ], "x_axis": [ -0.928, -0.280, -0.246 ], "y_axis": [ -0.317, 0.246, 0.916 ], "z_axis": [ -0.196, 0.928, -0.317 ], "quaternion": [ 0.016, -0.189, 0.789, 0.584 ] } }, { "index": 231, "index_chain": 64, "chain_name": "Q", "nt_resnum": 64, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/64", "linked_nts": [ "///Q/63", "///Q/65" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -116.509, "beta": 179.403, "gamma": 91.633, "delta": 78.983, "epsilon": -141.378, "zeta": -81.235, "epsilon_zeta": -60.143, "bb_type": "BI", "chi": -168.925, "glyco_bond": "anti", "C5prime_xyz": [ -1.332, 8.623, 1.112 ], "P_xyz": [ 1.174, 9.172, 0.512 ], "form": "A", "ssZp": 4.652, "Dp": 4.764, "splay_angle": 25.519, "splay_distance": 3.930, "splay_ratio": 0.222, "d22": 4.110, "d64": 4.300, "eta": 162.742, "theta": -147.405, "eta_prime": 175.051, "theta_prime": -147.346, "eta_base": -149.709, "theta_base": -117.088, "v0": 8.983, "v1": -33.181, "v2": 43.226, "v3": -39.316, "v4": 19.276, "amplitude": 43.554, "phase_angle": 7.040, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.072, "frame": { "rmsd": 0.012, "origin": [ 25.408, 61.994, 32.522 ], "x_axis": [ -0.924, -0.265, 0.275 ], "y_axis": [ 0.118, 0.488, 0.865 ], "z_axis": [ -0.363, 0.832, -0.420 ], "quaternion": [ -0.190, -0.044, 0.841, 0.504 ] } }, { "index": 232, "index_chain": 65, "chain_name": "Q", "nt_resnum": 65, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/65", "linked_nts": [ "///Q/64", "///Q/66" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -47.544, "beta": 162.772, "gamma": 40.202, "delta": 78.987, "epsilon": -149.025, "zeta": -75.338, "epsilon_zeta": -73.686, "bb_type": "BI", "chi": -167.340, "glyco_bond": "anti", "C5prime_xyz": [ -1.318, 8.654, 1.022 ], "P_xyz": [ 1.286, 8.860, 1.339 ], "form": "A", "ssZp": 4.663, "Dp": 4.743, "splay_angle": 21.306, "splay_distance": 3.350, "splay_ratio": 0.189, "d22": 4.156, "d64": 4.272, "eta": 168.288, "theta": -146.981, "eta_prime": -177.574, "theta_prime": -144.398, "eta_base": -129.622, "theta_base": -118.693, "v0": 12.070, "v1": -35.371, "v2": 43.928, "v3": -38.247, "v4": 16.659, "amplitude": 43.995, "phase_angle": 3.160, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.531, "filter_rmsd": 0.067, "frame": { "rmsd": 0.008, "origin": [ 22.667, 63.921, 30.467 ], "x_axis": [ -0.629, 0.002, 0.777 ], "y_axis": [ 0.651, 0.547, 0.526 ], "z_axis": [ -0.425, 0.837, -0.345 ], "quaternion": [ -0.378, 0.205, 0.794, 0.429 ] } }, { "index": 233, "index_chain": 66, "chain_name": "Q", "nt_resnum": 66, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/66", "linked_nts": [ "///Q/65", "///Q/67" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -54.435, "beta": 167.707, "gamma": 48.427, "delta": 83.960, "epsilon": -130.120, "zeta": -92.458, "epsilon_zeta": -37.662, "bb_type": "--", "chi": -162.569, "glyco_bond": "anti", "C5prime_xyz": [ -1.367, 8.778, 0.749 ], "P_xyz": [ 1.250, 9.079, 1.009 ], "form": "A", "ssZp": 4.450, "Dp": 4.711, "splay_angle": 17.641, "splay_distance": 2.876, "splay_ratio": 0.154, "d22": null, "d64": null, "eta": 177.545, "theta": -142.590, "eta_prime": -171.238, "theta_prime": -141.020, "eta_base": -134.188, "theta_base": -117.367, "v0": 5.756, "v1": -26.387, "v2": 36.202, "v3": -33.668, "v4": 17.656, "amplitude": 36.735, "phase_angle": 9.768, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.853, "filter_rmsd": 0.069, "frame": { "rmsd": 0.008, "origin": [ 19.821, 65.369, 29.452 ], "x_axis": [ -0.143, 0.241, 0.960 ], "y_axis": [ 0.837, 0.548, -0.013 ], "z_axis": [ -0.529, 0.801, -0.280 ], "quaternion": [ 0.530, -0.384, -0.702, -0.281 ] } }, { "index": 234, "index_chain": 67, "chain_name": "Q", "nt_resnum": 67, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/67", "linked_nts": [ "///Q/66", "///Q/68" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -44.521, "beta": 149.187, "gamma": 39.025, "delta": 73.583, "epsilon": -172.761, "zeta": -75.587, "epsilon_zeta": -97.174, "bb_type": "BI", "chi": -153.373, "glyco_bond": "anti", "C5prime_xyz": [ -1.754, 8.899, 0.110 ], "P_xyz": [ 0.808, 9.440, -0.185 ], "form": "A", "ssZp": 4.212, "Dp": 4.461, "splay_angle": 24.915, "splay_distance": 4.047, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 153.337, "theta": -138.922, "eta_prime": 171.499, "theta_prime": -145.368, "eta_base": -145.024, "theta_base": -116.478, "v0": -0.045, "v1": -27.756, "v2": 43.792, "v3": -44.786, "v4": 28.105, "amplitude": 46.187, "phase_angle": 18.532, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.259, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 17.494, 67.057, 29.515 ], "x_axis": [ 0.322, 0.397, 0.859 ], "y_axis": [ 0.668, 0.548, -0.504 ], "z_axis": [ -0.671, 0.737, -0.088 ], "quaternion": [ 0.667, -0.464, -0.573, -0.102 ] } }, { "index": 235, "index_chain": 68, "chain_name": "Q", "nt_resnum": 68, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/68", "linked_nts": [ "///Q/67", "///Q/69" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": 168.818, "beta": -161.881, "gamma": 168.694, "delta": 85.048, "epsilon": -152.895, "zeta": -69.137, "epsilon_zeta": -83.757, "bb_type": "BI", "chi": -173.653, "glyco_bond": "anti", "C5prime_xyz": [ -0.980, 8.184, 1.460 ], "P_xyz": [ 0.885, 9.552, 0.353 ], "form": "A", "ssZp": 4.616, "Dp": 4.651, "splay_angle": 23.255, "splay_distance": 3.607, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 170.801, "theta": -162.966, "eta_prime": -173.945, "theta_prime": -161.818, "eta_base": -123.476, "theta_base": -147.569, "v0": 20.626, "v1": -40.785, "v2": 44.873, "v3": -33.968, "v4": 8.536, "amplitude": 45.292, "phase_angle": 352.204, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.617, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 15.153, 69.481, 31.758 ], "x_axis": [ 0.674, 0.595, 0.437 ], "y_axis": [ 0.324, 0.293, -0.900 ], "z_axis": [ -0.664, 0.748, 0.005 ], "quaternion": [ 0.702, -0.587, -0.392, 0.097 ] } }, { "index": 236, "index_chain": 69, "chain_name": "Q", "nt_resnum": 69, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/69", "linked_nts": [ "///Q/68", "///Q/70" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor", "alpha": -77.963, "beta": -170.371, "gamma": 59.046, "delta": 78.766, "epsilon": -157.896, "zeta": -63.913, "epsilon_zeta": -93.983, "bb_type": "BI", "chi": -154.142, "glyco_bond": "anti", "C5prime_xyz": [ -1.201, 8.770, 0.240 ], "P_xyz": [ 1.450, 9.004, 0.479 ], "form": "A", "ssZp": 4.237, "Dp": 4.558, "splay_angle": 24.114, "splay_distance": 3.746, "splay_ratio": 0.209, "d22": 4.046, "d64": 3.966, "eta": 171.367, "theta": -142.905, "eta_prime": -178.080, "theta_prime": -140.284, "eta_base": -154.177, "theta_base": -107.600, "v0": 7.637, "v1": -30.831, "v2": 41.719, "v3": -38.377, "v4": 19.325, "amplitude": 42.185, "phase_angle": 8.520, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.756, "filter_rmsd": 0.109, "frame": { "rmsd": 0.010, "origin": [ 12.489, 70.856, 33.763 ], "x_axis": [ 0.755, 0.653, -0.057 ], "y_axis": [ -0.144, 0.080, -0.986 ], "z_axis": [ -0.639, 0.753, 0.155 ], "quaternion": [ 0.705, -0.617, -0.206, 0.282 ] } }, { "index": 237, "index_chain": 70, "chain_name": "Q", "nt_resnum": 70, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/70", "linked_nts": [ "///Q/69", "///Q/71" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -80.368, "beta": -178.699, "gamma": 60.978, "delta": 78.168, "epsilon": -137.699, "zeta": -75.413, "epsilon_zeta": -62.286, "bb_type": "BI", "chi": -158.482, "glyco_bond": "anti", "C5prime_xyz": [ -1.339, 8.717, 0.429 ], "P_xyz": [ 1.298, 8.936, 0.260 ], "form": "A", "ssZp": 4.389, "Dp": 4.793, "splay_angle": 20.839, "splay_distance": 3.310, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 167.809, "theta": -142.821, "eta_prime": -178.334, "theta_prime": -143.292, "eta_base": -131.877, "theta_base": -121.139, "v0": 10.930, "v1": -35.842, "v2": 46.396, "v3": -40.606, "v4": 19.048, "amplitude": 46.584, "phase_angle": 5.155, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.706, "filter_rmsd": 0.112, "frame": { "rmsd": 0.011, "origin": [ 11.669, 74.371, 34.766 ], "x_axis": [ 0.596, 0.482, -0.643 ], "y_axis": [ -0.612, -0.246, -0.752 ], "z_axis": [ -0.520, 0.841, 0.148 ], "quaternion": [ 0.612, -0.651, 0.050, 0.447 ] } }, { "index": 238, "index_chain": 71, "chain_name": "Q", "nt_resnum": 71, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/71", "linked_nts": [ "///Q/70", "///Q/72" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -76.470, "beta": 163.603, "gamma": 67.319, "delta": 76.784, "epsilon": -119.615, "zeta": 102.487, "epsilon_zeta": 137.898, "bb_type": "--", "chi": -163.460, "glyco_bond": "anti", "C5prime_xyz": [ -1.488, 8.696, 0.668 ], "P_xyz": [ 0.937, 9.249, -0.046 ], "form": ".", "ssZp": 4.465, "Dp": 4.896, "splay_angle": 103.592, "splay_distance": 12.315, "splay_ratio": 0.791, "d22": null, "d64": null, "eta": 167.654, "theta": 49.403, "eta_prime": 178.270, "theta_prime": 44.659, "eta_base": -145.287, "theta_base": 63.443, "v0": 6.594, "v1": -33.461, "v2": 45.913, "v3": -43.263, "v4": 23.543, "amplitude": 46.728, "phase_angle": 10.720, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.590, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 11.639, 77.642, 35.270 ], "x_axis": [ 0.307, 0.167, -0.937 ], "y_axis": [ -0.899, -0.272, -0.343 ], "z_axis": [ -0.312, 0.948, 0.067 ], "quaternion": [ 0.525, -0.615, 0.298, 0.508 ] } }, { "index": 239, "index_chain": 72, "chain_name": "Q", "nt_resnum": 72, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/72", "linked_nts": [ "///Q/71", "///Q/73" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -166.290, "beta": -160.762, "gamma": 73.145, "delta": 109.344, "epsilon": -70.358, "zeta": 97.923, "epsilon_zeta": 191.718, "bb_type": "--", "chi": 57.092, "glyco_bond": "syn", "C5prime_xyz": [ -5.531, 4.475, 1.649 ], "P_xyz": [ -6.064, 1.899, 1.969 ], "form": ".", "ssZp": -1.027, "Dp": 2.017, "splay_angle": 149.366, "splay_distance": 18.008, "splay_ratio": 0.965, "d22": 11.911, "d64": 15.096, "eta": 170.468, "theta": 130.528, "eta_prime": -173.533, "theta_prime": 116.132, "eta_base": -171.042, "theta_base": 8.131, "v0": -27.255, "v1": 18.865, "v2": -4.505, "v3": -10.846, "v4": 23.761, "amplitude": 26.614, "phase_angle": 99.746, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.012, "origin": [ 0.040, 73.934, 37.103 ], "x_axis": [ -0.401, -0.912, -0.083 ], "y_axis": [ -0.532, 0.306, -0.789 ], "z_axis": [ 0.746, -0.272, -0.608 ], "quaternion": [ 0.273, -0.475, 0.761, -0.349 ] } }, { "index": 240, "index_chain": 73, "chain_name": "Q", "nt_resnum": 73, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/73", "linked_nts": [ "///Q/72", "///Q/74" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": 46.244, "beta": 149.244, "gamma": 40.526, "delta": 78.050, "epsilon": -142.924, "zeta": -78.315, "epsilon_zeta": -64.609, "bb_type": "BI", "chi": -170.415, "glyco_bond": "anti", "C5prime_xyz": [ -1.268, 8.585, 1.137 ], "P_xyz": [ 1.391, 8.706, 1.100 ], "form": "A", "ssZp": 4.699, "Dp": 4.761, "splay_angle": 26.529, "splay_distance": 3.983, "splay_ratio": 0.232, "d22": 4.295, "d64": 4.586, "eta": -50.643, "theta": -145.218, "eta_prime": -53.128, "theta_prime": -144.124, "eta_base": 58.748, "theta_base": -116.448, "v0": 13.009, "v1": -38.115, "v2": 47.533, "v3": -40.901, "v4": 17.706, "amplitude": 47.595, "phase_angle": 2.929, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.111, "frame": { "rmsd": 0.011, "origin": [ 1.729, 90.072, 29.295 ], "x_axis": [ 0.238, 0.182, 0.954 ], "y_axis": [ -0.515, -0.809, 0.283 ], "z_axis": [ 0.823, -0.559, -0.099 ], "quaternion": [ 0.287, 0.732, -0.114, 0.607 ] } }, { "index": 241, "index_chain": 74, "chain_name": "Q", "nt_resnum": 74, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/74", "linked_nts": [ "///Q/73", "///Q/75" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -60.217, "beta": 164.848, "gamma": 59.583, "delta": 80.661, "epsilon": -110.202, "zeta": -101.554, "epsilon_zeta": -8.648, "bb_type": "--", "chi": -173.521, "glyco_bond": "anti", "C5prime_xyz": [ -1.083, 8.488, 1.369 ], "P_xyz": [ 1.563, 8.648, 1.294 ], "form": "A", "ssZp": 4.721, "Dp": 4.884, "splay_angle": 22.878, "splay_distance": 3.533, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": -178.208, "theta": -143.600, "eta_prime": -168.719, "theta_prime": -140.298, "eta_base": -128.595, "theta_base": -117.514, "v0": 13.878, "v1": -36.642, "v2": 44.359, "v3": -37.213, "v4": 14.866, "amplitude": 44.362, "phase_angle": 0.654, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.871, "filter_rmsd": 0.069, "frame": { "rmsd": 0.007, "origin": [ 5.647, 89.642, 29.874 ], "x_axis": [ -0.143, -0.317, 0.938 ], "y_axis": [ -0.551, -0.762, -0.341 ], "z_axis": [ 0.822, -0.565, -0.066 ], "quaternion": [ 0.086, 0.649, -0.334, 0.678 ] } }, { "index": 242, "index_chain": 75, "chain_name": "Q", "nt_resnum": 75, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/75", "linked_nts": [ "///Q/74", "///Q/76" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -57.639, "beta": 139.491, "gamma": 58.830, "delta": 76.566, "epsilon": -168.518, "zeta": -81.366, "epsilon_zeta": -87.152, "bb_type": "BI", "chi": -176.445, "glyco_bond": "anti", "C5prime_xyz": [ -1.654, 8.515, 1.531 ], "P_xyz": [ 0.942, 8.838, 1.285 ], "form": "A", "ssZp": 4.570, "Dp": 4.571, "splay_angle": 21.886, "splay_distance": 3.239, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 156.796, "theta": -142.925, "eta_prime": 175.803, "theta_prime": -147.381, "eta_base": -142.162, "theta_base": -119.417, "v0": 4.943, "v1": -29.772, "v2": 41.715, "v3": -39.974, "v4": 22.266, "amplitude": 42.663, "phase_angle": 12.101, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.865, "filter_rmsd": 0.036, "frame": { "rmsd": 0.006, "origin": [ 8.798, 88.429, 30.913 ], "x_axis": [ -0.634, -0.468, 0.616 ], "y_axis": [ -0.352, -0.535, -0.768 ], "z_axis": [ 0.689, -0.703, 0.175 ], "quaternion": [ -0.038, 0.426, -0.480, 0.765 ] } }, { "index": 243, "index_chain": 76, "chain_name": "Q", "nt_resnum": 76, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/76", "linked_nts": [ "///Q/75", "///Q/77" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -148.521, "beta": -141.728, "gamma": 102.245, "delta": 79.114, "epsilon": -135.247, "zeta": -82.400, "epsilon_zeta": -52.847, "bb_type": "BI", "chi": -168.817, "glyco_bond": "anti", "C5prime_xyz": [ -1.218, 8.575, 1.097 ], "P_xyz": [ 1.393, 8.524, 0.643 ], "form": "A", "ssZp": 4.665, "Dp": 4.795, "splay_angle": 25.009, "splay_distance": 3.799, "splay_ratio": 0.218, "d22": 3.901, "d64": 4.165, "eta": 159.206, "theta": -139.485, "eta_prime": 168.457, "theta_prime": -140.066, "eta_base": -146.388, "theta_base": -112.096, "v0": 11.321, "v1": -34.837, "v2": 44.169, "v3": -38.612, "v4": 17.253, "amplitude": 44.281, "phase_angle": 4.084, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.010, "origin": [ 10.797, 86.854, 32.918 ], "x_axis": [ -0.729, -0.683, -0.042 ], "y_axis": [ 0.237, -0.195, -0.952 ], "z_axis": [ 0.642, -0.704, 0.304 ], "quaternion": [ -0.308, 0.201, -0.555, 0.746 ] } }, { "index": 244, "index_chain": 77, "chain_name": "Q", "nt_resnum": 77, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/77", "linked_nts": [ "///Q/76", "///Q/78" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -61.429, "beta": 156.086, "gamma": 60.864, "delta": 78.770, "epsilon": -110.058, "zeta": -143.777, "epsilon_zeta": 33.719, "bb_type": "--", "chi": -174.783, "glyco_bond": "anti", "C5prime_xyz": [ -1.409, 8.524, 1.459 ], "P_xyz": [ 1.190, 8.757, 1.302 ], "form": "A", "ssZp": 4.644, "Dp": 4.800, "splay_angle": 21.724, "splay_distance": 3.457, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 176.018, "theta": -143.480, "eta_prime": -172.230, "theta_prime": -147.114, "eta_base": -127.297, "theta_base": -141.232, "v0": 10.292, "v1": -34.600, "v2": 44.798, "v3": -40.204, "v4": 18.774, "amplitude": 45.031, "phase_angle": 5.833, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.719, "filter_rmsd": 0.067, "frame": { "rmsd": 0.008, "origin": [ 11.332, 83.644, 34.876 ], "x_axis": [ -0.528, -0.566, -0.633 ], "y_axis": [ 0.645, 0.217, -0.733 ], "z_axis": [ 0.552, -0.795, 0.250 ], "quaternion": [ -0.484, -0.032, -0.612, 0.625 ] } }, { "index": 245, "index_chain": 78, "chain_name": "Q", "nt_resnum": 78, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/78", "linked_nts": [ "///Q/77", "///Q/79" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": 104.865, "beta": -96.151, "gamma": 175.496, "delta": 74.780, "epsilon": -115.430, "zeta": -78.956, "epsilon_zeta": -36.474, "bb_type": "--", "chi": 171.607, "glyco_bond": "anti", "C5prime_xyz": [ -1.687, 8.119, 2.236 ], "P_xyz": [ 0.083, 9.309, 0.691 ], "form": ".", "ssZp": 4.771, "Dp": 4.776, "splay_angle": 29.821, "splay_distance": 4.525, "splay_ratio": 0.259, "d22": null, "d64": null, "eta": 163.538, "theta": -141.085, "eta_prime": 175.302, "theta_prime": -143.113, "eta_base": -162.963, "theta_base": -97.282, "v0": 7.221, "v1": -31.506, "v2": 42.748, "v3": -39.899, "v4": 20.511, "amplitude": 43.324, "phase_angle": 9.359, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 11.879, 81.099, 37.152 ], "x_axis": [ -0.393, -0.366, -0.844 ], "y_axis": [ 0.823, 0.269, -0.500 ], "z_axis": [ 0.409, -0.891, 0.196 ], "quaternion": [ 0.517, 0.189, 0.605, -0.574 ] } }, { "index": 246, "index_chain": 79, "chain_name": "Q", "nt_resnum": 79, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/79", "linked_nts": [ "///Q/78", "///Q/80" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -49.209, "beta": 166.232, "gamma": 42.180, "delta": 77.877, "epsilon": -146.475, "zeta": -76.063, "epsilon_zeta": -70.412, "bb_type": "BI", "chi": -168.087, "glyco_bond": "anti", "C5prime_xyz": [ -1.205, 8.619, 1.054 ], "P_xyz": [ 1.397, 8.792, 1.451 ], "form": "A", "ssZp": 4.644, "Dp": 4.737, "splay_angle": 17.769, "splay_distance": 2.794, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 161.789, "theta": -149.906, "eta_prime": -178.936, "theta_prime": -147.138, "eta_base": -110.159, "theta_base": -129.985, "v0": 9.870, "v1": -33.174, "v2": 42.700, "v3": -38.277, "v4": 18.052, "amplitude": 42.918, "phase_angle": 5.772, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.312, "filter_rmsd": 0.069, "frame": { "rmsd": 0.008, "origin": [ 11.945, 76.922, 35.413 ], "x_axis": [ 0.423, 0.061, -0.904 ], "y_axis": [ 0.795, 0.454, 0.403 ], "z_axis": [ 0.435, -0.889, 0.143 ], "quaternion": [ 0.711, 0.454, 0.471, -0.258 ] } }, { "index": 247, "index_chain": 80, "chain_name": "Q", "nt_resnum": 80, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/80", "linked_nts": [ "///Q/79", "///Q/81" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.693, "beta": 170.877, "gamma": 48.069, "delta": 86.310, "epsilon": -157.698, "zeta": -74.799, "epsilon_zeta": -82.899, "bb_type": "BI", "chi": -156.227, "glyco_bond": "anti", "C5prime_xyz": [ -1.372, 8.671, 0.378 ], "P_xyz": [ 1.219, 9.049, 0.556 ], "form": "A", "ssZp": 4.332, "Dp": 4.556, "splay_angle": 19.467, "splay_distance": 3.027, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 171.113, "theta": -151.040, "eta_prime": -176.228, "theta_prime": -152.134, "eta_base": -146.459, "theta_base": -130.299, "v0": 6.752, "v1": -27.049, "v2": 35.663, "v3": -32.883, "v4": 16.629, "amplitude": 36.027, "phase_angle": 8.146, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.829, "filter_rmsd": 0.035, "frame": { "rmsd": 0.007, "origin": [ 11.769, 74.191, 34.845 ], "x_axis": [ 0.714, 0.334, -0.616 ], "y_axis": [ 0.593, 0.178, 0.785 ], "z_axis": [ 0.372, -0.926, -0.071 ], "quaternion": [ 0.675, 0.634, 0.366, -0.096 ] } }, { "index": 248, "index_chain": 81, "chain_name": "Q", "nt_resnum": 81, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/81", "linked_nts": [ "///Q/80", "///Q/82" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,ribose-zipper", "alpha": -82.795, "beta": 174.141, "gamma": 59.841, "delta": 82.062, "epsilon": -157.617, "zeta": -60.954, "epsilon_zeta": -96.663, "bb_type": "BI", "chi": -152.240, "glyco_bond": "anti", "C5prime_xyz": [ -1.137, 8.600, 0.094 ], "P_xyz": [ 1.443, 8.763, -0.361 ], "form": "A", "ssZp": 4.244, "Dp": 4.621, "splay_angle": 27.605, "splay_distance": 4.305, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": 158.504, "theta": -138.190, "eta_prime": 170.883, "theta_prime": -138.244, "eta_base": -151.158, "theta_base": -111.410, "v0": 12.468, "v1": -34.916, "v2": 42.962, "v3": -36.976, "v4": 15.636, "amplitude": 42.995, "phase_angle": 2.264, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.665, "filter_rmsd": 0.035, "frame": { "rmsd": 0.010, "origin": [ 12.391, 71.397, 33.862 ], "x_axis": [ 0.911, 0.391, -0.128 ], "y_axis": [ 0.223, -0.208, 0.952 ], "z_axis": [ 0.346, -0.896, -0.277 ], "quaternion": [ 0.597, 0.774, 0.198, 0.070 ] } }, { "index": 249, "index_chain": 82, "chain_name": "Q", "nt_resnum": 82, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/82", "linked_nts": [ "///Q/81", "///Q/83" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper", "alpha": -72.846, "beta": 171.838, "gamma": 71.089, "delta": 77.321, "epsilon": -149.510, "zeta": -75.096, "epsilon_zeta": -74.414, "bb_type": "BI", "chi": -168.683, "glyco_bond": "anti", "C5prime_xyz": [ -1.513, 8.728, 1.084 ], "P_xyz": [ 1.071, 9.119, 0.964 ], "form": "A", "ssZp": 4.578, "Dp": 4.644, "splay_angle": 24.283, "splay_distance": 3.833, "splay_ratio": 0.213, "d22": 4.307, "d64": 4.551, "eta": 175.106, "theta": -149.234, "eta_prime": -165.418, "theta_prime": -148.295, "eta_base": -117.818, "theta_base": -127.345, "v0": 3.666, "v1": -29.548, "v2": 42.642, "v3": -41.555, "v4": 24.064, "amplitude": 43.922, "phase_angle": 13.870, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.464, "filter_rmsd": 0.069, "frame": { "rmsd": 0.009, "origin": [ 15.478, 69.256, 31.760 ], "x_axis": [ 0.843, 0.271, 0.465 ], "y_axis": [ -0.352, -0.376, 0.857 ], "z_axis": [ 0.407, -0.886, -0.221 ], "quaternion": [ 0.558, 0.781, -0.026, 0.279 ] } }, { "index": 250, "index_chain": 83, "chain_name": "Q", "nt_resnum": 83, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/83", "linked_nts": [ "///Q/82", "///Q/84" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper", "alpha": -66.598, "beta": 171.939, "gamma": 61.460, "delta": 81.379, "epsilon": -144.112, "zeta": -82.791, "epsilon_zeta": -61.322, "bb_type": "BI", "chi": -166.941, "glyco_bond": "anti", "C5prime_xyz": [ -1.639, 8.747, 0.860 ], "P_xyz": [ 0.871, 9.191, 1.197 ], "form": "A", "ssZp": 4.304, "Dp": 4.485, "splay_angle": 20.146, "splay_distance": 3.184, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 178.162, "theta": -152.563, "eta_prime": -171.025, "theta_prime": -143.401, "eta_base": -138.945, "theta_base": -127.513, "v0": 1.067, "v1": -26.362, "v2": 40.355, "v3": -40.910, "v4": 25.058, "amplitude": 42.253, "phase_angle": 17.239, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.855, "filter_rmsd": 0.070, "frame": { "rmsd": 0.009, "origin": [ 18.017, 67.121, 29.839 ], "x_axis": [ 0.488, 0.188, 0.853 ], "y_axis": [ -0.713, -0.478, 0.513 ], "z_axis": [ 0.504, -0.858, -0.099 ], "quaternion": [ 0.477, 0.719, -0.183, 0.472 ] } }, { "index": 251, "index_chain": 84, "chain_name": "Q", "nt_resnum": 84, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/84", "linked_nts": [ "///Q/83", "///Q/85" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -56.071, "beta": 177.600, "gamma": 60.064, "delta": 138.738, "epsilon": -84.314, "zeta": 70.359, "epsilon_zeta": 205.327, "bb_type": "--", "chi": -122.246, "glyco_bond": "anti", "C5prime_xyz": [ -1.726, 8.493, -1.111 ], "P_xyz": [ 0.728, 9.019, -0.503 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -148.405, "theta": 106.060, "eta_prime": -132.205, "theta_prime": 105.144, "eta_base": -120.519, "theta_base": null, "v0": -12.720, "v1": 23.668, "v2": -25.362, "v3": 18.876, "v4": -3.976, "amplitude": 25.741, "phase_angle": 170.162, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.824, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 20.245, 65.009, 28.994 ], "x_axis": [ -0.044, 0.120, 0.992 ], "y_axis": [ -0.729, -0.683, 0.050 ], "z_axis": [ 0.683, -0.721, 0.118 ], "quaternion": [ 0.312, 0.617, -0.247, 0.679 ] } }, { "index": 252, "index_chain": 85, "chain_name": "Q", "nt_resnum": 85, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/85", "linked_nts": [ "///Q/84", "///Q/86" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-stack,ss-non-loop,cap-donor", "alpha": 157.826, "beta": -152.778, "gamma": 171.166, "delta": 145.093, "epsilon": -96.716, "zeta": 88.103, "epsilon_zeta": 175.182, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -109.655, "theta": 89.862, "eta_prime": -118.964, "theta_prime": 69.136, "eta_base": null, "theta_base": null, "v0": -17.098, "v1": 32.714, "v2": -35.964, "v3": 26.483, "v4": -5.961, "amplitude": 36.404, "phase_angle": 171.083, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null }, { "index": 253, "index_chain": 86, "chain_name": "Q", "nt_resnum": 86, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/86", "linked_nts": [ "///Q/85", "///Q/87" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,ribose-zipper,cap-acceptor", "alpha": 101.848, "beta": -153.826, "gamma": 144.792, "delta": 72.046, "epsilon": 80.333, "zeta": 77.610, "epsilon_zeta": 2.723, "bb_type": "--", "chi": -139.204, "glyco_bond": "anti", "C5prime_xyz": [ -0.858, 8.426, -0.667 ], "P_xyz": [ 0.658, 8.333, -2.792 ], "form": ".", "ssZp": 2.963, "Dp": 3.822, "splay_angle": 18.831, "splay_distance": 3.231, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 165.442, "theta": -159.417, "eta_prime": 155.077, "theta_prime": -155.430, "eta_base": null, "theta_base": -119.139, "v0": 17.516, "v1": -41.942, "v2": 48.771, "v3": -40.073, "v4": 14.674, "amplitude": 48.795, "phase_angle": 358.202, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.007, "origin": [ 14.099, 65.378, 24.117 ], "x_axis": [ -0.253, 0.407, -0.878 ], "y_axis": [ -0.882, -0.471, 0.036 ], "z_axis": [ -0.399, 0.783, 0.478 ], "quaternion": [ 0.434, -0.430, 0.276, 0.742 ] } }, { "index": 254, "index_chain": 87, "chain_name": "Q", "nt_resnum": 87, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/87", "linked_nts": [ "///Q/86", "///Q/88" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,ribose-zipper,cap-acceptor,phosphate,splayed-apart", "alpha": -144.592, "beta": 163.128, "gamma": 65.679, "delta": 86.107, "epsilon": -161.336, "zeta": -153.714, "epsilon_zeta": -7.623, "bb_type": "--", "chi": -116.133, "glyco_bond": "anti", "C5prime_xyz": [ -1.521, 8.237, -1.898 ], "P_xyz": [ 0.853, 7.976, -2.950 ], "form": ".", "ssZp": 2.241, "Dp": 4.268, "splay_angle": 151.278, "splay_distance": 18.109, "splay_ratio": 0.969, "d22": null, "d64": null, "eta": 161.237, "theta": 162.655, "eta_prime": -173.298, "theta_prime": 166.140, "eta_base": -128.349, "theta_base": -137.892, "v0": 2.738, "v1": -23.312, "v2": 33.353, "v3": -32.700, "v4": 19.264, "amplitude": 34.400, "phase_angle": 14.169, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.011, "origin": [ 11.671, 67.402, 24.781 ], "x_axis": [ -0.680, 0.038, -0.732 ], "y_axis": [ -0.709, -0.291, 0.643 ], "z_axis": [ -0.189, 0.956, 0.225 ], "quaternion": [ 0.252, -0.311, 0.539, 0.741 ] } }, { "index": 255, "index_chain": 88, "chain_name": "Q", "nt_resnum": 88, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/88", "linked_nts": [ "///Q/87", "///Q/89" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,ribose-zipper,splayed-apart", "alpha": 46.245, "beta": 147.922, "gamma": 58.143, "delta": 82.872, "epsilon": -128.589, "zeta": -83.508, "epsilon_zeta": -45.081, "bb_type": "--", "chi": 171.973, "glyco_bond": "anti", "C5prime_xyz": [ -1.388, 8.043, 2.148 ], "P_xyz": [ 1.199, 8.104, 2.265 ], "form": "A", "ssZp": 4.760, "Dp": 4.778, "splay_angle": 23.915, "splay_distance": 3.721, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": -78.565, "theta": -133.138, "eta_prime": -93.371, "theta_prime": -132.383, "eta_base": -138.449, "theta_base": -104.275, "v0": 12.616, "v1": -35.028, "v2": 42.713, "v3": -36.728, "v4": 15.291, "amplitude": 42.736, "phase_angle": 1.906, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3d", "suiteness": 0.058, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 0.832, 70.044, 39.045 ], "x_axis": [ -0.660, -0.057, -0.749 ], "y_axis": [ 0.748, -0.135, -0.650 ], "z_axis": [ -0.064, -0.989, 0.132 ], "quaternion": [ -0.290, -0.293, -0.590, 0.694 ] } }, { "index": 256, "index_chain": 89, "chain_name": "Q", "nt_resnum": 89, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/89", "linked_nts": [ "///Q/88", "///Q/90" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -42.154, "beta": 164.615, "gamma": 37.054, "delta": 82.651, "epsilon": -151.378, "zeta": -80.425, "epsilon_zeta": -70.953, "bb_type": "BI", "chi": -161.454, "glyco_bond": "anti", "C5prime_xyz": [ -1.218, 8.758, 0.641 ], "P_xyz": [ 1.416, 9.013, 0.994 ], "form": "A", "ssZp": 4.514, "Dp": 4.670, "splay_angle": 22.280, "splay_distance": 3.540, "splay_ratio": 0.195, "d22": 4.545, "d64": 4.653, "eta": 166.663, "theta": -150.990, "eta_prime": -176.666, "theta_prime": -150.352, "eta_base": -127.340, "theta_base": -137.132, "v0": 7.967, "v1": -30.572, "v2": 40.217, "v3": -36.622, "v4": 18.125, "amplitude": 40.561, "phase_angle": 7.460, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.305, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ -1.557, 67.233, 39.538 ], "x_axis": [ -0.012, -0.225, -0.974 ], "y_axis": [ 0.991, -0.133, 0.019 ], "z_axis": [ -0.134, -0.965, 0.225 ], "quaternion": [ 0.520, 0.474, 0.404, -0.585 ] } }, { "index": 257, "index_chain": 90, "chain_name": "Q", "nt_resnum": 90, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/90", "linked_nts": [ "///Q/89", "///Q/91" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.604, "beta": 167.538, "gamma": 49.136, "delta": 80.429, "epsilon": -145.003, "zeta": -78.898, "epsilon_zeta": -66.105, "bb_type": "BI", "chi": -158.690, "glyco_bond": "anti", "C5prime_xyz": [ -1.448, 8.741, 0.453 ], "P_xyz": [ 1.158, 9.248, 0.394 ], "form": "A", "ssZp": 4.386, "Dp": 4.681, "splay_angle": 22.783, "splay_distance": 3.592, "splay_ratio": 0.199, "d22": 4.198, "d64": 4.190, "eta": 169.843, "theta": -149.048, "eta_prime": 179.652, "theta_prime": -148.446, "eta_base": -154.786, "theta_base": -121.361, "v0": 8.207, "v1": -33.271, "v2": 44.225, "v3": -40.840, "v4": 20.536, "amplitude": 44.695, "phase_angle": 8.317, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.872, "filter_rmsd": 0.112, "frame": { "rmsd": 0.012, "origin": [ -3.735, 64.537, 40.262 ], "x_axis": [ 0.398, -0.200, -0.895 ], "y_axis": [ 0.890, -0.151, 0.430 ], "z_axis": [ -0.222, -0.968, 0.118 ], "quaternion": [ 0.584, 0.598, 0.288, -0.467 ] } }, { "index": 258, "index_chain": 91, "chain_name": "Q", "nt_resnum": 91, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/91", "linked_nts": [ "///Q/90", "///Q/92" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -56.371, "beta": 162.371, "gamma": 50.579, "delta": 75.634, "epsilon": -154.179, "zeta": -66.004, "epsilon_zeta": -88.175, "bb_type": "BI", "chi": -159.238, "glyco_bond": "anti", "C5prime_xyz": [ -1.189, 8.738, 0.574 ], "P_xyz": [ 1.386, 9.136, 0.456 ], "form": "A", "ssZp": 4.391, "Dp": 4.629, "splay_angle": 24.925, "splay_distance": 3.873, "splay_ratio": 0.218, "d22": 3.943, "d64": 4.243, "eta": 167.241, "theta": -147.728, "eta_prime": -179.839, "theta_prime": -144.657, "eta_base": -137.496, "theta_base": -118.051, "v0": 10.638, "v1": -36.398, "v2": 46.879, "v3": -42.057, "v4": 19.792, "amplitude": 47.125, "phase_angle": 5.863, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.826, "filter_rmsd": 0.111, "frame": { "rmsd": 0.012, "origin": [ -5.044, 61.417, 39.058 ], "x_axis": [ 0.842, -0.130, -0.523 ], "y_axis": [ 0.510, -0.119, 0.852 ], "z_axis": [ -0.173, -0.984, -0.034 ], "quaternion": [ 0.650, 0.706, 0.134, -0.246 ] } }, { "index": 259, "index_chain": 92, "chain_name": "Q", "nt_resnum": 92, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/92", "linked_nts": [ "///Q/91", "///Q/93" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -71.647, "beta": 179.647, "gamma": 60.012, "delta": 81.390, "epsilon": -148.480, "zeta": -59.920, "epsilon_zeta": -88.560, "bb_type": "BI", "chi": -164.699, "glyco_bond": "anti", "C5prime_xyz": [ -1.580, 8.678, 0.795 ], "P_xyz": [ 1.013, 9.033, 1.079 ], "form": "A", "ssZp": 4.479, "Dp": 4.614, "splay_angle": 24.764, "splay_distance": 3.971, "splay_ratio": 0.218, "d22": 3.813, "d64": 4.143, "eta": 172.000, "theta": -134.761, "eta_prime": -172.945, "theta_prime": -135.174, "eta_base": -132.651, "theta_base": -100.680, "v0": 5.056, "v1": -28.747, "v2": 40.044, "v3": -38.640, "v4": 21.151, "amplitude": 40.925, "phase_angle": 11.907, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.827, "filter_rmsd": 0.107, "frame": { "rmsd": 0.009, "origin": [ -5.112, 58.028, 37.183 ], "x_axis": [ 1.000, 0.005, 0.016 ], "y_axis": [ -0.016, -0.043, 0.999 ], "z_axis": [ 0.006, -0.999, -0.042 ], "quaternion": [ 0.692, 0.722, -0.004, 0.008 ] } }, { "index": 260, "index_chain": 93, "chain_name": "Q", "nt_resnum": 93, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/93", "linked_nts": [ "///Q/92", "///Q/94" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.188, "beta": 169.690, "gamma": 67.088, "delta": 81.725, "epsilon": -153.878, "zeta": -78.752, "epsilon_zeta": -75.126, "bb_type": "BI", "chi": -168.220, "glyco_bond": "anti", "C5prime_xyz": [ -1.664, 8.653, 1.048 ], "P_xyz": [ 0.817, 9.375, 1.099 ], "form": "A", "ssZp": 4.487, "Dp": 4.568, "splay_angle": 18.641, "splay_distance": 2.924, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 169.023, "theta": -158.591, "eta_prime": -171.703, "theta_prime": -159.715, "eta_base": -116.297, "theta_base": -150.915, "v0": 7.206, "v1": -31.109, "v2": 41.352, "v3": -38.390, "v4": 19.900, "amplitude": 41.858, "phase_angle": 8.920, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.622, "filter_rmsd": 0.110, "frame": { "rmsd": 0.009, "origin": [ -2.954, 54.868, 36.123 ], "x_axis": [ 0.762, 0.041, 0.646 ], "y_axis": [ -0.643, -0.060, 0.763 ], "z_axis": [ 0.070, -0.997, -0.019 ], "quaternion": [ 0.649, 0.679, -0.222, 0.264 ] } }, { "index": 261, "index_chain": 94, "chain_name": "Q", "nt_resnum": 94, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/94", "linked_nts": [ "///Q/93", "///Q/95" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.062, "beta": 179.839, "gamma": 34.715, "delta": 80.436, "epsilon": -179.093, "zeta": -74.973, "epsilon_zeta": -104.120, "bb_type": "BI", "chi": -145.117, "glyco_bond": "anti", "C5prime_xyz": [ -1.063, 8.569, -0.301 ], "P_xyz": [ 1.509, 9.014, -0.164 ], "form": "A", "ssZp": 4.040, "Dp": 4.486, "splay_angle": 23.261, "splay_distance": 3.732, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 162.833, "theta": -139.293, "eta_prime": 171.024, "theta_prime": -140.446, "eta_base": -167.396, "theta_base": -110.764, "v0": 12.072, "v1": -34.113, "v2": 41.847, "v3": -36.369, "v4": 15.406, "amplitude": 41.886, "phase_angle": 2.485, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.431, "filter_rmsd": 0.032, "frame": { "rmsd": 0.016, "origin": [ -2.220, 52.717, 34.284 ], "x_axis": [ 0.375, -0.028, 0.927 ], "y_axis": [ -0.878, -0.330, 0.345 ], "z_axis": [ 0.296, -0.943, -0.149 ], "quaternion": [ 0.473, 0.681, -0.333, 0.449 ] } }, { "index": 262, "index_chain": 95, "chain_name": "Q", "nt_resnum": 95, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/95", "linked_nts": [ "///Q/94", "///Q/96" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 165.633, "beta": -140.169, "gamma": 155.062, "delta": 77.985, "epsilon": -137.950, "zeta": -73.173, "epsilon_zeta": -64.777, "bb_type": "BI", "chi": -167.365, "glyco_bond": "anti", "C5prime_xyz": [ -1.113, 8.628, 1.203 ], "P_xyz": [ 1.101, 9.384, 0.005 ], "form": "A", "ssZp": 4.550, "Dp": 4.699, "splay_angle": 21.339, "splay_distance": 3.441, "splay_ratio": 0.188, "d22": 4.057, "d64": 4.204, "eta": 168.563, "theta": -147.917, "eta_prime": -173.203, "theta_prime": -147.028, "eta_base": -126.228, "theta_base": -124.077, "v0": 11.462, "v1": -32.721, "v2": 40.638, "v3": -34.953, "v4": 14.841, "amplitude": 40.679, "phase_angle": 2.569, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.152, "filter_rmsd": 0.067, "frame": { "rmsd": 0.011, "origin": [ 0.279, 50.103, 35.209 ], "x_axis": [ -0.183, -0.132, 0.974 ], "y_axis": [ -0.904, -0.368, -0.219 ], "z_axis": [ 0.387, -0.921, -0.052 ], "quaternion": [ 0.315, 0.556, -0.465, 0.612 ] } }, { "index": 263, "index_chain": 96, "chain_name": "Q", "nt_resnum": 96, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/96", "linked_nts": [ "///Q/95", "///Q/97" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop,splayed-apart", "alpha": -57.949, "beta": 169.281, "gamma": 50.014, "delta": 78.140, "epsilon": -157.850, "zeta": 122.755, "epsilon_zeta": 79.395, "bb_type": "--", "chi": -155.066, "glyco_bond": "anti", "C5prime_xyz": [ -1.856, 8.832, 0.242 ], "P_xyz": [ 0.670, 9.421, 0.399 ], "form": ".", "ssZp": 4.206, "Dp": 4.473, "splay_angle": 170.514, "splay_distance": 18.376, "splay_ratio": 0.997, "d22": 10.684, "d64": 13.942, "eta": 166.141, "theta": 29.064, "eta_prime": -176.080, "theta_prime": 23.042, "eta_base": -136.923, "theta_base": 164.987, "v0": -0.723, "v1": -24.627, "v2": 39.311, "v3": -41.518, "v4": 26.052, "amplitude": 41.793, "phase_angle": 19.845, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.878, "filter_rmsd": 0.110, "frame": { "rmsd": 0.012, "origin": [ 2.403, 47.717, 36.488 ], "x_axis": [ -0.655, -0.177, 0.735 ], "y_axis": [ -0.643, -0.382, -0.664 ], "z_axis": [ 0.398, -0.907, 0.136 ], "quaternion": [ 0.158, 0.384, -0.533, 0.737 ] } }, { "index": 264, "index_chain": 97, "chain_name": "Q", "nt_resnum": 97, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/97", "linked_nts": [ "///Q/96", "///Q/98" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,internal-loop,splayed-apart", "alpha": -75.118, "beta": -142.615, "gamma": 53.754, "delta": 142.157, "epsilon": -102.796, "zeta": -69.135, "epsilon_zeta": -33.661, "bb_type": "--", "chi": -130.137, "glyco_bond": "anti", "C5prime_xyz": [ -1.559, 8.708, -0.653 ], "P_xyz": [ 0.325, 9.407, 1.050 ], "form": ".", "ssZp": 1.259, "Dp": 1.307, "splay_angle": 110.785, "splay_distance": 17.416, "splay_ratio": 0.823, "d22": null, "d64": null, "eta": -120.449, "theta": -56.431, "eta_prime": -89.430, "theta_prime": -73.150, "eta_base": 125.578, "theta_base": -81.518, "v0": -20.059, "v1": 33.361, "v2": -33.416, "v3": 22.831, "v4": -1.861, "amplitude": 34.695, "phase_angle": 164.393, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.010, "filter_rmsd": 0.114, "frame": { "rmsd": 0.015, "origin": [ 1.749, 35.270, 22.986 ], "x_axis": [ 0.546, 0.658, -0.519 ], "y_axis": [ -0.156, 0.688, 0.709 ], "z_axis": [ 0.824, -0.306, 0.478 ], "quaternion": [ 0.823, 0.308, 0.408, 0.247 ] } }, { "index": 265, "index_chain": 98, "chain_name": "Q", "nt_resnum": 98, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/98", "linked_nts": [ "///Q/97", "///Q/99" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper,splayed-apart", "alpha": -64.351, "beta": 144.736, "gamma": 168.020, "delta": 83.033, "epsilon": -128.589, "zeta": -88.545, "epsilon_zeta": -40.043, "bb_type": "--", "chi": -155.036, "glyco_bond": "anti", "C5prime_xyz": [ -1.777, 8.761, 0.218 ], "P_xyz": [ -1.323, 10.716, -1.421 ], "form": "B", "ssZp": 3.901, "Dp": 4.462, "splay_angle": 19.241, "splay_distance": 3.154, "splay_ratio": 0.170, "d22": null, "d64": null, "eta": -97.075, "theta": 171.797, "eta_prime": -64.606, "theta_prime": -177.994, "eta_base": -40.295, "theta_base": -136.704, "v0": 0.670, "v1": -25.681, "v2": 39.318, "v3": -39.741, "v4": 24.928, "amplitude": 41.243, "phase_angle": 17.571, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "2h", "suiteness": 0.509, "filter_rmsd": 0.043, "frame": { "rmsd": 0.015, "origin": [ 6.472, 35.727, 39.743 ], "x_axis": [ -0.581, -0.186, 0.793 ], "y_axis": [ -0.804, -0.022, -0.594 ], "z_axis": [ 0.127, -0.982, -0.137 ], "quaternion": [ -0.255, -0.380, 0.651, -0.605 ] } }, { "index": 266, "index_chain": 99, "chain_name": "Q", "nt_resnum": 99, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/99", "linked_nts": [ "///Q/98", "///Q/100" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,A-minor,ribose-zipper", "alpha": -67.379, "beta": 151.835, "gamma": 54.712, "delta": 79.541, "epsilon": -161.848, "zeta": -59.144, "epsilon_zeta": -102.704, "bb_type": "BI", "chi": -149.989, "glyco_bond": "anti", "C5prime_xyz": [ -1.449, 8.737, -0.152 ], "P_xyz": [ 0.973, 8.870, -0.999 ], "form": "A", "ssZp": 4.130, "Dp": 4.632, "splay_angle": 19.094, "splay_distance": 3.174, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 153.576, "theta": -137.844, "eta_prime": 169.988, "theta_prime": -146.019, "eta_base": -141.006, "theta_base": -132.221, "v0": 1.785, "v1": -27.745, "v2": 41.655, "v3": -41.538, "v4": 25.546, "amplitude": 43.406, "phase_angle": 16.327, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.565, "filter_rmsd": 0.041, "frame": { "rmsd": 0.014, "origin": [ 6.240, 32.584, 39.890 ], "x_axis": [ -0.942, -0.055, 0.331 ], "y_axis": [ -0.322, -0.134, -0.937 ], "z_axis": [ 0.096, -0.989, 0.108 ], "quaternion": [ 0.090, 0.145, -0.652, 0.739 ] } }, { "index": 267, "index_chain": 100, "chain_name": "Q", "nt_resnum": 100, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/100", "linked_nts": [ "///Q/99", "///Q/101" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -109.815, "beta": 166.763, "gamma": 94.753, "delta": 76.912, "epsilon": -151.258, "zeta": -56.310, "epsilon_zeta": -94.949, "bb_type": "BI", "chi": -168.070, "glyco_bond": "anti", "C5prime_xyz": [ -1.895, 8.800, 0.710 ], "P_xyz": [ 0.186, 9.678, -0.616 ], "form": ".", "ssZp": 4.537, "Dp": 4.655, "splay_angle": 34.838, "splay_distance": 5.451, "splay_ratio": 0.302, "d22": null, "d64": null, "eta": 160.187, "theta": -135.879, "eta_prime": 178.522, "theta_prime": -138.662, "eta_base": -145.967, "theta_base": -99.401, "v0": -7.168, "v1": -23.870, "v2": 44.190, "v3": -47.724, "v4": 35.640, "amplitude": 49.213, "phase_angle": 26.111, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.043, "frame": { "rmsd": 0.015, "origin": [ 5.931, 30.001, 41.708 ], "x_axis": [ -0.999, -0.016, -0.047 ], "y_axis": [ 0.050, -0.310, -0.949 ], "z_axis": [ 0.000, -0.950, 0.311 ], "quaternion": [ -0.020, -0.014, -0.587, 0.809 ] } }, { "index": 268, "index_chain": 101, "chain_name": "Q", "nt_resnum": 101, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/101", "linked_nts": [ "///Q/100", "///Q/102" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -77.213, "beta": 175.446, "gamma": 65.507, "delta": 79.485, "epsilon": -115.068, "zeta": -62.942, "epsilon_zeta": -52.127, "bb_type": "--", "chi": -176.915, "glyco_bond": "anti", "C5prime_xyz": [ -1.552, 8.578, 1.401 ], "P_xyz": [ 1.028, 9.203, 1.511 ], "form": ".", "ssZp": 4.797, "Dp": 4.870, "splay_angle": 47.399, "splay_distance": 7.101, "splay_ratio": 0.402, "d22": 3.289, "d64": 3.877, "eta": 173.727, "theta": -108.654, "eta_prime": -167.690, "theta_prime": -103.431, "eta_base": -107.001, "theta_base": -51.364, "v0": 5.033, "v1": -31.081, "v2": 44.049, "v3": -40.704, "v4": 23.055, "amplitude": 44.955, "phase_angle": 11.526, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.611, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ 1.930, 26.353, 42.335 ], "x_axis": [ -0.567, -0.105, -0.817 ], "y_axis": [ 0.823, -0.129, -0.554 ], "z_axis": [ -0.047, -0.986, 0.159 ], "quaternion": [ -0.341, -0.317, -0.565, 0.681 ] } }, { "index": 269, "index_chain": 102, "chain_name": "Q", "nt_resnum": 102, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/102", "linked_nts": [ "///Q/101", "///Q/103" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -52.076, "beta": 170.507, "gamma": 42.647, "delta": 84.447, "epsilon": -130.542, "zeta": -67.910, "epsilon_zeta": -62.632, "bb_type": "BI", "chi": -167.131, "glyco_bond": "anti", "C5prime_xyz": [ -0.896, 8.576, 0.968 ], "P_xyz": [ 1.682, 8.634, 1.470 ], "form": "A", "ssZp": 4.544, "Dp": 4.741, "splay_angle": 23.838, "splay_distance": 3.791, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 162.604, "theta": -129.252, "eta_prime": -168.284, "theta_prime": -127.945, "eta_base": -91.433, "theta_base": -97.423, "v0": 10.608, "v1": -31.329, "v2": 39.372, "v3": -34.210, "v4": 14.880, "amplitude": 39.441, "phase_angle": 3.378, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.347, "filter_rmsd": 0.068, "frame": { "rmsd": 0.010, "origin": [ 1.691, 22.451, 36.406 ], "x_axis": [ 0.739, 0.119, -0.663 ], "y_axis": [ 0.670, -0.018, 0.742 ], "z_axis": [ 0.076, -0.993, -0.093 ], "quaternion": [ 0.638, 0.680, 0.290, -0.216 ] } }, { "index": 270, "index_chain": 103, "chain_name": "Q", "nt_resnum": 103, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/103", "linked_nts": [ "///Q/102", "///Q/104" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -78.364, "beta": 167.638, "gamma": 57.018, "delta": 79.081, "epsilon": -120.063, "zeta": -92.598, "epsilon_zeta": -27.465, "bb_type": "--", "chi": -171.796, "glyco_bond": "anti", "C5prime_xyz": [ -1.627, 8.521, 1.159 ], "P_xyz": [ 0.872, 9.221, 1.094 ], "form": "A", "ssZp": 4.665, "Dp": 4.820, "splay_angle": 25.250, "splay_distance": 3.903, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 155.403, "theta": -143.201, "eta_prime": 173.956, "theta_prime": -139.038, "eta_base": -136.989, "theta_base": -98.092, "v0": 8.622, "v1": -34.096, "v2": 45.172, "v3": -41.558, "v4": 20.752, "amplitude": 45.618, "phase_angle": 8.022, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.715, "filter_rmsd": 0.034, "frame": { "rmsd": 0.015, "origin": [ 2.723, 19.505, 34.255 ], "x_axis": [ 0.940, 0.334, -0.067 ], "y_axis": [ 0.119, -0.138, 0.983 ], "z_axis": [ 0.319, -0.932, -0.170 ], "quaternion": [ 0.639, 0.750, 0.151, 0.084 ] } }, { "index": 271, "index_chain": 104, "chain_name": "Q", "nt_resnum": 104, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/104", "linked_nts": [ "///Q/103", "///Q/105" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -50.147, "beta": 143.383, "gamma": 60.268, "delta": 77.054, "epsilon": -156.689, "zeta": -80.865, "epsilon_zeta": -75.824, "bb_type": "BI", "chi": -168.851, "glyco_bond": "anti", "C5prime_xyz": [ -1.591, 8.677, 1.088 ], "P_xyz": [ 0.934, 9.065, 0.512 ], "form": ".", "ssZp": 4.699, "Dp": 4.736, "splay_angle": 30.082, "splay_distance": 4.788, "splay_ratio": 0.264, "d22": 5.168, "d64": 5.747, "eta": 165.971, "theta": -158.665, "eta_prime": -175.158, "theta_prime": -162.127, "eta_base": -116.156, "theta_base": -160.494, "v0": 5.978, "v1": -31.883, "v2": 43.571, "v3": -41.028, "v4": 22.559, "amplitude": 44.365, "phase_angle": 10.860, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.849, "filter_rmsd": 0.110, "frame": { "rmsd": 0.009, "origin": [ 5.980, 17.817, 32.923 ], "x_axis": [ 0.762, 0.223, 0.608 ], "y_axis": [ -0.467, -0.461, 0.754 ], "z_axis": [ 0.449, -0.859, -0.247 ], "quaternion": [ 0.513, 0.786, -0.078, 0.336 ] } }, { "index": 272, "index_chain": 105, "chain_name": "Q", "nt_resnum": 105, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/105", "linked_nts": [ "///Q/104", "///Q/106" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.768, "beta": -178.872, "gamma": 58.147, "delta": 76.480, "epsilon": -157.217, "zeta": -70.307, "epsilon_zeta": -86.910, "bb_type": "BI", "chi": -169.232, "glyco_bond": "anti", "C5prime_xyz": [ -1.823, 8.739, 1.018 ], "P_xyz": [ 0.682, 9.392, 1.417 ], "form": "A", "ssZp": 4.606, "Dp": 4.639, "splay_angle": 19.108, "splay_distance": 2.928, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 171.882, "theta": -151.527, "eta_prime": 176.246, "theta_prime": -148.678, "eta_base": -171.433, "theta_base": -108.624, "v0": 1.250, "v1": -29.334, "v2": 44.400, "v3": -45.130, "v4": 27.736, "amplitude": 46.477, "phase_angle": 17.193, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.779, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ 7.835, 15.642, 29.082 ], "x_axis": [ 0.515, 0.259, 0.817 ], "y_axis": [ -0.662, -0.485, 0.571 ], "z_axis": [ 0.544, -0.835, -0.078 ], "quaternion": [ 0.488, 0.721, -0.140, 0.472 ] } }, { "index": 273, "index_chain": 106, "chain_name": "Q", "nt_resnum": 106, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/106", "linked_nts": [ "///Q/105", "///Q/107" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -73.252, "beta": 177.612, "gamma": 55.831, "delta": 82.691, "epsilon": -155.816, "zeta": -75.435, "epsilon_zeta": -80.381, "bb_type": "BI", "chi": -155.114, "glyco_bond": "anti", "C5prime_xyz": [ -1.217, 8.649, 0.235 ], "P_xyz": [ 1.411, 8.818, 0.244 ], "form": "A", "ssZp": 4.307, "Dp": 4.602, "splay_angle": 22.792, "splay_distance": 3.511, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 165.770, "theta": -151.174, "eta_prime": 179.180, "theta_prime": -153.480, "eta_base": -127.022, "theta_base": -136.098, "v0": 10.290, "v1": -33.867, "v2": 43.178, "v3": -38.228, "v4": 17.722, "amplitude": 43.348, "phase_angle": 5.071, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.859, "filter_rmsd": 0.036, "frame": { "rmsd": 0.010, "origin": [ 10.448, 14.369, 29.435 ], "x_axis": [ -0.042, -0.111, 0.993 ], "y_axis": [ -0.700, -0.706, -0.108 ], "z_axis": [ 0.713, -0.699, -0.048 ], "quaternion": [ 0.226, 0.654, -0.310, 0.652 ] } }, { "index": 274, "index_chain": 107, "chain_name": "Q", "nt_resnum": 107, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/107", "linked_nts": [ "///Q/106", "///Q/108" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.161, "beta": 172.058, "gamma": 52.751, "delta": 77.859, "epsilon": -139.438, "zeta": -74.783, "epsilon_zeta": -64.655, "bb_type": "BI", "chi": -159.307, "glyco_bond": "anti", "C5prime_xyz": [ -1.165, 8.570, 0.536 ], "P_xyz": [ 1.425, 8.802, 0.401 ], "form": "A", "ssZp": 4.389, "Dp": 4.745, "splay_angle": 23.317, "splay_distance": 3.798, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 169.289, "theta": -142.380, "eta_prime": 177.978, "theta_prime": -140.583, "eta_base": -150.307, "theta_base": -123.509, "v0": 11.467, "v1": -36.306, "v2": 45.855, "v3": -41.121, "v4": 18.732, "amplitude": 46.023, "phase_angle": 4.892, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.935, "filter_rmsd": 0.034, "frame": { "rmsd": 0.014, "origin": [ 13.641, 12.909, 29.440 ], "x_axis": [ -0.363, -0.405, 0.839 ], "y_axis": [ -0.554, -0.630, -0.544 ], "z_axis": [ 0.749, -0.662, 0.005 ], "quaternion": [ 0.053, 0.562, -0.427, 0.707 ] } }, { "index": 275, "index_chain": 108, "chain_name": "Q", "nt_resnum": 108, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/108", "linked_nts": [ "///Q/107", "///Q/109" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -56.615, "beta": 175.663, "gamma": 46.573, "delta": 79.076, "epsilon": -148.938, "zeta": -65.874, "epsilon_zeta": -83.064, "bb_type": "BI", "chi": -154.570, "glyco_bond": "anti", "C5prime_xyz": [ -1.532, 8.829, 0.157 ], "P_xyz": [ 0.971, 9.529, 0.210 ], "form": "A", "ssZp": 4.283, "Dp": 4.667, "splay_angle": 24.167, "splay_distance": 3.960, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 169.581, "theta": -142.142, "eta_prime": -179.529, "theta_prime": -140.836, "eta_base": -149.990, "theta_base": -109.749, "v0": 0.764, "v1": -26.690, "v2": 40.477, "v3": -41.499, "v4": 25.591, "amplitude": 42.476, "phase_angle": 17.649, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.839, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 16.452, 11.466, 31.548 ], "x_axis": [ -0.773, -0.443, 0.454 ], "y_axis": [ -0.224, -0.480, -0.848 ], "z_axis": [ 0.594, -0.757, 0.272 ], "quaternion": [ -0.069, 0.330, -0.505, 0.794 ] } }, { "index": 276, "index_chain": 109, "chain_name": "Q", "nt_resnum": 109, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/109", "linked_nts": [ "///Q/108", "///Q/110" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor", "alpha": -72.257, "beta": 174.399, "gamma": 52.823, "delta": 77.613, "epsilon": -141.702, "zeta": -53.501, "epsilon_zeta": -88.201, "bb_type": "BI", "chi": -160.308, "glyco_bond": "anti", "C5prime_xyz": [ -1.595, 8.851, 0.500 ], "P_xyz": [ 0.901, 9.622, 0.206 ], "form": ".", "ssZp": 4.536, "Dp": 4.862, "splay_angle": 82.047, "splay_distance": 11.597, "splay_ratio": 0.656, "d22": null, "d64": null, "eta": 161.651, "theta": -112.263, "eta_prime": 175.797, "theta_prime": -158.212, "eta_base": -138.300, "theta_base": 149.642, "v0": 3.262, "v1": -30.766, "v2": 44.148, "v3": -43.100, "v4": 25.537, "amplitude": 45.558, "phase_angle": 14.290, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.917, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 16.844, 8.547, 34.196 ], "x_axis": [ -0.866, -0.472, -0.166 ], "y_axis": [ 0.307, -0.240, -0.921 ], "z_axis": [ 0.395, -0.848, 0.353 ], "quaternion": [ -0.248, 0.073, -0.564, 0.784 ] } }, { "index": 277, "index_chain": 110, "chain_name": "Q", "nt_resnum": 110, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/110", "linked_nts": [ "///Q/109", "///Q/111" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop", "alpha": 170.390, "beta": 135.328, "gamma": 48.050, "delta": 83.877, "epsilon": -114.377, "zeta": -90.500, "epsilon_zeta": -23.877, "bb_type": "--", "chi": -160.254, "glyco_bond": "anti", "C5prime_xyz": [ -1.525, 8.739, 0.522 ], "P_xyz": [ 1.008, 8.833, 0.055 ], "form": ".", "ssZp": 4.174, "Dp": 4.668, "splay_angle": 27.894, "splay_distance": 4.439, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": 18.782, "theta": -128.128, "eta_prime": 48.202, "theta_prime": -124.734, "eta_base": 25.796, "theta_base": -74.983, "v0": 1.366, "v1": -23.135, "v2": 34.743, "v3": -35.122, "v4": 21.347, "amplitude": 36.263, "phase_angle": 16.645, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.643, "filter_rmsd": 0.110, "frame": { "rmsd": 0.009, "origin": [ 28.093, 6.263, 35.849 ], "x_axis": [ 0.354, 0.621, -0.699 ], "y_axis": [ -0.672, -0.351, -0.652 ], "z_axis": [ -0.651, 0.700, 0.293 ], "quaternion": [ 0.569, -0.594, 0.021, 0.568 ] } }, { "index": 278, "index_chain": 111, "chain_name": "Q", "nt_resnum": 111, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/111", "linked_nts": [ "///Q/110", "///Q/112" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,ribose-zipper,cap-donor,phosphate", "alpha": -52.601, "beta": 142.329, "gamma": 63.742, "delta": 80.801, "epsilon": -158.132, "zeta": -66.313, "epsilon_zeta": -91.819, "bb_type": "BI", "chi": -144.459, "glyco_bond": "anti", "C5prime_xyz": [ -1.222, 8.836, -0.390 ], "P_xyz": [ 1.242, 8.652, -1.193 ], "form": ".", "ssZp": 3.738, "Dp": 4.404, "splay_angle": 17.339, "splay_distance": 2.873, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 165.300, "theta": -143.067, "eta_prime": -167.292, "theta_prime": -149.659, "eta_base": -99.955, "theta_base": -134.716, "v0": 3.349, "v1": -28.399, "v2": 41.015, "v3": -39.626, "v4": 23.184, "amplitude": 42.239, "phase_angle": 13.824, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.974, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 26.395, 9.549, 33.394 ], "x_axis": [ -0.223, 0.014, -0.975 ], "y_axis": [ -0.877, -0.439, 0.194 ], "z_axis": [ -0.426, 0.898, 0.110 ], "quaternion": [ 0.335, -0.526, 0.410, 0.665 ] } }, { "index": 279, "index_chain": 112, "chain_name": "Q", "nt_resnum": 112, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/112", "linked_nts": [ "///Q/111", "///Q/113" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,phosphate", "alpha": -80.032, "beta": -176.954, "gamma": 58.114, "delta": 83.889, "epsilon": -148.226, "zeta": -61.047, "epsilon_zeta": -87.179, "bb_type": "BI", "chi": -127.159, "glyco_bond": "anti", "C5prime_xyz": [ -1.568, 8.504, -1.380 ], "P_xyz": [ 0.890, 8.839, -1.989 ], "form": ".", "ssZp": 2.854, "Dp": 4.525, "splay_angle": 58.163, "splay_distance": 9.373, "splay_ratio": 0.487, "d22": null, "d64": null, "eta": 170.528, "theta": -92.101, "eta_prime": -178.126, "theta_prime": -85.298, "eta_base": -150.908, "theta_base": -56.463, "v0": -0.358, "v1": -23.643, "v2": 36.675, "v3": -38.290, "v4": 24.571, "amplitude": 38.864, "phase_angle": 19.321, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.745, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ 25.272, 12.189, 33.548 ], "x_axis": [ -0.558, -0.197, -0.806 ], "y_axis": [ -0.806, -0.102, 0.583 ], "z_axis": [ -0.197, 0.975, -0.102 ], "quaternion": [ 0.244, -0.402, 0.624, 0.624 ] } }, { "index": 280, "index_chain": 113, "chain_name": "Q", "nt_resnum": 113, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/113", "linked_nts": [ "///Q/112", "///Q/114" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": 137.896, "beta": -131.020, "gamma": 176.985, "delta": 84.250, "epsilon": -148.052, "zeta": -71.486, "epsilon_zeta": -76.567, "bb_type": "BI", "chi": -179.220, "glyco_bond": "anti", "C5prime_xyz": [ -1.002, 8.220, 1.640 ], "P_xyz": [ 0.734, 9.354, 0.053 ], "form": "A", "ssZp": 4.739, "Dp": 4.706, "splay_angle": 24.910, "splay_distance": 3.801, "splay_ratio": 0.219, "d22": 4.641, "d64": 4.719, "eta": 162.846, "theta": -155.933, "eta_prime": -147.654, "theta_prime": -159.640, "eta_base": -86.071, "theta_base": -141.414, "v0": 14.828, "v1": -36.479, "v2": 43.891, "v3": -35.823, "v4": 13.511, "amplitude": 43.895, "phase_angle": 359.163, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.416, "filter_rmsd": 0.067, "frame": { "rmsd": 0.008, "origin": [ 16.141, 11.328, 31.617 ], "x_axis": [ -0.779, -0.444, 0.442 ], "y_axis": [ 0.297, 0.359, 0.885 ], "z_axis": [ -0.552, 0.821, -0.148 ], "quaternion": [ -0.329, -0.049, 0.756, 0.564 ] } }, { "index": 281, "index_chain": 114, "chain_name": "Q", "nt_resnum": 114, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/114", "linked_nts": [ "///Q/113", "///Q/115" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.400, "beta": 179.635, "gamma": 51.351, "delta": 81.434, "epsilon": -151.445, "zeta": -66.857, "epsilon_zeta": -84.588, "bb_type": "BI", "chi": -163.041, "glyco_bond": "anti", "C5prime_xyz": [ -1.247, 8.660, 0.752 ], "P_xyz": [ 1.282, 8.817, 1.388 ], "form": "A", "ssZp": 4.356, "Dp": 4.562, "splay_angle": 17.962, "splay_distance": 2.852, "splay_ratio": 0.157, "d22": 4.457, "d64": 4.130, "eta": 176.746, "theta": -143.613, "eta_prime": -170.496, "theta_prime": -143.124, "eta_base": -138.899, "theta_base": -117.409, "v0": 9.203, "v1": -31.747, "v2": 41.541, "v3": -36.754, "v4": 17.699, "amplitude": 41.772, "phase_angle": 6.029, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.938, "filter_rmsd": 0.112, "frame": { "rmsd": 0.012, "origin": [ 13.479, 13.016, 29.493 ], "x_axis": [ -0.476, -0.221, 0.851 ], "y_axis": [ 0.651, 0.562, 0.510 ], "z_axis": [ -0.591, 0.797, -0.124 ], "quaternion": [ -0.490, 0.146, 0.735, 0.444 ] } }, { "index": 282, "index_chain": 115, "chain_name": "Q", "nt_resnum": 115, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/115", "linked_nts": [ "///Q/114", "///Q/116" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -73.879, "beta": -179.563, "gamma": 54.057, "delta": 76.893, "epsilon": -155.383, "zeta": -71.322, "epsilon_zeta": -84.061, "bb_type": "BI", "chi": -149.257, "glyco_bond": "anti", "C5prime_xyz": [ -1.203, 8.756, -0.072 ], "P_xyz": [ 1.387, 9.136, -0.202 ], "form": "A", "ssZp": 4.165, "Dp": 4.685, "splay_angle": 24.066, "splay_distance": 3.746, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": 162.889, "theta": -154.206, "eta_prime": 176.327, "theta_prime": -152.550, "eta_base": -142.260, "theta_base": -131.838, "v0": 12.204, "v1": -37.467, "v2": 47.017, "v3": -40.656, "v4": 18.308, "amplitude": 47.114, "phase_angle": 3.675, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.888, "filter_rmsd": 0.111, "frame": { "rmsd": 0.010, "origin": [ 10.950, 14.251, 29.027 ], "x_axis": [ -0.085, 0.153, 0.985 ], "y_axis": [ 0.661, 0.748, -0.060 ], "z_axis": [ -0.746, 0.645, -0.165 ], "quaternion": [ 0.612, -0.288, -0.707, -0.207 ] } }, { "index": 283, "index_chain": 116, "chain_name": "Q", "nt_resnum": 116, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/116", "linked_nts": [ "///Q/115", "///Q/117" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -60.383, "beta": 177.162, "gamma": 45.544, "delta": 82.429, "epsilon": -159.092, "zeta": -58.242, "epsilon_zeta": -100.849, "bb_type": "BI", "chi": -157.138, "glyco_bond": "anti", "C5prime_xyz": [ -1.160, 8.609, 0.362 ], "P_xyz": [ 1.451, 8.872, 0.416 ], "form": ".", "ssZp": 4.453, "Dp": 4.684, "splay_angle": 24.952, "splay_distance": 4.446, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 166.739, "theta": -123.999, "eta_prime": 178.193, "theta_prime": -135.047, "eta_base": -147.839, "theta_base": -125.590, "v0": 15.108, "v1": -37.187, "v2": 43.924, "v3": -35.560, "v4": 13.303, "amplitude": 43.938, "phase_angle": 358.546, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.832, "filter_rmsd": 0.036, "frame": { "rmsd": 0.013, "origin": [ 7.633, 15.990, 29.110 ], "x_axis": [ 0.381, 0.344, 0.858 ], "y_axis": [ 0.586, 0.629, -0.512 ], "z_axis": [ -0.715, 0.698, 0.038 ], "quaternion": [ 0.716, -0.423, -0.550, -0.084 ] } }, { "index": 284, "index_chain": 117, "chain_name": "Q", "nt_resnum": 117, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/117", "linked_nts": [ "///Q/116", "///Q/118" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 169.643, "beta": 171.331, "gamma": 177.081, "delta": 85.086, "epsilon": -141.922, "zeta": -66.490, "epsilon_zeta": -75.432, "bb_type": "BI", "chi": 178.884, "glyco_bond": "anti", "C5prime_xyz": [ -1.104, 8.097, 1.805 ], "P_xyz": [ 0.065, 10.304, 1.004 ], "form": "A", "ssZp": 4.783, "Dp": 4.766, "splay_angle": 26.630, "splay_distance": 4.023, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": 175.380, "theta": -170.030, "eta_prime": -174.367, "theta_prime": -158.832, "eta_base": -142.331, "theta_base": -118.130, "v0": 16.388, "v1": -36.637, "v2": 41.554, "v3": -33.484, "v4": 10.891, "amplitude": 41.649, "phase_angle": 356.131, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.607, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 4.280, 17.090, 31.815 ], "x_axis": [ 0.645, 0.481, 0.594 ], "y_axis": [ 0.386, 0.466, -0.796 ], "z_axis": [ -0.660, 0.743, 0.115 ], "quaternion": [ 0.746, -0.516, -0.420, 0.032 ] } }, { "index": 285, "index_chain": 118, "chain_name": "Q", "nt_resnum": 118, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/118", "linked_nts": [ "///Q/117", "///Q/119" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.691, "beta": 178.240, "gamma": 52.728, "delta": 81.416, "epsilon": -147.580, "zeta": -73.788, "epsilon_zeta": -73.793, "bb_type": "BI", "chi": -168.543, "glyco_bond": "anti", "C5prime_xyz": [ -1.452, 8.582, 1.024 ], "P_xyz": [ 1.154, 8.787, 1.282 ], "form": "A", "ssZp": 4.663, "Dp": 4.733, "splay_angle": 22.719, "splay_distance": 3.609, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 165.097, "theta": -144.022, "eta_prime": -175.974, "theta_prime": -142.536, "eta_base": -123.066, "theta_base": -123.451, "v0": 9.376, "v1": -34.232, "v2": 44.506, "v3": -40.010, "v4": 19.515, "amplitude": 44.806, "phase_angle": 6.628, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.927, "filter_rmsd": 0.118, "frame": { "rmsd": 0.016, "origin": [ 2.713, 19.805, 34.335 ], "x_axis": [ 0.710, 0.700, -0.078 ], "y_axis": [ -0.148, 0.039, -0.988 ], "z_axis": [ -0.689, 0.713, 0.131 ], "quaternion": [ 0.686, -0.620, -0.223, 0.309 ] } }, { "index": 286, "index_chain": 119, "chain_name": "Q", "nt_resnum": 119, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/119", "linked_nts": [ "///Q/118", "///Q/120" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -52.725, "beta": -168.268, "gamma": 28.988, "delta": 80.269, "epsilon": -153.935, "zeta": -62.923, "epsilon_zeta": -91.013, "bb_type": "BI", "chi": -149.108, "glyco_bond": "anti", "C5prime_xyz": [ -1.050, 8.644, -0.040 ], "P_xyz": [ 1.347, 9.202, 0.824 ], "form": "A", "ssZp": 4.006, "Dp": 4.658, "splay_angle": 20.009, "splay_distance": 3.248, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 175.632, "theta": -150.258, "eta_prime": -179.197, "theta_prime": -145.737, "eta_base": -151.969, "theta_base": -124.633, "v0": 11.205, "v1": -33.567, "v2": 41.922, "v3": -36.286, "v4": 16.154, "amplitude": 41.996, "phase_angle": 3.401, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.178, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 1.637, 22.462, 36.528 ], "x_axis": [ 0.672, 0.355, -0.650 ], "y_axis": [ -0.606, -0.239, -0.758 ], "z_axis": [ -0.425, 0.904, 0.055 ], "quaternion": [ 0.610, -0.681, 0.092, 0.394 ] } }, { "index": 287, "index_chain": 120, "chain_name": "Q", "nt_resnum": 120, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/120", "linked_nts": [ "///Q/119", "///Q/121" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -72.942, "beta": 170.105, "gamma": 54.628, "delta": 74.334, "epsilon": -156.287, "zeta": -64.746, "epsilon_zeta": -91.541, "bb_type": "BI", "chi": -149.491, "glyco_bond": "anti", "C5prime_xyz": [ -1.340, 8.811, -0.123 ], "P_xyz": [ 1.114, 9.340, -0.686 ], "form": ".", "ssZp": 4.118, "Dp": 4.671, "splay_angle": 22.483, "splay_distance": 3.980, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 158.954, "theta": -151.638, "eta_prime": 173.679, "theta_prime": -155.509, "eta_base": -152.749, "theta_base": -161.338, "v0": 8.998, "v1": -36.677, "v2": 49.073, "v3": -44.447, "v4": 22.742, "amplitude": 49.568, "phase_angle": 8.107, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.816, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 1.255, 25.635, 37.108 ], "x_axis": [ 0.404, 0.150, -0.902 ], "y_axis": [ -0.884, -0.187, -0.428 ], "z_axis": [ -0.233, 0.971, 0.057 ], "quaternion": [ 0.564, -0.619, 0.296, 0.458 ] } }, { "index": 288, "index_chain": 121, "chain_name": "Q", "nt_resnum": 121, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/121", "linked_nts": [ "///Q/120", "///Q/122" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -61.754, "beta": 163.115, "gamma": 71.738, "delta": 67.188, "epsilon": -152.516, "zeta": -79.299, "epsilon_zeta": -73.217, "bb_type": "BI", "chi": -161.882, "glyco_bond": "anti", "C5prime_xyz": [ -2.204, 8.930, 0.479 ], "P_xyz": [ -0.064, 10.245, -0.002 ], "form": "A", "ssZp": 4.344, "Dp": 4.606, "splay_angle": 19.980, "splay_distance": 3.205, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": -179.085, "theta": -167.913, "eta_prime": -169.909, "theta_prime": -165.388, "eta_base": -164.204, "theta_base": -130.993, "v0": -7.750, "v1": -24.439, "v2": 44.808, "v3": -50.371, "v4": 37.236, "amplitude": 50.385, "phase_angle": 27.215, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.260, "filter_rmsd": 0.035, "frame": { "rmsd": 0.010, "origin": [ 2.637, 28.962, 38.802 ], "x_axis": [ 0.303, 0.044, -0.952 ], "y_axis": [ -0.947, -0.098, -0.306 ], "z_axis": [ -0.106, 0.994, 0.012 ], "quaternion": [ 0.552, -0.589, 0.383, 0.449 ] } }, { "index": 289, "index_chain": 122, "chain_name": "Q", "nt_resnum": 122, "nt_name": "C", "nt_code": "C", "nt_id": "///Q/122", "linked_nts": [ "///Q/121", "///Q/123" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop", "alpha": -64.472, "beta": 157.515, "gamma": 58.636, "delta": 77.050, "epsilon": -149.990, "zeta": -71.719, "epsilon_zeta": -78.272, "bb_type": "BI", "chi": -155.288, "glyco_bond": "anti", "C5prime_xyz": [ -1.565, 8.867, 0.265 ], "P_xyz": [ 0.940, 9.293, -0.308 ], "form": ".", "ssZp": 4.252, "Dp": 4.638, "splay_angle": 45.915, "splay_distance": 7.996, "splay_ratio": 0.402, "d22": null, "d64": null, "eta": 166.335, "theta": -134.656, "eta_prime": 179.106, "theta_prime": -142.584, "eta_base": -135.490, "theta_base": -142.223, "v0": 5.622, "v1": -32.341, "v2": 44.906, "v3": -42.895, "v4": 23.650, "amplitude": 45.856, "phase_angle": 11.685, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.440, "filter_rmsd": 0.069, "frame": { "rmsd": 0.011, "origin": [ 3.547, 31.982, 38.235 ], "x_axis": [ -0.228, 0.036, -0.973 ], "y_axis": [ -0.970, 0.078, 0.231 ], "z_axis": [ 0.084, 0.996, 0.017 ], "quaternion": [ 0.465, -0.411, 0.568, 0.540 ] } }, { "index": 290, "index_chain": 123, "chain_name": "Q", "nt_resnum": 123, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/123", "linked_nts": [ "///Q/122", "///Q/124" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper", "alpha": -175.191, "beta": 164.487, "gamma": -164.121, "delta": 84.645, "epsilon": -138.634, "zeta": -77.305, "epsilon_zeta": -61.328, "bb_type": "BI", "chi": -156.130, "glyco_bond": "anti", "C5prime_xyz": [ -1.435, 8.672, 0.327 ], "P_xyz": [ -0.821, 10.925, -0.848 ], "form": ".", "ssZp": 4.038, "Dp": 4.490, "splay_angle": 18.378, "splay_distance": 2.936, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": -157.382, "theta": 171.682, "eta_prime": -158.023, "theta_prime": -177.160, "eta_base": -152.475, "theta_base": -133.552, "v0": 4.075, "v1": -25.884, "v2": 36.854, "v3": -35.362, "v4": 19.843, "amplitude": 37.756, "phase_angle": 12.548, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1f", "suiteness": 0.279, "filter_rmsd": 0.042, "frame": { "rmsd": 0.016, "origin": [ 6.612, 39.309, 37.312 ], "x_axis": [ -0.417, 0.079, -0.905 ], "y_axis": [ -0.902, -0.155, 0.402 ], "z_axis": [ -0.109, 0.985, 0.136 ], "quaternion": [ 0.375, -0.388, 0.531, 0.653 ] } }, { "index": 291, "index_chain": 124, "chain_name": "Q", "nt_resnum": 124, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/124", "linked_nts": [ "///Q/123", "///Q/125" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,A-minor,ribose-zipper", "alpha": -78.375, "beta": 167.579, "gamma": 62.536, "delta": 81.301, "epsilon": -157.033, "zeta": -67.644, "epsilon_zeta": -89.389, "bb_type": "BI", "chi": -149.588, "glyco_bond": "anti", "C5prime_xyz": [ -1.060, 8.676, -0.259 ], "P_xyz": [ 1.413, 8.763, -1.034 ], "form": "A", "ssZp": 4.023, "Dp": 4.613, "splay_angle": 18.674, "splay_distance": 2.944, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 157.569, "theta": -150.034, "eta_prime": 173.710, "theta_prime": -154.738, "eta_base": -135.535, "theta_base": -140.608, "v0": 2.015, "v1": -26.888, "v2": 40.890, "v3": -40.016, "v4": 24.307, "amplitude": 42.478, "phase_angle": 15.720, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.726, "filter_rmsd": 0.044, "frame": { "rmsd": 0.025, "origin": [ 6.116, 42.176, 36.918 ], "x_axis": [ -0.867, -0.002, -0.498 ], "y_axis": [ -0.497, 0.079, 0.864 ], "z_axis": [ 0.038, 0.997, -0.069 ], "quaternion": [ 0.189, -0.176, 0.710, 0.656 ] } }, { "index": 292, "index_chain": 125, "chain_name": "Q", "nt_resnum": 125, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/125", "linked_nts": [ "///Q/124", "///Q/126" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,A-minor", "alpha": -75.768, "beta": 173.190, "gamma": 59.720, "delta": 79.316, "epsilon": -152.138, "zeta": -57.877, "epsilon_zeta": -94.260, "bb_type": "BI", "chi": -149.305, "glyco_bond": "anti", "C5prime_xyz": [ -0.954, 8.691, -0.085 ], "P_xyz": [ 1.544, 8.936, -0.601 ], "form": "A", "ssZp": 4.086, "Dp": 4.683, "splay_angle": 27.252, "splay_distance": 4.247, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": 166.273, "theta": -138.691, "eta_prime": 176.832, "theta_prime": -137.379, "eta_base": -153.424, "theta_base": -102.389, "v0": 7.056, "v1": -31.922, "v2": 43.430, "v3": -39.892, "v4": 20.919, "amplitude": 44.006, "phase_angle": 9.277, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.831, "filter_rmsd": 0.054, "frame": { "rmsd": 0.028, "origin": [ 6.350, 44.903, 35.835 ], "x_axis": [ -0.993, -0.098, -0.070 ], "y_axis": [ -0.096, 0.294, 0.951 ], "z_axis": [ -0.073, 0.951, -0.302 ], "quaternion": [ -0.001, -0.060, 0.804, 0.591 ] } }, { "index": 293, "index_chain": 126, "chain_name": "Q", "nt_resnum": 126, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/126", "linked_nts": [ "///Q/125", "///Q/127" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop", "alpha": -72.877, "beta": 167.384, "gamma": 56.659, "delta": 82.944, "epsilon": -142.769, "zeta": -69.088, "epsilon_zeta": -73.681, "bb_type": "BI", "chi": -168.859, "glyco_bond": "anti", "C5prime_xyz": [ -1.193, 8.526, 0.965 ], "P_xyz": [ 1.377, 8.879, 0.614 ], "form": "A", "ssZp": 4.656, "Dp": 4.768, "splay_angle": 26.736, "splay_distance": 4.103, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 161.919, "theta": -138.543, "eta_prime": -176.497, "theta_prime": -136.556, "eta_base": -119.492, "theta_base": -104.537, "v0": 15.278, "v1": -36.897, "v2": 44.252, "v3": -35.982, "v4": 13.490, "amplitude": 44.261, "phase_angle": 358.863, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.825, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 3.481, 47.814, 34.680 ], "x_axis": [ -0.799, -0.071, 0.597 ], "y_axis": [ 0.545, 0.335, 0.769 ], "z_axis": [ -0.255, 0.939, -0.229 ], "quaternion": [ -0.277, 0.154, 0.769, 0.556 ] } }, { "index": 294, "index_chain": 127, "chain_name": "Q", "nt_resnum": 127, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/127", "linked_nts": [ "///Q/126", "///Q/128" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.031, "beta": 168.825, "gamma": 64.215, "delta": 80.467, "epsilon": -140.402, "zeta": -89.583, "epsilon_zeta": -50.818, "bb_type": "BI", "chi": -168.826, "glyco_bond": "anti", "C5prime_xyz": [ -1.456, 8.610, 1.018 ], "P_xyz": [ 1.105, 8.980, 1.073 ], "form": "A", "ssZp": 4.506, "Dp": 4.640, "splay_angle": 21.146, "splay_distance": 3.317, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 176.579, "theta": -146.533, "eta_prime": -164.932, "theta_prime": -147.115, "eta_base": -114.024, "theta_base": -121.482, "v0": 6.147, "v1": -31.024, "v2": 43.473, "v3": -40.319, "v4": 21.873, "amplitude": 44.226, "phase_angle": 10.592, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.782, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 0.128, 50.178, 34.571 ], "x_axis": [ -0.252, 0.099, 0.963 ], "y_axis": [ 0.910, 0.362, 0.201 ], "z_axis": [ -0.329, 0.927, -0.181 ], "quaternion": [ -0.482, 0.376, 0.670, 0.421 ] } }, { "index": 295, "index_chain": 128, "chain_name": "Q", "nt_resnum": 128, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/128", "linked_nts": [ "///Q/127", "///Q/129" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -29.565, "beta": 156.785, "gamma": 29.958, "delta": 83.590, "epsilon": -155.926, "zeta": -73.196, "epsilon_zeta": -82.730, "bb_type": "BI", "chi": -156.524, "glyco_bond": "anti", "C5prime_xyz": [ -1.294, 8.735, 0.302 ], "P_xyz": [ 1.362, 9.060, 0.500 ], "form": "A", "ssZp": 4.381, "Dp": 4.623, "splay_angle": 26.086, "splay_distance": 4.135, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 164.927, "theta": -149.351, "eta_prime": 177.749, "theta_prime": -149.293, "eta_base": -139.741, "theta_base": -134.454, "v0": 7.508, "v1": -30.839, "v2": 41.053, "v3": -37.835, "v4": 19.083, "amplitude": 41.494, "phase_angle": 8.361, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.027, "filter_rmsd": 0.105, "frame": { "rmsd": 0.008, "origin": [ -2.243, 52.493, 34.429 ], "x_axis": [ 0.301, 0.271, 0.914 ], "y_axis": [ 0.852, 0.355, -0.386 ], "z_axis": [ -0.429, 0.895, -0.124 ], "quaternion": [ 0.619, -0.517, -0.543, -0.235 ] } }, { "index": 296, "index_chain": 129, "chain_name": "Q", "nt_resnum": 129, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/129", "linked_nts": [ "///Q/128", "///Q/130" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -82.150, "beta": 173.281, "gamma": 68.503, "delta": 77.643, "epsilon": -141.395, "zeta": -68.626, "epsilon_zeta": -72.769, "bb_type": "BI", "chi": -172.669, "glyco_bond": "anti", "C5prime_xyz": [ -1.720, 8.587, 1.267 ], "P_xyz": [ 0.805, 9.262, 1.267 ], "form": "A", "ssZp": 4.685, "Dp": 4.736, "splay_angle": 24.401, "splay_distance": 3.776, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 168.202, "theta": -141.102, "eta_prime": 178.044, "theta_prime": -139.384, "eta_base": -154.011, "theta_base": -96.667, "v0": 4.255, "v1": -29.807, "v2": 42.491, "v3": -41.462, "v4": 23.546, "amplitude": 43.664, "phase_angle": 13.314, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.504, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ -5.283, 55.238, 34.993 ], "x_axis": [ 0.699, 0.174, 0.694 ], "y_axis": [ 0.670, 0.179, -0.720 ], "z_axis": [ -0.249, 0.968, 0.009 ], "quaternion": [ 0.687, -0.615, -0.343, -0.181 ] } }, { "index": 297, "index_chain": 130, "chain_name": "Q", "nt_resnum": 130, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/130", "linked_nts": [ "///Q/129", "///Q/131" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.154, "beta": 170.570, "gamma": 62.735, "delta": 81.291, "epsilon": -145.895, "zeta": -77.208, "epsilon_zeta": -68.687, "bb_type": "BI", "chi": -165.607, "glyco_bond": "anti", "C5prime_xyz": [ -1.381, 8.598, 0.881 ], "P_xyz": [ 1.168, 9.020, 0.808 ], "form": "A", "ssZp": 4.599, "Dp": 4.715, "splay_angle": 21.561, "splay_distance": 3.356, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 170.376, "theta": -149.344, "eta_prime": -172.830, "theta_prime": -149.604, "eta_base": -112.412, "theta_base": -126.343, "v0": 6.873, "v1": -29.920, "v2": 39.829, "v3": -37.207, "v4": 19.328, "amplitude": 40.342, "phase_angle": 9.149, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.813, "filter_rmsd": 0.033, "frame": { "rmsd": 0.011, "origin": [ -4.790, 58.256, 37.208 ], "x_axis": [ 0.969, 0.245, -0.006 ], "y_axis": [ -0.037, 0.122, -0.992 ], "z_axis": [ -0.243, 0.962, 0.127 ], "quaternion": [ 0.745, -0.656, -0.080, 0.095 ] } }, { "index": 298, "index_chain": 131, "chain_name": "Q", "nt_resnum": 131, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/131", "linked_nts": [ "///Q/130", "///Q/132" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.408, "beta": 170.617, "gamma": 49.773, "delta": 80.074, "epsilon": -149.189, "zeta": -65.362, "epsilon_zeta": -83.828, "bb_type": "BI", "chi": -158.440, "glyco_bond": "anti", "C5prime_xyz": [ -1.179, 8.652, 0.494 ], "P_xyz": [ 1.416, 8.943, 0.520 ], "form": "A", "ssZp": 4.429, "Dp": 4.708, "splay_angle": 24.499, "splay_distance": 3.826, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 165.584, "theta": -143.460, "eta_prime": 177.157, "theta_prime": -143.882, "eta_base": -145.020, "theta_base": -116.991, "v0": 10.974, "v1": -33.936, "v2": 42.861, "v3": -37.464, "v4": 16.854, "amplitude": 42.970, "phase_angle": 4.080, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.952, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ -4.939, 61.167, 38.870 ], "x_axis": [ 0.811, 0.184, -0.555 ], "y_axis": [ -0.577, 0.097, -0.811 ], "z_axis": [ -0.095, 0.978, 0.185 ], "quaternion": [ 0.723, -0.618, 0.159, 0.263 ] } }, { "index": 299, "index_chain": 132, "chain_name": "Q", "nt_resnum": 132, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/132", "linked_nts": [ "///Q/131", "///Q/133" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -67.660, "beta": 177.582, "gamma": 49.119, "delta": 79.510, "epsilon": -146.030, "zeta": -75.228, "epsilon_zeta": -70.802, "bb_type": "BI", "chi": -164.149, "glyco_bond": "anti", "C5prime_xyz": [ -0.992, 8.551, 0.815 ], "P_xyz": [ 1.593, 8.956, 1.043 ], "form": "A", "ssZp": 4.531, "Dp": 4.705, "splay_angle": 21.672, "splay_distance": 3.506, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 165.090, "theta": -152.748, "eta_prime": 177.728, "theta_prime": -150.462, "eta_base": -138.388, "theta_base": -142.525, "v0": 14.636, "v1": -36.897, "v2": 44.478, "v3": -37.108, "v4": 14.211, "amplitude": 44.478, "phase_angle": 359.910, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.941, "filter_rmsd": 0.038, "frame": { "rmsd": 0.014, "origin": [ -3.582, 64.656, 39.663 ], "x_axis": [ 0.332, -0.002, -0.943 ], "y_axis": [ -0.943, 0.006, -0.332 ], "z_axis": [ 0.006, 1.000, 0.001 ], "quaternion": [ 0.579, -0.576, 0.410, 0.407 ] } }, { "index": 300, "index_chain": 133, "chain_name": "Q", "nt_resnum": 133, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/133", "linked_nts": [ "///Q/132", "///Q/134" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -76.572, "beta": 167.370, "gamma": 67.487, "delta": 78.025, "epsilon": -140.574, "zeta": -77.032, "epsilon_zeta": -63.542, "bb_type": "BI", "chi": -165.138, "glyco_bond": "anti", "C5prime_xyz": [ -1.657, 8.727, 0.766 ], "P_xyz": [ 0.802, 9.418, 0.169 ], "form": ".", "ssZp": 4.605, "Dp": 4.793, "splay_angle": 27.457, "splay_distance": 4.293, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": 165.277, "theta": -140.778, "eta_prime": 176.844, "theta_prime": -138.394, "eta_base": -163.348, "theta_base": -100.202, "v0": 3.777, "v1": -30.644, "v2": 44.026, "v3": -43.236, "v4": 24.977, "amplitude": 45.374, "phase_angle": 14.004, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.612, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ -1.499, 67.325, 40.575 ], "x_axis": [ 0.015, -0.040, -0.999 ], "y_axis": [ -0.982, 0.188, -0.022 ], "z_axis": [ 0.189, 0.981, -0.037 ], "quaternion": [ 0.540, -0.465, 0.550, 0.436 ] } }, { "index": 301, "index_chain": 134, "chain_name": "Q", "nt_resnum": 134, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/134", "linked_nts": [ "///Q/133", "///Q/135" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": -56.835, "beta": 155.269, "gamma": 66.045, "delta": 82.089, "epsilon": -159.272, "zeta": -68.494, "epsilon_zeta": -90.779, "bb_type": "BI", "chi": -166.727, "glyco_bond": "anti", "C5prime_xyz": [ -1.765, 8.743, 0.889 ], "P_xyz": [ 0.799, 9.243, 0.379 ], "form": ".", "ssZp": 4.559, "Dp": 4.591, "splay_angle": 28.121, "splay_distance": 4.731, "splay_ratio": 0.253, "d22": null, "d64": null, "eta": 170.969, "theta": -144.781, "eta_prime": -165.327, "theta_prime": -151.967, "eta_base": -105.289, "theta_base": -145.600, "v0": 3.894, "v1": -28.509, "v2": 40.791, "v3": -39.154, "v4": 22.498, "amplitude": 41.883, "phase_angle": 13.114, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.625, "filter_rmsd": 0.104, "frame": { "rmsd": 0.008, "origin": [ -0.374, 69.971, 37.388 ], "x_axis": [ -0.634, 0.092, -0.768 ], "y_axis": [ -0.716, 0.305, 0.628 ], "z_axis": [ 0.292, 0.948, -0.127 ], "quaternion": [ 0.369, -0.217, 0.719, 0.548 ] } }, { "index": 302, "index_chain": 135, "chain_name": "Q", "nt_resnum": 135, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/135", "linked_nts": [ "///Q/134", "///Q/136" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop", "alpha": -77.026, "beta": -174.618, "gamma": 55.336, "delta": 69.812, "epsilon": -138.565, "zeta": -90.143, "epsilon_zeta": -48.422, "bb_type": "BI", "chi": -166.633, "glyco_bond": "anti", "C5prime_xyz": [ -2.016, 8.871, 0.879 ], "P_xyz": [ 0.313, 9.919, 1.439 ], "form": ".", "ssZp": 4.552, "Dp": 4.736, "splay_angle": 78.631, "splay_distance": 12.450, "splay_ratio": 0.638, "d22": null, "d64": null, "eta": 169.248, "theta": 162.143, "eta_prime": 174.632, "theta_prime": 163.165, "eta_base": -164.998, "theta_base": 172.308, "v0": -1.672, "v1": -27.381, "v2": 44.326, "v3": -46.672, "v4": 30.407, "amplitude": 47.365, "phase_angle": 20.634, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.581, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 2.868, 72.609, 35.170 ], "x_axis": [ -0.888, 0.033, -0.459 ], "y_axis": [ -0.445, 0.198, 0.873 ], "z_axis": [ 0.120, 0.980, -0.161 ], "quaternion": [ 0.193, -0.137, 0.749, 0.618 ] } }, { "index": 303, "index_chain": 136, "chain_name": "Q", "nt_resnum": 136, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/136", "linked_nts": [ "///Q/135", "///Q/137" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -146.974, "beta": 89.506, "gamma": 174.769, "delta": 75.672, "epsilon": 92.491, "zeta": 71.158, "epsilon_zeta": 21.334, "bb_type": "--", "chi": -161.272, "glyco_bond": "anti", "C5prime_xyz": [ -0.830, 8.412, 0.647 ], "P_xyz": [ -1.574, 10.590, -0.485 ], "form": "A", "ssZp": 3.863, "Dp": 3.968, "splay_angle": 24.175, "splay_distance": 4.131, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": -127.691, "theta": -168.742, "eta_prime": -167.162, "theta_prime": -162.425, "eta_base": 165.622, "theta_base": -125.284, "v0": 22.989, "v1": -44.892, "v2": 48.305, "v3": -36.013, "v4": 8.646, "amplitude": 48.890, "phase_angle": 351.122, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.083, "filter_rmsd": 0.116, "frame": { "rmsd": 0.015, "origin": [ 12.122, 80.646, 37.354 ], "x_axis": [ -0.278, -0.028, -0.960 ], "y_axis": [ -0.945, -0.174, 0.278 ], "z_axis": [ -0.174, 0.984, 0.022 ], "quaternion": [ 0.378, -0.467, 0.520, 0.607 ] } }, { "index": 304, "index_chain": 137, "chain_name": "Q", "nt_resnum": 137, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/137", "linked_nts": [ "///Q/136", "///Q/138" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 69.554, "beta": -172.956, "gamma": 164.046, "delta": 69.572, "epsilon": 92.922, "zeta": 65.656, "epsilon_zeta": 27.266, "bb_type": "--", "chi": -177.767, "glyco_bond": "anti", "C5prime_xyz": [ -1.048, 8.249, 1.564 ], "P_xyz": [ 0.420, 10.063, 0.480 ], "form": "A", "ssZp": 4.191, "Dp": 4.145, "splay_angle": 20.571, "splay_distance": 3.268, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 146.132, "theta": -169.806, "eta_prime": 170.909, "theta_prime": -158.216, "eta_base": -138.140, "theta_base": -127.980, "v0": 19.668, "v1": -44.833, "v2": 51.577, "v3": -41.430, "v4": 14.207, "amplitude": 51.658, "phase_angle": 356.804, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 11.682, 84.262, 35.408 ], "x_axis": [ -0.661, -0.511, -0.550 ], "y_axis": [ -0.579, -0.121, 0.807 ], "z_axis": [ -0.478, 0.851, -0.216 ], "quaternion": [ 0.027, -0.411, 0.662, 0.626 ] } }, { "index": 305, "index_chain": 138, "chain_name": "Q", "nt_resnum": 138, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/138", "linked_nts": [ "///Q/137", "///Q/139" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -145.823, "beta": 179.713, "gamma": 56.795, "delta": 81.237, "epsilon": -156.688, "zeta": -67.186, "epsilon_zeta": -89.502, "bb_type": "BI", "chi": -152.526, "glyco_bond": "anti", "C5prime_xyz": [ -1.374, 8.806, 0.107 ], "P_xyz": [ 1.236, 9.216, 0.183 ], "form": "A", "ssZp": 4.194, "Dp": 4.552, "splay_angle": 18.750, "splay_distance": 3.015, "splay_ratio": 0.163, "d22": null, "d64": null, "eta": 154.320, "theta": -146.053, "eta_prime": 176.679, "theta_prime": -146.976, "eta_base": -141.901, "theta_base": -118.106, "v0": 3.239, "v1": -26.855, "v2": 38.832, "v3": -37.832, "v4": 21.972, "amplitude": 40.013, "phase_angle": 13.960, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 10.811, 86.618, 33.317 ], "x_axis": [ -0.891, -0.453, 0.044 ], "y_axis": [ -0.114, 0.315, 0.942 ], "z_axis": [ -0.440, 0.834, -0.332 ], "quaternion": [ -0.152, -0.178, 0.796, 0.558 ] } }, { "index": 306, "index_chain": 139, "chain_name": "Q", "nt_resnum": 139, "nt_name": "U", "nt_code": "U", "nt_id": "///Q/139", "linked_nts": [ "///Q/138", "///Q/140" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -80.625, "beta": 169.542, "gamma": 65.936, "delta": 77.104, "epsilon": -147.075, "zeta": -68.844, "epsilon_zeta": -78.232, "bb_type": "BI", "chi": -150.220, "glyco_bond": "anti", "C5prime_xyz": [ -1.382, 8.833, -0.007 ], "P_xyz": [ 1.142, 9.222, -0.659 ], "form": "A", "ssZp": 4.129, "Dp": 4.692, "splay_angle": 24.151, "splay_distance": 3.815, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 162.827, "theta": -143.002, "eta_prime": 177.070, "theta_prime": -143.829, "eta_base": -138.470, "theta_base": -112.972, "v0": 7.427, "v1": -32.273, "v2": 43.496, "v3": -40.238, "v4": 20.821, "amplitude": 44.046, "phase_angle": 9.065, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.604, "filter_rmsd": 0.110, "frame": { "rmsd": 0.011, "origin": [ 8.829, 88.249, 31.735 ], "x_axis": [ -0.817, -0.243, 0.523 ], "y_axis": [ 0.244, 0.677, 0.694 ], "z_axis": [ -0.523, 0.695, -0.494 ], "quaternion": [ -0.303, 0.000, 0.864, 0.402 ] } }, { "index": 307, "index_chain": 140, "chain_name": "Q", "nt_resnum": 140, "nt_name": "G", "nt_code": "G", "nt_id": "///Q/140", "linked_nts": [ "///Q/139", "///Q/141" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -81.193, "beta": 176.513, "gamma": 61.750, "delta": 80.394, "epsilon": -165.850, "zeta": -74.213, "epsilon_zeta": -91.637, "bb_type": "BI", "chi": -165.263, "glyco_bond": "anti", "C5prime_xyz": [ -1.316, 8.674, 0.829 ], "P_xyz": [ 1.304, 9.040, 0.738 ], "form": "A", "ssZp": 4.591, "Dp": 4.632, "splay_angle": 21.355, "splay_distance": 3.235, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 157.868, "theta": -159.079, "eta_prime": 174.679, "theta_prime": -151.448, "eta_base": -134.885, "theta_base": -146.168, "v0": 8.785, "v1": -32.912, "v2": 42.897, "v3": -38.943, "v4": 19.227, "amplitude": 43.230, "phase_angle": 7.112, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.699, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 5.412, 89.754, 30.953 ], "x_axis": [ -0.250, -0.067, 0.966 ], "y_axis": [ 0.630, 0.746, 0.215 ], "z_axis": [ -0.735, 0.663, -0.144 ], "quaternion": [ 0.581, -0.193, -0.731, -0.300 ] } }, { "index": 308, "index_chain": 141, "chain_name": "Q", "nt_resnum": 141, "nt_name": "A", "nt_code": "A", "nt_id": "///Q/141", "linked_nts": [ "///Q/140", null ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -77.999, "beta": -163.316, "gamma": 76.574, "delta": 131.598, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -127.971, "glyco_bond": "anti", "C5prime_xyz": [ -1.610, 8.530, -0.906 ], "P_xyz": [ 0.977, 8.808, -0.335 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -12.214, "v1": 20.311, "v2": -20.218, "v3": 13.744, "v4": -1.122, "amplitude": 21.017, "phase_angle": 164.157, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.189, "filter_rmsd": 0.035, "frame": { "rmsd": 0.007, "origin": [ 2.418, 90.193, 29.809 ], "x_axis": [ 0.229, 0.107, 0.968 ], "y_axis": [ 0.444, 0.873, -0.201 ], "z_axis": [ -0.866, 0.476, 0.153 ], "quaternion": [ 0.751, -0.225, -0.611, -0.112 ] } }, { "index": 309, "index_chain": 1, "chain_name": "G", "nt_resnum": -1, "nt_name": "A", "nt_code": "A", "nt_id": "///G/-1", "linked_nts": [ null, "///G/0" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor", "alpha": null, "beta": null, "gamma": -11.931, "delta": 90.945, "epsilon": -132.535, "zeta": 122.368, "epsilon_zeta": 105.097, "bb_type": "--", "chi": -111.963, "glyco_bond": "anti", "C5prime_xyz": [ -4.149, 7.629, -2.235 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 1.918, "Dp": 2.530, "splay_angle": 84.447, "splay_distance": 13.512, "splay_ratio": 0.672, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -48.856, "v1": 28.233, "v2": 1.004, "v3": -28.612, "v4": 47.049, "amplitude": 49.642, "phase_angle": 88.842, "puckering": "O4'-endo", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.014, "origin": [ 18.109, 25.621, 83.087 ], "x_axis": [ -0.749, 0.305, 0.588 ], "y_axis": [ -0.652, -0.188, -0.734 ], "z_axis": [ -0.113, -0.934, 0.340 ], "quaternion": [ 0.317, 0.157, -0.553, 0.755 ] } }, { "index": 310, "index_chain": 2, "chain_name": "G", "nt_resnum": 0, "nt_name": "A2M", "nt_code": "a", "is_modified": true, "nt_id": "///G/0", "linked_nts": [ "///G/-1", "///G/1" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,splayed-apart", "alpha": -54.415, "beta": 172.075, "gamma": 39.601, "delta": 147.863, "epsilon": 179.956, "zeta": 141.493, "epsilon_zeta": 38.463, "bb_type": "--", "chi": -123.764, "glyco_bond": "anti", "C5prime_xyz": [ -2.182, 8.656, -0.894 ], "P_xyz": [ 0.095, 9.723, -0.066 ], "form": ".", "ssZp": 2.184, "Dp": 2.346, "splay_angle": 112.546, "splay_distance": 14.488, "splay_ratio": 0.832, "d22": null, "d64": null, "eta": -174.463, "theta": 122.404, "eta_prime": -147.589, "theta_prime": 91.617, "eta_base": -152.341, "theta_base": 148.885, "v0": -24.205, "v1": 39.251, "v2": -39.033, "v3": 25.458, "v4": -0.869, "amplitude": 40.854, "phase_angle": 162.825, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.050, "filter_rmsd": 0.073, "frame": { "rmsd": 0.059, "origin": [ 25.771, 19.797, 73.603 ], "x_axis": [ 0.026, -0.324, 0.946 ], "y_axis": [ -0.995, 0.078, 0.055 ], "z_axis": [ -0.092, -0.943, -0.321 ], "quaternion": [ -0.443, -0.563, 0.586, -0.379 ] } }, { "index": 311, "index_chain": 3, "chain_name": "G", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///G/1", "linked_nts": [ "///G/0", "///G/2" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-canonical,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -44.999, "beta": 111.520, "gamma": 169.295, "delta": 149.454, "epsilon": -88.554, "zeta": 95.646, "epsilon_zeta": 175.800, "bb_type": "--", "chi": -66.612, "glyco_bond": "--", "C5prime_xyz": [ -2.582, 6.681, -3.229 ], "P_xyz": [ -3.470, 5.632, -5.432 ], "form": ".", "ssZp": -0.421, "Dp": 0.714, "splay_angle": 44.946, "splay_distance": 8.199, "splay_ratio": 0.383, "d22": null, "d64": null, "eta": -8.519, "theta": 65.027, "eta_prime": -39.362, "theta_prime": 54.314, "eta_base": -105.054, "theta_base": 62.097, "v0": -16.194, "v1": 29.963, "v2": -32.122, "v3": 23.297, "v4": -4.567, "amplitude": 32.668, "phase_angle": 169.517, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.032, "frame": { "rmsd": 0.032, "origin": [ 21.180, 23.695, 60.426 ], "x_axis": [ -0.435, -0.421, -0.796 ], "y_axis": [ -0.871, -0.026, 0.490 ], "z_axis": [ -0.227, 0.907, -0.356 ], "quaternion": [ 0.214, -0.486, 0.664, 0.526 ] } }, { "index": 312, "index_chain": 4, "chain_name": "G", "nt_resnum": 2, "nt_name": "C", "nt_code": "C", "nt_id": "///G/2", "linked_nts": [ "///G/1", "///G/3" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor,phosphate", "alpha": 44.003, "beta": 174.534, "gamma": -159.061, "delta": 81.985, "epsilon": -155.692, "zeta": -70.789, "epsilon_zeta": -84.903, "bb_type": "BI", "chi": -172.112, "glyco_bond": "anti", "C5prime_xyz": [ -1.410, 8.529, 1.284 ], "P_xyz": [ -0.828, 10.964, 0.636 ], "form": "A", "ssZp": 4.487, "Dp": 4.600, "splay_angle": 24.998, "splay_distance": 3.921, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 130.256, "theta": 164.077, "eta_prime": 105.536, "theta_prime": 179.571, "eta_base": 121.452, "theta_base": -152.138, "v0": 12.611, "v1": -36.800, "v2": 45.827, "v3": -39.032, "v4": 17.136, "amplitude": 45.879, "phase_angle": 2.743, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "6n", "suiteness": 0.147, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 26.479, 23.312, 66.670 ], "x_axis": [ -0.188, -0.142, -0.972 ], "y_axis": [ -0.978, 0.122, 0.171 ], "z_axis": [ 0.094, 0.982, -0.162 ], "quaternion": [ 0.439, -0.462, 0.606, 0.475 ] } }, { "index": 313, "index_chain": 5, "chain_name": "G", "nt_resnum": 3, "nt_name": "G", "nt_code": "G", "nt_id": "///G/3", "linked_nts": [ "///G/2", "///G/4" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -80.876, "beta": -179.112, "gamma": 61.389, "delta": 79.644, "epsilon": -150.820, "zeta": -71.580, "epsilon_zeta": -79.240, "bb_type": "BI", "chi": -165.475, "glyco_bond": "anti", "C5prime_xyz": [ -1.395, 8.794, 0.893 ], "P_xyz": [ 1.179, 9.074, 1.332 ], "form": "A", "ssZp": 4.437, "Dp": 4.546, "splay_angle": 25.008, "splay_distance": 3.939, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 169.616, "theta": -144.710, "eta_prime": -179.106, "theta_prime": -142.913, "eta_base": -149.346, "theta_base": -114.003, "v0": 3.806, "v1": -28.654, "v2": 41.403, "v3": -39.928, "v4": 22.808, "amplitude": 42.556, "phase_angle": 13.365, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.714, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 28.766, 26.416, 65.956 ], "x_axis": [ -0.652, -0.148, -0.744 ], "y_axis": [ -0.758, 0.163, 0.632 ], "z_axis": [ 0.028, 0.975, -0.218 ], "quaternion": [ 0.271, -0.318, 0.713, 0.564 ] } }, { "index": 314, "index_chain": 6, "chain_name": "G", "nt_resnum": 4, "nt_name": "C", "nt_code": "C", "nt_id": "///G/4", "linked_nts": [ "///G/3", "///G/5" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.737, "beta": 167.587, "gamma": 65.241, "delta": 84.216, "epsilon": -140.409, "zeta": -76.911, "epsilon_zeta": -63.498, "bb_type": "BI", "chi": -167.643, "glyco_bond": "anti", "C5prime_xyz": [ -1.601, 8.733, 0.987 ], "P_xyz": [ 1.004, 9.127, 1.102 ], "form": "A", "ssZp": 4.374, "Dp": 4.521, "splay_angle": 21.473, "splay_distance": 3.645, "splay_ratio": 0.193, "d22": 4.169, "d64": 4.373, "eta": 173.486, "theta": -135.927, "eta_prime": -171.227, "theta_prime": -130.452, "eta_base": -128.001, "theta_base": -113.628, "v0": 5.174, "v1": -27.658, "v2": 38.834, "v3": -36.846, "v4": 19.817, "amplitude": 39.599, "phase_angle": 11.276, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.733, "filter_rmsd": 0.073, "frame": { "rmsd": 0.015, "origin": [ 29.168, 29.588, 63.657 ], "x_axis": [ -0.961, -0.084, -0.262 ], "y_axis": [ -0.274, 0.194, 0.942 ], "z_axis": [ -0.028, 0.977, -0.209 ], "quaternion": [ 0.076, -0.116, 0.769, 0.624 ] } }, { "index": 315, "index_chain": 7, "chain_name": "G", "nt_resnum": 5, "nt_name": "C", "nt_code": "C", "nt_id": "///G/5", "linked_nts": [ "///G/4", "///G/6" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -53.430, "beta": 171.564, "gamma": 57.945, "delta": 138.762, "epsilon": -117.445, "zeta": -167.688, "epsilon_zeta": 50.243, "bb_type": "BII", "chi": -130.931, "glyco_bond": "anti", "C5prime_xyz": [ -2.486, 8.878, -0.740 ], "P_xyz": [ -0.169, 9.929, -0.099 ], "form": ".", "ssZp": 1.959, "Dp": 1.908, "splay_angle": 69.531, "splay_distance": 11.727, "splay_ratio": 0.572, "d22": null, "d64": null, "eta": -172.970, "theta": -175.390, "eta_prime": -144.054, "theta_prime": 157.390, "eta_base": -118.787, "theta_base": 123.230, "v0": -36.155, "v1": 44.168, "v2": -34.860, "v3": 14.917, "v4": 13.259, "amplitude": 43.227, "phase_angle": 143.751, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.862, "filter_rmsd": 0.070, "frame": { "rmsd": 0.011, "origin": [ 28.356, 32.131, 61.175 ], "x_axis": [ -0.933, -0.223, 0.282 ], "y_axis": [ 0.195, 0.346, 0.918 ], "z_axis": [ -0.302, 0.911, -0.280 ], "quaternion": [ -0.182, -0.009, 0.800, 0.572 ] } }, { "index": 316, "index_chain": 8, "chain_name": "G", "nt_resnum": 6, "nt_name": "A", "nt_code": "A", "nt_id": "///G/6", "linked_nts": [ "///G/5", "///G/7" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,bulge,splayed-apart", "alpha": -59.192, "beta": -174.702, "gamma": -72.437, "delta": 154.056, "epsilon": -130.694, "zeta": -98.890, "epsilon_zeta": -31.804, "bb_type": "--", "chi": -117.553, "glyco_bond": "anti", "C5prime_xyz": [ -1.394, 8.219, -1.044 ], "P_xyz": [ -0.468, 10.657, -1.264 ], "form": ".", "ssZp": 1.389, "Dp": 1.527, "splay_angle": 89.243, "splay_distance": 13.503, "splay_ratio": 0.703, "d22": null, "d64": null, "eta": 121.958, "theta": -136.435, "eta_prime": 109.648, "theta_prime": -125.642, "eta_base": 84.797, "theta_base": -91.933, "v0": -5.146, "v1": 26.497, "v2": -36.147, "v3": 34.405, "v4": -18.699, "amplitude": 36.814, "phase_angle": 190.919, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.011, "origin": [ 39.876, 30.005, 60.640 ], "x_axis": [ -0.328, -0.700, 0.635 ], "y_axis": [ -0.585, 0.678, 0.446 ], "z_axis": [ -0.742, -0.225, -0.632 ], "quaternion": [ -0.424, -0.395, 0.812, 0.068 ] } }, { "index": 317, "index_chain": 9, "chain_name": "G", "nt_resnum": 7, "nt_name": "G", "nt_code": "G", "nt_id": "///G/7", "linked_nts": [ "///G/6", "///G/8" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,junction-loop,splayed-apart", "alpha": -53.317, "beta": 166.667, "gamma": 49.933, "delta": 81.505, "epsilon": -129.812, "zeta": -74.414, "epsilon_zeta": -55.398, "bb_type": "BI", "chi": 178.808, "glyco_bond": "anti", "C5prime_xyz": [ -1.778, 8.465, 1.751 ], "P_xyz": [ 0.759, 8.702, 2.523 ], "form": ".", "ssZp": 4.706, "Dp": 4.720, "splay_angle": 32.045, "splay_distance": 4.837, "splay_ratio": 0.276, "d22": null, "d64": null, "eta": -178.757, "theta": -121.816, "eta_prime": -151.074, "theta_prime": -115.958, "eta_base": -112.629, "theta_base": -57.274, "v0": 6.295, "v1": -29.234, "v2": 40.239, "v3": -37.096, "v4": 19.489, "amplitude": 40.816, "phase_angle": 9.649, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.164, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 28.012, 35.485, 57.242 ], "x_axis": [ -0.294, 0.157, 0.943 ], "y_axis": [ 0.952, 0.135, 0.275 ], "z_axis": [ -0.084, 0.978, -0.189 ], "quaternion": [ -0.404, 0.436, 0.636, 0.493 ] } }, { "index": 318, "index_chain": 10, "chain_name": "G", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///G/8", "linked_nts": [ "///G/7", "///G/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop", "alpha": -37.298, "beta": 161.486, "gamma": 35.057, "delta": 82.912, "epsilon": -159.657, "zeta": -64.602, "epsilon_zeta": -95.054, "bb_type": "BI", "chi": -152.749, "glyco_bond": "anti", "C5prime_xyz": [ -1.125, 8.648, 0.245 ], "P_xyz": [ 1.457, 8.721, 0.853 ], "form": ".", "ssZp": 4.088, "Dp": 4.450, "splay_angle": 21.075, "splay_distance": 3.330, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 167.296, "theta": -142.087, "eta_prime": -167.134, "theta_prime": -141.093, "eta_base": -87.833, "theta_base": -108.151, "v0": 11.400, "v1": -31.907, "v2": 39.112, "v3": -33.381, "v4": 14.143, "amplitude": 39.136, "phase_angle": 2.006, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.199, "filter_rmsd": 0.041, "frame": { "rmsd": 0.013, "origin": [ 27.946, 39.154, 60.393 ], "x_axis": [ 0.744, 0.165, 0.648 ], "y_axis": [ 0.655, 0.015, -0.756 ], "z_axis": [ -0.134, 0.986, -0.097 ], "quaternion": [ 0.645, -0.676, -0.303, -0.190 ] } }, { "index": 319, "index_chain": 11, "chain_name": "G", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///G/9", "linked_nts": [ "///G/8", "///G/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -82.407, "beta": 179.938, "gamma": 57.789, "delta": 83.993, "epsilon": -155.770, "zeta": -65.058, "epsilon_zeta": -90.712, "bb_type": "BI", "chi": -147.384, "glyco_bond": "anti", "C5prime_xyz": [ -1.094, 8.584, -0.162 ], "P_xyz": [ 1.557, 8.624, -0.452 ], "form": "A", "ssZp": 4.082, "Dp": 4.630, "splay_angle": 21.259, "splay_distance": 3.365, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 161.213, "theta": -139.364, "eta_prime": 177.848, "theta_prime": -141.186, "eta_base": -133.178, "theta_base": -118.019, "v0": 13.719, "v1": -34.897, "v2": 41.892, "v3": -35.123, "v4": 13.590, "amplitude": 41.892, "phase_angle": 0.043, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.683, "filter_rmsd": 0.032, "frame": { "rmsd": 0.010, "origin": [ 27.934, 42.473, 60.661 ], "x_axis": [ 0.984, 0.160, 0.077 ], "y_axis": [ 0.068, 0.060, -0.996 ], "z_axis": [ -0.164, 0.985, 0.048 ], "quaternion": [ 0.723, -0.685, -0.083, 0.032 ] } }, { "index": 320, "index_chain": 12, "chain_name": "G", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///G/10", "linked_nts": [ "///G/9", "///G/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper,phosphate", "alpha": -84.361, "beta": 171.836, "gamma": 70.403, "delta": 82.130, "epsilon": -134.574, "zeta": -103.358, "epsilon_zeta": -31.216, "bb_type": "--", "chi": -157.608, "glyco_bond": "anti", "C5prime_xyz": [ -1.314, 8.792, 0.455 ], "P_xyz": [ 1.242, 9.166, -0.012 ], "form": "A", "ssZp": 4.357, "Dp": 4.780, "splay_angle": 26.486, "splay_distance": 4.417, "splay_ratio": 0.231, "d22": 4.119, "d64": 4.389, "eta": 170.491, "theta": -135.499, "eta_prime": -176.472, "theta_prime": -140.657, "eta_base": -138.617, "theta_base": -121.094, "v0": 8.249, "v1": -30.040, "v2": 38.939, "v3": -34.864, "v4": 17.196, "amplitude": 39.195, "phase_angle": 6.555, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.409, "filter_rmsd": 0.066, "frame": { "rmsd": 0.007, "origin": [ 28.735, 45.542, 61.784 ], "x_axis": [ 0.888, -0.058, -0.456 ], "y_axis": [ -0.447, 0.126, -0.886 ], "z_axis": [ 0.109, 0.990, 0.086 ], "quaternion": [ 0.725, -0.647, 0.195, 0.134 ] } }, { "index": 321, "index_chain": 13, "chain_name": "G", "nt_resnum": 11, "nt_name": "U", "nt_code": "U", "nt_id": "///G/11", "linked_nts": [ "///G/10", null ], "nt_type": "RNA", "dbn": "(", "summary": "anti,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,ribose-zipper", "alpha": 78.081, "beta": -160.874, "gamma": -108.712, "delta": 119.582, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -164.681, "glyco_bond": "anti", "C5prime_xyz": [ -0.858, 7.932, 1.005 ], "P_xyz": [ 0.889, 9.757, 0.989 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 24.626, "v1": -25.091, "v2": 16.556, "v3": -2.764, "v4": -13.674, "amplitude": 25.732, "phase_angle": 310.046, "puckering": "C1'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.011, "origin": [ 31.014, 49.257, 62.508 ], "x_axis": [ 0.478, -0.322, -0.817 ], "y_axis": [ -0.838, 0.111, -0.534 ], "z_axis": [ 0.263, 0.940, -0.217 ], "quaternion": [ 0.586, -0.629, 0.461, 0.220 ] } }, { "index": 322, "index_chain": 1, "chain_name": "R", "nt_resnum": 12, "nt_name": "GTP", "nt_code": "g", "is_modified": true, "nt_id": "///R/12", "linked_nts": [ null, "///R/13" ], "nt_type": "RNA", "dbn": "(", "summary": "modified,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 101.359, "delta": 78.136, "epsilon": -142.601, "zeta": -77.962, "epsilon_zeta": -64.639, "bb_type": "BI", "chi": 177.200, "glyco_bond": "anti", "C5prime_xyz": [ -2.089, 8.575, 1.739 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.500, "Dp": 4.537, "splay_angle": 23.258, "splay_distance": 3.710, "splay_ratio": 0.208, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -6.648, "v1": -17.337, "v2": 33.060, "v3": -37.907, "v4": 27.894, "amplitude": 37.598, "phase_angle": 28.443, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.059, "frame": { "rmsd": 0.059, "origin": [ 33.701, 51.511, 62.316 ], "x_axis": [ 0.084, -0.299, -0.951 ], "y_axis": [ -0.931, 0.316, -0.182 ], "z_axis": [ 0.355, 0.900, -0.251 ], "quaternion": [ 0.536, -0.505, 0.609, 0.295 ] } }, { "index": 323, "index_chain": 2, "chain_name": "R", "nt_resnum": 13, "nt_name": "G", "nt_code": "G", "nt_id": "///R/13", "linked_nts": [ "///R/12", "///R/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -51.565, "beta": -177.510, "gamma": 31.372, "delta": 77.188, "epsilon": -171.669, "zeta": -68.269, "epsilon_zeta": -103.399, "bb_type": "BI", "chi": -157.633, "glyco_bond": "anti", "C5prime_xyz": [ -0.927, 8.640, 0.433 ], "P_xyz": [ 1.530, 9.208, 1.017 ], "form": "A", "ssZp": 4.430, "Dp": 4.641, "splay_angle": 21.118, "splay_distance": 3.286, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 167.711, "theta": -143.892, "eta_prime": 176.115, "theta_prime": -144.241, "eta_base": -139.486, "theta_base": -108.035, "v0": 12.131, "v1": -35.702, "v2": 43.885, "v3": -38.357, "v4": 16.874, "amplitude": 43.951, "phase_angle": 3.135, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.264, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 36.615, 53.391, 60.999 ], "x_axis": [ -0.557, -0.028, -0.830 ], "y_axis": [ -0.737, 0.478, 0.478 ], "z_axis": [ 0.384, 0.878, -0.286 ], "quaternion": [ 0.398, -0.251, 0.762, 0.445 ] } }, { "index": 324, "index_chain": 3, "chain_name": "R", "nt_resnum": 14, "nt_name": "C", "nt_code": "C", "nt_id": "///R/14", "linked_nts": [ "///R/13", "///R/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 175.586, "beta": -156.687, "gamma": 138.104, "delta": 81.059, "epsilon": -103.051, "zeta": -127.626, "epsilon_zeta": 24.576, "bb_type": "--", "chi": -169.753, "glyco_bond": "anti", "C5prime_xyz": [ -0.813, 8.343, 1.241 ], "P_xyz": [ 1.457, 8.936, 0.042 ], "form": "A", "ssZp": 4.517, "Dp": 4.855, "splay_angle": 22.441, "splay_distance": 3.563, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 163.395, "theta": -151.024, "eta_prime": 177.996, "theta_prime": -146.887, "eta_base": -131.953, "theta_base": -138.970, "v0": 20.420, "v1": -41.440, "v2": 46.123, "v3": -36.095, "v4": 9.873, "amplitude": 46.412, "phase_angle": 353.612, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.075, "frame": { "rmsd": 0.016, "origin": [ 37.585, 55.502, 58.674 ], "x_axis": [ -0.884, 0.242, -0.400 ], "y_axis": [ -0.215, 0.550, 0.807 ], "z_axis": [ 0.416, 0.799, -0.434 ], "quaternion": [ 0.241, 0.008, 0.847, 0.474 ] } }, { "index": 325, "index_chain": 4, "chain_name": "R", "nt_resnum": 15, "nt_name": "A", "nt_code": "A", "nt_id": "///R/15", "linked_nts": [ "///R/14", "///R/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -8.369, "beta": 117.401, "gamma": 30.670, "delta": 67.866, "epsilon": -161.459, "zeta": -64.454, "epsilon_zeta": -97.005, "bb_type": "BI", "chi": -156.936, "glyco_bond": "anti", "C5prime_xyz": [ -2.020, 8.936, 0.257 ], "P_xyz": [ 0.636, 9.299, 0.098 ], "form": "A", "ssZp": 4.417, "Dp": 4.674, "splay_angle": 27.107, "splay_distance": 4.245, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": 160.662, "theta": -146.893, "eta_prime": 174.257, "theta_prime": -149.076, "eta_base": -164.506, "theta_base": -117.276, "v0": -5.771, "v1": -23.984, "v2": 42.368, "v3": -47.411, "v4": 33.551, "amplitude": 47.018, "phase_angle": 25.698, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.031, "frame": { "rmsd": 0.009, "origin": [ 38.896, 57.223, 55.842 ], "x_axis": [ -0.982, 0.181, 0.052 ], "y_axis": [ 0.147, 0.562, 0.814 ], "z_axis": [ 0.118, 0.807, -0.578 ], "quaternion": [ 0.019, 0.093, 0.883, 0.459 ] } }, { "index": 326, "index_chain": 5, "chain_name": "R", "nt_resnum": 16, "nt_name": "C", "nt_code": "C", "nt_id": "///R/16", "linked_nts": [ "///R/15", "///R/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -83.116, "beta": -177.422, "gamma": 63.453, "delta": 72.611, "epsilon": -163.490, "zeta": -59.875, "epsilon_zeta": -103.615, "bb_type": "BI", "chi": -167.979, "glyco_bond": "anti", "C5prime_xyz": [ -1.217, 8.670, 1.050 ], "P_xyz": [ 1.360, 9.062, 1.168 ], "form": "A", "ssZp": 4.642, "Dp": 4.695, "splay_angle": 24.728, "splay_distance": 3.809, "splay_ratio": 0.218, "d22": 4.263, "d64": 4.558, "eta": 166.397, "theta": -149.565, "eta_prime": 176.897, "theta_prime": -146.374, "eta_base": -133.357, "theta_base": -120.341, "v0": 10.803, "v1": -36.733, "v2": 47.271, "v3": -42.163, "v4": 20.218, "amplitude": 47.517, "phase_angle": 5.826, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.329, "filter_rmsd": 0.072, "frame": { "rmsd": 0.012, "origin": [ 37.209, 60.021, 53.133 ], "x_axis": [ -0.678, 0.255, 0.689 ], "y_axis": [ 0.731, 0.327, 0.599 ], "z_axis": [ -0.072, 0.910, -0.408 ], "quaternion": [ -0.245, 0.318, 0.777, 0.486 ] } }, { "index": 327, "index_chain": 6, "chain_name": "R", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///R/17", "linked_nts": [ "///R/16", "///R/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop", "alpha": -102.849, "beta": -170.810, "gamma": 83.595, "delta": 81.545, "epsilon": -132.455, "zeta": -69.955, "epsilon_zeta": -62.500, "bb_type": "BI", "chi": -171.748, "glyco_bond": "anti", "C5prime_xyz": [ -1.476, 8.638, 1.202 ], "P_xyz": [ 1.160, 8.948, 1.200 ], "form": "A", "ssZp": 4.646, "Dp": 4.737, "splay_angle": 24.197, "splay_distance": 3.858, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 175.352, "theta": -126.916, "eta_prime": -172.445, "theta_prime": -128.081, "eta_base": -134.805, "theta_base": -88.029, "v0": 5.120, "v1": -29.516, "v2": 41.312, "v3": -39.316, "v4": 21.774, "amplitude": 42.197, "phase_angle": 11.753, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.070, "frame": { "rmsd": 0.011, "origin": [ 34.959, 62.660, 51.559 ], "x_axis": [ -0.165, 0.299, 0.940 ], "y_axis": [ 0.978, 0.174, 0.116 ], "z_axis": [ -0.129, 0.938, -0.321 ], "quaternion": [ -0.415, 0.495, 0.644, 0.409 ] } }, { "index": 328, "index_chain": 7, "chain_name": "R", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///R/17", "linked_nts": [ "///R/17", "///R/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -66.466, "beta": 164.228, "gamma": 52.628, "delta": 74.546, "epsilon": -166.241, "zeta": -55.670, "epsilon_zeta": -110.570, "bb_type": "BI", "chi": -165.358, "glyco_bond": "anti", "C5prime_xyz": [ -1.677, 8.720, 0.824 ], "P_xyz": [ 0.847, 9.317, 0.734 ], "form": "A", "ssZp": 4.585, "Dp": 4.637, "splay_angle": 23.861, "splay_distance": 3.844, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 152.875, "theta": -144.944, "eta_prime": 175.348, "theta_prime": -144.729, "eta_base": -118.308, "theta_base": -115.223, "v0": 4.830, "v1": -32.967, "v2": 46.274, "v3": -45.001, "v4": 25.536, "amplitude": 47.481, "phase_angle": 12.947, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.772, "filter_rmsd": 0.035, "frame": { "rmsd": 0.013, "origin": [ 33.786, 66.037, 53.009 ], "x_axis": [ 0.578, 0.225, 0.784 ], "y_axis": [ 0.799, 0.038, -0.600 ], "z_axis": [ -0.165, 0.974, -0.158 ], "quaternion": [ 0.604, -0.652, -0.393, -0.238 ] } }, { "index": 329, "index_chain": 8, "chain_name": "R", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///R/17", "linked_nts": [ "///R/17", "///R/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop", "alpha": -82.079, "beta": -172.277, "gamma": 67.085, "delta": 81.595, "epsilon": -152.586, "zeta": -60.559, "epsilon_zeta": -92.027, "bb_type": "BI", "chi": -154.753, "glyco_bond": "anti", "C5prime_xyz": [ -1.606, 8.866, 0.299 ], "P_xyz": [ 0.946, 9.422, 0.308 ], "form": ".", "ssZp": 4.249, "Dp": 4.556, "splay_angle": 52.933, "splay_distance": 8.705, "splay_ratio": 0.448, "d22": 6.198, "d64": 7.354, "eta": 179.645, "theta": -146.629, "eta_prime": -167.012, "theta_prime": -135.556, "eta_base": -124.394, "theta_base": -129.903, "v0": 1.185, "v1": -25.829, "v2": 38.870, "v3": -39.421, "v4": 24.251, "amplitude": 40.654, "phase_angle": 17.037, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.412, "filter_rmsd": 0.111, "frame": { "rmsd": 0.011, "origin": [ 33.032, 69.240, 54.996 ], "x_axis": [ 0.929, 0.233, 0.286 ], "y_axis": [ 0.286, 0.037, -0.958 ], "z_axis": [ -0.234, 0.972, -0.032 ], "quaternion": [ 0.695, -0.694, -0.187, -0.019 ] } }, { "index": 330, "index_chain": 9, "chain_name": "R", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///R/17", "linked_nts": [ "///R/17", "///R/17" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor", "alpha": -71.804, "beta": -123.359, "gamma": 43.565, "delta": 146.420, "epsilon": -84.961, "zeta": 80.879, "epsilon_zeta": 194.161, "bb_type": "--", "chi": -124.899, "glyco_bond": "anti", "C5prime_xyz": [ -1.988, 8.686, -0.968 ], "P_xyz": [ -0.911, 10.133, 0.954 ], "form": ".", "ssZp": 0.216, "Dp": 0.342, "splay_angle": 33.263, "splay_distance": 5.534, "splay_ratio": 0.308, "d22": null, "d64": null, "eta": -136.754, "theta": 99.737, "eta_prime": -127.989, "theta_prime": 82.915, "eta_base": -131.960, "theta_base": 62.450, "v0": -24.609, "v1": 41.539, "v2": -42.262, "v3": 29.085, "v4": -3.122, "amplitude": 43.677, "phase_angle": 165.375, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.660, "filter_rmsd": 0.112, "frame": { "rmsd": 0.010, "origin": [ 31.276, 77.732, 55.758 ], "x_axis": [ 0.814, -0.450, 0.366 ], "y_axis": [ 0.051, -0.572, -0.818 ], "z_axis": [ 0.578, 0.685, -0.443 ], "quaternion": [ -0.447, 0.841, -0.119, 0.281 ] } }, { "index": 331, "index_chain": 10, "chain_name": "R", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///R/17", "linked_nts": [ "///R/17", "///R/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart", "alpha": -136.579, "beta": 164.886, "gamma": 62.630, "delta": 86.712, "epsilon": -141.662, "zeta": -58.208, "epsilon_zeta": -83.453, "bb_type": "BI", "chi": -91.541, "glyco_bond": "anti", "C5prime_xyz": [ -2.227, 7.362, -2.962 ], "P_xyz": [ -0.314, 6.451, -4.562 ], "form": ".", "ssZp": 0.253, "Dp": 4.635, "splay_angle": 101.255, "splay_distance": 15.122, "splay_ratio": 0.773, "d22": null, "d64": null, "eta": 140.025, "theta": -131.818, "eta_prime": 146.857, "theta_prime": -128.751, "eta_base": 131.308, "theta_base": -107.673, "v0": 9.677, "v1": -30.776, "v2": 38.908, "v3": -34.221, "v4": 15.571, "amplitude": 39.026, "phase_angle": 4.459, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6g", "suiteness": 0.521, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 29.345, 72.977, 53.689 ], "x_axis": [ -0.214, 0.829, 0.517 ], "y_axis": [ -0.804, 0.151, -0.575 ], "z_axis": [ -0.555, -0.539, 0.634 ], "quaternion": [ 0.627, -0.014, -0.428, 0.651 ] } }, { "index": 332, "index_chain": 11, "chain_name": "R", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///R/17", "linked_nts": [ "///R/17", "///R/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,hairpin-loop,splayed-apart", "alpha": -64.262, "beta": -115.922, "gamma": 76.203, "delta": 140.601, "epsilon": -141.512, "zeta": 137.276, "epsilon_zeta": 81.212, "bb_type": "--", "chi": -129.068, "glyco_bond": "anti", "C5prime_xyz": [ -2.293, 8.831, -0.776 ], "P_xyz": [ -0.326, 9.358, 0.914 ], "form": ".", "ssZp": 1.833, "Dp": 1.942, "splay_angle": 50.946, "splay_distance": 7.865, "splay_ratio": 0.433, "d22": null, "d64": null, "eta": -122.268, "theta": 143.457, "eta_prime": -103.097, "theta_prime": 126.886, "eta_base": -120.325, "theta_base": 147.690, "v0": -29.775, "v1": 41.197, "v2": -36.695, "v3": 20.895, "v4": 5.223, "amplitude": 40.858, "phase_angle": 153.911, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.247, "filter_rmsd": 0.068, "frame": { "rmsd": 0.009, "origin": [ 15.430, 78.774, 52.488 ], "x_axis": [ 0.560, 0.816, -0.143 ], "y_axis": [ 0.695, -0.557, -0.455 ], "z_axis": [ -0.451, 0.155, -0.879 ], "quaternion": [ -0.176, 0.866, 0.436, -0.172 ] } }, { "index": 333, "index_chain": 12, "chain_name": "R", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///R/17", "linked_nts": [ "///R/17", "///R/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -52.815, "beta": 131.052, "gamma": 42.256, "delta": 78.542, "epsilon": -147.506, "zeta": -80.102, "epsilon_zeta": -67.404, "bb_type": "BI", "chi": -162.583, "glyco_bond": "anti", "C5prime_xyz": [ -1.426, 8.684, 0.709 ], "P_xyz": [ 1.196, 8.466, 0.478 ], "form": "A", "ssZp": 4.526, "Dp": 4.719, "splay_angle": 20.992, "splay_distance": 3.244, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 178.037, "theta": -140.622, "eta_prime": 177.021, "theta_prime": -142.378, "eta_base": -172.967, "theta_base": -112.770, "v0": 6.972, "v1": -32.207, "v2": 43.404, "v3": -40.618, "v4": 21.383, "amplitude": 44.033, "phase_angle": 9.695, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.377, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 12.060, 72.367, 55.561 ], "x_axis": [ -0.433, 0.646, -0.629 ], "y_axis": [ 0.596, -0.318, -0.737 ], "z_axis": [ -0.677, -0.694, -0.247 ], "quaternion": [ 0.020, -0.532, -0.583, 0.613 ] } }, { "index": 334, "index_chain": 13, "chain_name": "R", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///R/17", "linked_nts": [ "///R/17", "///R/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -53.440, "beta": 165.278, "gamma": 52.461, "delta": 93.993, "epsilon": -129.140, "zeta": 177.067, "epsilon_zeta": 53.793, "bb_type": "BII", "chi": -156.789, "glyco_bond": "anti", "C5prime_xyz": [ -1.196, 8.792, 0.430 ], "P_xyz": [ 1.444, 8.825, 0.681 ], "form": ".", "ssZp": 4.060, "Dp": 4.382, "splay_angle": 143.913, "splay_distance": 18.217, "splay_ratio": 0.951, "d22": 12.603, "d64": 14.734, "eta": -178.388, "theta": 99.039, "eta_prime": -165.771, "theta_prime": 64.803, "eta_base": -122.260, "theta_base": -62.657, "v0": 3.158, "v1": -18.137, "v2": 25.443, "v3": -24.177, "v4": 13.342, "amplitude": 25.983, "phase_angle": 11.706, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.513, "filter_rmsd": 0.070, "frame": { "rmsd": 0.009, "origin": [ 9.092, 71.449, 54.629 ], "x_axis": [ 0.119, 0.400, -0.909 ], "y_axis": [ 0.640, -0.731, -0.238 ], "z_axis": [ -0.759, -0.553, -0.343 ], "quaternion": [ 0.106, 0.740, 0.351, -0.563 ] } }, { "index": 335, "index_chain": 14, "chain_name": "R", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///R/17", "linked_nts": [ "///R/17", "///R/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-stack,hairpin-loop,splayed-apart", "alpha": -134.133, "beta": 104.060, "gamma": -84.373, "delta": 163.005, "epsilon": -93.235, "zeta": 164.699, "epsilon_zeta": 102.066, "bb_type": "BII", "chi": -179.761, "glyco_bond": "anti", "C5prime_xyz": [ -1.374, 7.296, 2.235 ], "P_xyz": [ -1.985, 7.877, 4.780 ], "form": ".", "ssZp": 1.328, "Dp": 1.363, "splay_angle": 50.384, "splay_distance": 8.761, "splay_ratio": 0.426, "d22": 6.970, "d64": 8.335, "eta": -4.117, "theta": -171.553, "eta_prime": 9.800, "theta_prime": -178.599, "eta_base": 126.513, "theta_base": -176.704, "v0": 9.123, "v1": 16.876, "v2": -34.875, "v3": 40.835, "v4": -31.426, "amplitude": 40.689, "phase_angle": 211.005, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.010, "origin": [ 11.098, 54.419, 48.478 ], "x_axis": [ -0.931, -0.355, 0.083 ], "y_axis": [ -0.041, 0.328, 0.944 ], "z_axis": [ -0.363, 0.875, -0.320 ], "quaternion": [ -0.139, -0.124, 0.803, 0.566 ] } }, { "index": 336, "index_chain": 15, "chain_name": "R", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///R/17", "linked_nts": [ "///R/17", "///R/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop", "alpha": 94.608, "beta": -139.480, "gamma": 164.386, "delta": 68.256, "epsilon": -109.616, "zeta": -106.879, "epsilon_zeta": -2.737, "bb_type": "--", "chi": -174.958, "glyco_bond": "anti", "C5prime_xyz": [ -2.087, 8.822, 1.396 ], "P_xyz": [ -0.290, 10.404, 0.317 ], "form": ".", "ssZp": 4.518, "Dp": 4.691, "splay_angle": 26.578, "splay_distance": 4.172, "splay_ratio": 0.230, "d22": 3.896, "d64": 3.346, "eta": 149.895, "theta": -154.966, "eta_prime": 147.925, "theta_prime": -147.384, "eta_base": 153.427, "theta_base": -84.075, "v0": -4.172, "v1": -24.844, "v2": 43.135, "v3": -46.784, "v4": 31.830, "amplitude": 47.064, "phase_angle": 23.579, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.009, "origin": [ 19.435, 52.181, 49.975 ], "x_axis": [ -0.611, 0.189, -0.769 ], "y_axis": [ -0.391, 0.772, 0.501 ], "z_axis": [ 0.688, 0.606, -0.398 ], "quaternion": [ 0.437, -0.061, 0.834, 0.332 ] } }, { "index": 337, "index_chain": 16, "chain_name": "R", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///R/17", "linked_nts": [ "///R/17", "///R/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -20.753, "beta": 128.492, "gamma": 37.801, "delta": 77.406, "epsilon": -126.027, "zeta": -112.610, "epsilon_zeta": -13.417, "bb_type": "--", "chi": -149.976, "glyco_bond": "anti", "C5prime_xyz": [ -1.368, 8.938, -0.069 ], "P_xyz": [ 1.280, 8.823, -0.471 ], "form": ".", "ssZp": 3.923, "Dp": 4.760, "splay_angle": 150.914, "splay_distance": 18.069, "splay_ratio": 0.968, "d22": null, "d64": null, "eta": 167.864, "theta": -163.551, "eta_prime": -175.300, "theta_prime": -178.580, "eta_base": -103.102, "theta_base": 164.662, "v0": 3.594, "v1": -28.185, "v2": 40.674, "v3": -39.444, "v4": 22.759, "amplitude": 41.858, "phase_angle": 13.660, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.069, "frame": { "rmsd": 0.009, "origin": [ 18.782, 55.242, 47.217 ], "x_axis": [ -0.729, 0.685, -0.004 ], "y_axis": [ 0.443, 0.476, 0.760 ], "z_axis": [ 0.522, 0.552, -0.650 ], "quaternion": [ 0.156, 0.334, 0.845, 0.388 ] } }, { "index": 338, "index_chain": 17, "chain_name": "R", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///R/17", "linked_nts": [ "///R/17", "///R/18" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart", "alpha": -23.582, "beta": -164.267, "gamma": 141.875, "delta": 85.804, "epsilon": -144.558, "zeta": -70.696, "epsilon_zeta": -73.862, "bb_type": "BI", "chi": -172.597, "glyco_bond": "anti", "C5prime_xyz": [ -0.836, 8.204, 1.332 ], "P_xyz": [ 1.251, 9.019, -0.043 ], "form": "A", "ssZp": 4.759, "Dp": 4.784, "splay_angle": 26.494, "splay_distance": 4.090, "splay_ratio": 0.234, "d22": null, "d64": null, "eta": -34.739, "theta": -149.929, "eta_prime": -29.812, "theta_prime": -153.683, "eta_base": -25.709, "theta_base": -141.222, "v0": 20.568, "v1": -39.882, "v2": 42.564, "v3": -31.908, "v4": 7.281, "amplitude": 43.121, "phase_angle": 350.781, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 34.857, 62.280, 51.522 ], "x_axis": [ -0.223, 0.156, 0.962 ], "y_axis": [ -0.947, -0.267, -0.176 ], "z_axis": [ 0.229, -0.951, 0.208 ], "quaternion": [ 0.424, 0.457, -0.433, 0.651 ] } }, { "index": 339, "index_chain": 18, "chain_name": "R", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///R/18", "linked_nts": [ "///R/17", "///R/19" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.967, "beta": 175.199, "gamma": 53.943, "delta": 79.195, "epsilon": -146.920, "zeta": -72.828, "epsilon_zeta": -74.092, "bb_type": "BI", "chi": -171.894, "glyco_bond": "anti", "C5prime_xyz": [ -1.444, 8.511, 1.241 ], "P_xyz": [ 1.101, 8.956, 1.597 ], "form": "A", "ssZp": 4.698, "Dp": 4.730, "splay_angle": 21.563, "splay_distance": 3.398, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 171.188, "theta": -148.456, "eta_prime": -175.100, "theta_prime": -145.102, "eta_base": -144.458, "theta_base": -120.514, "v0": 7.423, "v1": -31.011, "v2": 41.140, "v3": -38.660, "v4": 19.663, "amplitude": 41.645, "phase_angle": 8.927, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.938, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 37.672, 59.707, 52.999 ], "x_axis": [ -0.647, 0.084, 0.758 ], "y_axis": [ -0.743, -0.292, -0.602 ], "z_axis": [ 0.171, -0.953, 0.252 ], "quaternion": [ 0.280, 0.314, -0.525, 0.740 ] } }, { "index": 340, "index_chain": 19, "chain_name": "R", "nt_resnum": 19, "nt_name": "U", "nt_code": "U", "nt_id": "///R/19", "linked_nts": [ "///R/18", "///R/20" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.157, "beta": -171.733, "gamma": 41.766, "delta": 84.241, "epsilon": -171.531, "zeta": -63.443, "epsilon_zeta": -108.088, "bb_type": "BI", "chi": -149.239, "glyco_bond": "anti", "C5prime_xyz": [ -1.181, 8.691, -0.025 ], "P_xyz": [ 1.369, 9.121, 0.399 ], "form": "A", "ssZp": 4.138, "Dp": 4.445, "splay_angle": 23.675, "splay_distance": 3.908, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 169.561, "theta": -128.632, "eta_prime": -179.219, "theta_prime": -134.090, "eta_base": -143.035, "theta_base": -106.012, "v0": 7.591, "v1": -29.479, "v2": 38.691, "v3": -35.867, "v4": 17.735, "amplitude": 39.062, "phase_angle": 7.905, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.705, "filter_rmsd": 0.110, "frame": { "rmsd": 0.010, "origin": [ 38.881, 57.741, 55.493 ], "x_axis": [ -0.970, 0.001, 0.242 ], "y_axis": [ -0.214, -0.466, -0.858 ], "z_axis": [ 0.112, -0.885, 0.453 ], "quaternion": [ 0.063, 0.104, -0.513, 0.850 ] } }, { "index": 341, "index_chain": 20, "chain_name": "R", "nt_resnum": 20, "nt_name": "G", "nt_code": "G", "nt_id": "///R/20", "linked_nts": [ "///R/19", "///R/21" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 162.355, "beta": -175.870, "gamma": 169.162, "delta": 102.952, "epsilon": -102.045, "zeta": -123.771, "epsilon_zeta": 21.727, "bb_type": "--", "chi": -169.236, "glyco_bond": "anti", "C5prime_xyz": [ -0.966, 8.193, 1.231 ], "P_xyz": [ 0.897, 9.689, 0.183 ], "form": ".", "ssZp": 4.341, "Dp": 4.555, "splay_angle": 12.855, "splay_distance": 2.155, "splay_ratio": 0.113, "d22": null, "d64": null, "eta": 178.847, "theta": -147.326, "eta_prime": -169.139, "theta_prime": -153.011, "eta_base": -127.037, "theta_base": -143.429, "v0": 15.628, "v1": -25.343, "v2": 25.270, "v3": -17.353, "v4": 1.098, "amplitude": 26.308, "phase_angle": 343.851, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.187, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 37.532, 55.447, 58.355 ], "x_axis": [ -0.927, -0.099, -0.363 ], "y_axis": [ 0.364, -0.474, -0.801 ], "z_axis": [ -0.093, -0.875, 0.476 ], "quaternion": [ -0.137, -0.134, -0.494, 0.848 ] } }, { "index": 342, "index_chain": 21, "chain_name": "R", "nt_resnum": 21, "nt_name": "C", "nt_code": "C", "nt_id": "///R/21", "linked_nts": [ "///R/20", "///R/22" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 89.626, "beta": -128.008, "gamma": -163.404, "delta": 96.214, "epsilon": -126.583, "zeta": -70.535, "epsilon_zeta": -56.048, "bb_type": "--", "chi": -143.932, "glyco_bond": "anti", "C5prime_xyz": [ -0.855, 8.519, -0.338 ], "P_xyz": [ -0.035, 9.270, -2.780 ], "form": ".", "ssZp": 3.779, "Dp": 4.704, "splay_angle": 29.116, "splay_distance": 4.907, "splay_ratio": 0.252, "d22": 3.740, "d64": 4.068, "eta": 153.771, "theta": -147.322, "eta_prime": 172.258, "theta_prime": -147.265, "eta_base": -162.937, "theta_base": -125.040, "v0": 12.858, "v1": -25.396, "v2": 27.903, "v3": -21.544, "v4": 5.514, "amplitude": 28.140, "phase_angle": 352.571, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.069, "frame": { "rmsd": 0.009, "origin": [ 37.009, 54.423, 60.177 ], "x_axis": [ -0.787, -0.415, -0.456 ], "y_axis": [ 0.561, -0.790, -0.248 ], "z_axis": [ -0.257, -0.451, 0.855 ], "quaternion": [ -0.263, -0.192, -0.189, 0.926 ] } }, { "index": 343, "index_chain": 22, "chain_name": "R", "nt_resnum": 22, "nt_name": "C", "nt_code": "C", "nt_id": "///R/22", "linked_nts": [ "///R/21", "///R/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -73.151, "beta": 166.533, "gamma": 62.999, "delta": 77.906, "epsilon": -152.473, "zeta": -69.606, "epsilon_zeta": -82.866, "bb_type": "BI", "chi": -158.351, "glyco_bond": "anti", "C5prime_xyz": [ -1.857, 8.965, 0.357 ], "P_xyz": [ 0.579, 9.927, 0.032 ], "form": "A", "ssZp": 4.382, "Dp": 4.589, "splay_angle": 23.059, "splay_distance": 3.811, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 157.175, "theta": -151.332, "eta_prime": -179.932, "theta_prime": -152.555, "eta_base": -141.245, "theta_base": -127.075, "v0": -2.741, "v1": -23.057, "v2": 38.186, "v3": -40.717, "v4": 27.627, "amplitude": 41.252, "phase_angle": 22.228, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.346, "filter_rmsd": 0.060, "frame": { "rmsd": 0.005, "origin": [ 33.556, 51.531, 62.123 ], "x_axis": [ -0.152, -0.406, -0.901 ], "y_axis": [ 0.890, -0.453, 0.054 ], "z_axis": [ -0.430, -0.794, 0.430 ], "quaternion": [ -0.454, -0.467, -0.259, 0.713 ] } }, { "index": 344, "index_chain": 23, "chain_name": "R", "nt_resnum": 23, "nt_name": "A", "nt_code": "A", "nt_id": "///R/23", "linked_nts": [ "///R/22", "///R/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet", "alpha": -67.156, "beta": 167.332, "gamma": 58.490, "delta": 76.149, "epsilon": -153.379, "zeta": -70.750, "epsilon_zeta": -82.629, "bb_type": "BI", "chi": -166.751, "glyco_bond": "anti", "C5prime_xyz": [ -1.908, 8.762, 0.842 ], "P_xyz": [ 0.492, 9.663, 0.932 ], "form": "A", "ssZp": 4.545, "Dp": 4.644, "splay_angle": 23.059, "splay_distance": 3.723, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 168.050, "theta": -150.467, "eta_prime": -178.672, "theta_prime": -148.972, "eta_base": -138.352, "theta_base": -118.273, "v0": -1.668, "v1": -26.470, "v2": 42.172, "v3": -44.036, "v4": 29.376, "amplitude": 45.033, "phase_angle": 20.532, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.878, "filter_rmsd": 0.035, "frame": { "rmsd": 0.008, "origin": [ 30.735, 48.996, 62.499 ], "x_axis": [ 0.354, -0.462, -0.813 ], "y_axis": [ 0.846, -0.212, 0.489 ], "z_axis": [ -0.398, -0.861, 0.316 ], "quaternion": [ 0.604, 0.559, 0.172, -0.542 ] } }, { "index": 345, "index_chain": 24, "chain_name": "R", "nt_resnum": 24, "nt_name": "G", "nt_code": "G", "nt_id": "///R/24", "linked_nts": [ "///R/23", "///R/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate", "alpha": -65.832, "beta": 162.575, "gamma": 61.826, "delta": 77.297, "epsilon": -146.593, "zeta": -73.284, "epsilon_zeta": -73.309, "bb_type": "BI", "chi": -166.743, "glyco_bond": "anti", "C5prime_xyz": [ -1.951, 8.723, 0.857 ], "P_xyz": [ 0.531, 9.466, 0.655 ], "form": "A", "ssZp": 4.522, "Dp": 4.635, "splay_angle": 23.046, "splay_distance": 3.697, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": 168.663, "theta": -145.790, "eta_prime": -174.919, "theta_prime": -145.262, "eta_base": -128.086, "theta_base": -112.025, "v0": 0.959, "v1": -28.315, "v2": 43.296, "v3": -44.025, "v4": 27.205, "amplitude": 45.392, "phase_angle": 17.477, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.791, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 28.782, 45.930, 61.698 ], "x_axis": [ 0.722, -0.556, -0.411 ], "y_axis": [ 0.497, 0.003, 0.868 ], "z_axis": [ -0.481, -0.831, 0.278 ], "quaternion": [ 0.708, 0.600, -0.025, -0.372 ] } }, { "index": 346, "index_chain": 25, "chain_name": "R", "nt_resnum": 25, "nt_name": "U", "nt_code": "U", "nt_id": "///R/25", "linked_nts": [ "///R/24", "///R/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.653, "beta": 175.933, "gamma": 59.059, "delta": 77.385, "epsilon": -153.490, "zeta": -69.747, "epsilon_zeta": -83.743, "bb_type": "BI", "chi": -157.439, "glyco_bond": "anti", "C5prime_xyz": [ -1.752, 8.815, 0.391 ], "P_xyz": [ 0.804, 9.398, 0.479 ], "form": "A", "ssZp": 4.231, "Dp": 4.519, "splay_angle": 22.308, "splay_distance": 3.525, "splay_ratio": 0.195, "d22": 4.249, "d64": 4.126, "eta": 167.565, "theta": -151.033, "eta_prime": -178.363, "theta_prime": -149.289, "eta_base": -129.547, "theta_base": -122.388, "v0": 4.711, "v1": -30.129, "v2": 43.585, "v3": -41.936, "v4": 23.318, "amplitude": 44.692, "phase_angle": 12.775, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.883, "filter_rmsd": 0.111, "frame": { "rmsd": 0.009, "origin": [ 28.123, 42.427, 60.716 ], "x_axis": [ 0.932, -0.319, 0.172 ], "y_axis": [ -0.100, 0.228, 0.968 ], "z_axis": [ -0.348, -0.920, 0.181 ], "quaternion": [ 0.765, 0.617, -0.170, -0.071 ] } }, { "index": 347, "index_chain": 26, "chain_name": "R", "nt_resnum": 26, "nt_name": "U", "nt_code": "U", "nt_id": "///R/26", "linked_nts": [ "///R/25", "///R/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop", "alpha": -72.115, "beta": 178.895, "gamma": 62.387, "delta": 87.160, "epsilon": -135.278, "zeta": -64.634, "epsilon_zeta": -70.644, "bb_type": "BI", "chi": -152.923, "glyco_bond": "anti", "C5prime_xyz": [ -1.479, 8.740, 0.178 ], "P_xyz": [ 1.048, 9.191, 0.204 ], "form": ".", "ssZp": 4.035, "Dp": 4.550, "splay_angle": 30.034, "splay_distance": 4.815, "splay_ratio": 0.260, "d22": null, "d64": null, "eta": 179.273, "theta": -122.212, "eta_prime": -171.674, "theta_prime": -118.996, "eta_base": -137.073, "theta_base": -66.616, "v0": 4.706, "v1": -25.590, "v2": 35.486, "v3": -33.954, "v4": 18.612, "amplitude": 36.216, "phase_angle": 11.525, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.763, "filter_rmsd": 0.112, "frame": { "rmsd": 0.009, "origin": [ 28.012, 38.920, 60.378 ], "x_axis": [ 0.773, -0.020, 0.634 ], "y_axis": [ -0.608, 0.262, 0.749 ], "z_axis": [ -0.182, -0.965, 0.190 ], "quaternion": [ 0.746, 0.574, -0.274, 0.197 ] } }, { "index": 348, "index_chain": 27, "chain_name": "R", "nt_resnum": 27, "nt_name": "G", "nt_code": "G", "nt_id": "///R/27", "linked_nts": [ "///R/26", "///R/28" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart", "alpha": -67.668, "beta": 163.400, "gamma": 57.331, "delta": 81.906, "epsilon": -129.322, "zeta": 151.952, "epsilon_zeta": 78.726, "bb_type": "BII", "chi": -140.454, "glyco_bond": "anti", "C5prime_xyz": [ -1.514, 8.722, -0.644 ], "P_xyz": [ 0.897, 8.908, -1.573 ], "form": ".", "ssZp": 3.495, "Dp": 4.768, "splay_angle": 129.799, "splay_distance": 16.226, "splay_ratio": 0.906, "d22": null, "d64": null, "eta": 163.831, "theta": 73.825, "eta_prime": -170.865, "theta_prime": 101.431, "eta_base": -101.877, "theta_base": 142.721, "v0": 6.719, "v1": -31.457, "v2": 42.349, "v3": -39.656, "v4": 21.009, "amplitude": 42.975, "phase_angle": 9.790, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.809, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 29.189, 36.848, 64.562 ], "x_axis": [ -0.011, 0.220, 0.976 ], "y_axis": [ -0.988, -0.153, 0.023 ], "z_axis": [ 0.155, -0.963, 0.219 ], "quaternion": [ 0.513, 0.480, -0.400, 0.588 ] } }, { "index": 349, "index_chain": 28, "chain_name": "R", "nt_resnum": 28, "nt_name": "A", "nt_code": "A", "nt_id": "///R/28", "linked_nts": [ "///R/27", "///R/29" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,cap-donor,splayed-apart", "alpha": -83.301, "beta": -132.326, "gamma": 63.466, "delta": 151.105, "epsilon": -85.923, "zeta": 120.762, "epsilon_zeta": 153.315, "bb_type": "--", "chi": -79.552, "glyco_bond": "anti", "C5prime_xyz": [ -1.921, 7.095, -2.776 ], "P_xyz": [ 0.459, 8.083, -2.245 ], "form": ".", "ssZp": -0.746, "Dp": 1.210, "splay_angle": 44.637, "splay_distance": 7.424, "splay_ratio": 0.386, "d22": null, "d64": null, "eta": -102.860, "theta": 165.524, "eta_prime": -111.531, "theta_prime": 149.448, "eta_base": -179.265, "theta_base": -178.032, "v0": -3.668, "v1": 27.116, "v2": -38.638, "v3": 36.580, "v4": -21.333, "amplitude": 39.630, "phase_angle": 192.851, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.099, "filter_rmsd": 0.042, "frame": { "rmsd": 0.014, "origin": [ 19.093, 25.668, 58.532 ], "x_axis": [ 0.973, -0.059, -0.223 ], "y_axis": [ 0.220, 0.524, 0.823 ], "z_axis": [ 0.069, -0.850, 0.523 ], "quaternion": [ 0.869, 0.481, 0.084, -0.080 ] } }, { "index": 350, "index_chain": 29, "chain_name": "R", "nt_resnum": 29, "nt_name": "C", "nt_code": "C", "nt_id": "///R/29", "linked_nts": [ "///R/28", "///R/30" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,junction-loop,A-minor,ribose-zipper,phosphate", "alpha": 153.456, "beta": -136.680, "gamma": 76.163, "delta": 79.788, "epsilon": -121.358, "zeta": -104.731, "epsilon_zeta": -16.627, "bb_type": "--", "chi": -176.599, "glyco_bond": "anti", "C5prime_xyz": [ -1.606, 8.650, 1.349 ], "P_xyz": [ 0.766, 8.580, 2.371 ], "form": "A", "ssZp": 4.564, "Dp": 4.666, "splay_angle": 20.401, "splay_distance": 3.233, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 140.231, "theta": -148.774, "eta_prime": 124.661, "theta_prime": -147.364, "eta_base": 159.279, "theta_base": -135.482, "v0": -1.529, "v1": -25.632, "v2": 41.442, "v3": -43.266, "v4": 28.287, "amplitude": 44.217, "phase_angle": 20.406, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.072, "frame": { "rmsd": 0.013, "origin": [ 12.382, 24.478, 61.476 ], "x_axis": [ 0.943, -0.086, -0.322 ], "y_axis": [ 0.210, 0.903, 0.374 ], "z_axis": [ 0.258, -0.421, 0.870 ], "quaternion": [ 0.964, 0.206, 0.150, -0.077 ] } }, { "index": 351, "index_chain": 30, "chain_name": "R", "nt_resnum": 30, "nt_name": "G", "nt_code": "G", "nt_id": "///R/30", "linked_nts": [ "///R/29", "///R/31" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper,phosphate", "alpha": -55.365, "beta": 108.643, "gamma": 92.785, "delta": 79.015, "epsilon": -145.883, "zeta": -80.258, "epsilon_zeta": -65.625, "bb_type": "BI", "chi": 175.518, "glyco_bond": "anti", "C5prime_xyz": [ -1.793, 8.517, 1.712 ], "P_xyz": [ 0.359, 9.253, 0.257 ], "form": "A", "ssZp": 4.625, "Dp": 4.687, "splay_angle": 25.407, "splay_distance": 3.898, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 160.192, "theta": -145.538, "eta_prime": -177.797, "theta_prime": -156.613, "eta_base": -147.094, "theta_base": -136.374, "v0": 0.444, "v1": -26.600, "v2": 40.545, "v3": -41.118, "v4": 25.962, "amplitude": 42.581, "phase_angle": 17.789, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.015, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 12.188, 21.797, 63.273 ], "x_axis": [ 0.995, 0.095, -0.029 ], "y_axis": [ -0.058, 0.796, 0.602 ], "z_axis": [ 0.080, -0.597, 0.798 ], "quaternion": [ 0.947, 0.317, 0.029, 0.040 ] } }, { "index": 352, "index_chain": 31, "chain_name": "R", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///R/31", "linked_nts": [ "///R/30", "///R/32" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,A-minor", "alpha": -92.729, "beta": -168.472, "gamma": 69.343, "delta": 84.339, "epsilon": -142.992, "zeta": -61.655, "epsilon_zeta": -81.337, "bb_type": "BI", "chi": -169.812, "glyco_bond": "anti", "C5prime_xyz": [ -1.480, 8.581, 1.133 ], "P_xyz": [ 1.074, 8.886, 1.556 ], "form": ".", "ssZp": 4.558, "Dp": 4.609, "splay_angle": 30.010, "splay_distance": 4.610, "splay_ratio": 0.261, "d22": null, "d64": null, "eta": 168.288, "theta": -126.290, "eta_prime": 177.278, "theta_prime": -123.016, "eta_base": -145.249, "theta_base": -73.967, "v0": 2.346, "v1": -27.354, "v2": 39.966, "v3": -39.977, "v4": 23.654, "amplitude": 41.459, "phase_angle": 15.422, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.262, "filter_rmsd": 0.040, "frame": { "rmsd": 0.009, "origin": [ 13.203, 18.242, 64.507 ], "x_axis": [ 0.751, 0.606, 0.263 ], "y_axis": [ -0.644, 0.581, 0.497 ], "z_axis": [ 0.148, -0.543, 0.827 ], "quaternion": [ 0.889, 0.293, -0.032, 0.352 ] } }, { "index": 353, "index_chain": 32, "chain_name": "R", "nt_resnum": 32, "nt_name": "G", "nt_code": "G", "nt_id": "///R/32", "linked_nts": [ "///R/31", "///R/33" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -73.548, "beta": -177.662, "gamma": 53.130, "delta": 86.659, "epsilon": -141.469, "zeta": -98.611, "epsilon_zeta": -42.857, "bb_type": "BI", "chi": -158.838, "glyco_bond": "anti", "C5prime_xyz": [ -1.284, 8.673, 0.426 ], "P_xyz": [ 1.289, 9.009, 0.525 ], "form": "A", "ssZp": 4.389, "Dp": 4.717, "splay_angle": 19.842, "splay_distance": 3.100, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 167.129, "theta": -155.167, "eta_prime": -170.799, "theta_prime": -151.315, "eta_base": -101.857, "theta_base": -133.311, "v0": 9.762, "v1": -32.867, "v2": 42.144, "v3": -37.048, "v4": 17.688, "amplitude": 42.328, "phase_angle": 5.333, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.821, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 15.998, 18.906, 68.111 ], "x_axis": [ -0.095, 0.836, 0.541 ], "y_axis": [ -0.961, -0.218, 0.168 ], "z_axis": [ 0.258, -0.504, 0.824 ], "quaternion": [ 0.615, 0.273, -0.115, 0.731 ] } }, { "index": 354, "index_chain": 33, "chain_name": "R", "nt_resnum": 33, "nt_name": "G", "nt_code": "G", "nt_id": "///R/33", "linked_nts": [ "///R/32", "///R/34" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -48.430, "beta": 152.208, "gamma": 52.609, "delta": 84.892, "epsilon": -156.436, "zeta": -88.024, "epsilon_zeta": -68.412, "bb_type": "BI", "chi": -144.783, "glyco_bond": "anti", "C5prime_xyz": [ -1.621, 8.767, -0.526 ], "P_xyz": [ 0.959, 8.824, -1.202 ], "form": ".", "ssZp": 3.877, "Dp": 4.520, "splay_angle": 53.915, "splay_distance": 8.745, "splay_ratio": 0.454, "d22": null, "d64": null, "eta": 173.388, "theta": -161.628, "eta_prime": -172.378, "theta_prime": -153.917, "eta_base": -145.135, "theta_base": -157.373, "v0": 0.743, "v1": -25.846, "v2": 39.114, "v3": -39.255, "v4": 24.644, "amplitude": 40.950, "phase_angle": 17.220, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.367, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 17.656, 17.751, 70.463 ], "x_axis": [ -0.451, 0.647, 0.615 ], "y_axis": [ -0.727, -0.666, 0.168 ], "z_axis": [ 0.518, -0.371, 0.771 ], "quaternion": [ 0.404, 0.333, -0.060, 0.850 ] } }, { "index": 355, "index_chain": 34, "chain_name": "R", "nt_resnum": 34, "nt_name": "U", "nt_code": "U", "nt_id": "///R/34", "linked_nts": [ "///R/33", "///R/35" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -51.069, "beta": -151.796, "gamma": 53.942, "delta": 141.842, "epsilon": -106.931, "zeta": -148.468, "epsilon_zeta": 41.538, "bb_type": "--", "chi": -102.125, "glyco_bond": "anti", "C5prime_xyz": [ -2.691, 8.057, -2.095 ], "P_xyz": [ -0.680, 9.649, -1.597 ], "form": ".", "ssZp": 0.981, "Dp": 1.034, "splay_angle": 125.999, "splay_distance": 16.841, "splay_ratio": 0.891, "d22": null, "d64": null, "eta": -134.145, "theta": -113.742, "eta_prime": -131.298, "theta_prime": -152.434, "eta_base": -148.240, "theta_base": 157.586, "v0": -31.856, "v1": 41.005, "v2": -34.557, "v3": 17.663, "v4": 8.601, "amplitude": 40.297, "phase_angle": 149.042, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.631, "filter_rmsd": 0.103, "frame": { "rmsd": 0.013, "origin": [ 23.359, 13.454, 75.510 ], "x_axis": [ -0.439, 0.815, 0.379 ], "y_axis": [ -0.890, -0.452, -0.059 ], "z_axis": [ 0.123, -0.363, 0.923 ], "quaternion": [ 0.508, 0.150, -0.126, 0.839 ] } }, { "index": 356, "index_chain": 35, "chain_name": "R", "nt_resnum": 35, "nt_name": "G", "nt_code": "G", "nt_id": "///R/35", "linked_nts": [ "///R/34", "///R/36" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart", "alpha": 86.337, "beta": 160.970, "gamma": 36.919, "delta": 85.210, "epsilon": -144.830, "zeta": -79.100, "epsilon_zeta": -65.730, "bb_type": "BI", "chi": -174.850, "glyco_bond": "anti", "C5prime_xyz": [ -1.438, 8.438, 1.440 ], "P_xyz": [ 1.098, 8.530, 2.124 ], "form": "A", "ssZp": 4.737, "Dp": 4.724, "splay_angle": 25.452, "splay_distance": 3.873, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": -50.250, "theta": -143.687, "eta_prime": -24.985, "theta_prime": -141.769, "eta_base": 29.333, "theta_base": -115.658, "v0": 6.730, "v1": -29.307, "v2": 38.582, "v3": -36.137, "v4": 18.616, "amplitude": 39.059, "phase_angle": 8.957, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4d", "suiteness": 0.065, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 22.902, -2.802, 71.131 ], "x_axis": [ -0.538, 0.144, -0.831 ], "y_axis": [ -0.559, 0.676, 0.479 ], "z_axis": [ 0.631, 0.723, -0.283 ], "quaternion": [ 0.462, -0.131, 0.790, 0.380 ] } }, { "index": 357, "index_chain": 36, "chain_name": "R", "nt_resnum": 36, "nt_name": "G", "nt_code": "G", "nt_id": "///R/36", "linked_nts": [ "///R/35", "///R/37" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -67.176, "beta": 178.560, "gamma": 43.975, "delta": 80.317, "epsilon": -154.438, "zeta": -68.975, "epsilon_zeta": -85.462, "bb_type": "BI", "chi": -169.607, "glyco_bond": "anti", "C5prime_xyz": [ -1.248, 8.533, 1.052 ], "P_xyz": [ 1.323, 8.723, 1.495 ], "form": "A", "ssZp": 4.684, "Dp": 4.713, "splay_angle": 23.823, "splay_distance": 3.777, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 163.661, "theta": -149.040, "eta_prime": 175.007, "theta_prime": -147.446, "eta_base": -142.543, "theta_base": -133.144, "v0": 9.697, "v1": -34.068, "v2": 44.056, "v3": -39.710, "v4": 18.971, "amplitude": 44.322, "phase_angle": 6.278, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.797, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 25.640, -1.317, 68.828 ], "x_axis": [ -0.809, 0.463, -0.361 ], "y_axis": [ -0.138, 0.449, 0.883 ], "z_axis": [ 0.571, 0.764, -0.300 ], "quaternion": [ 0.291, 0.102, 0.800, 0.515 ] } }, { "index": 358, "index_chain": 37, "chain_name": "R", "nt_resnum": 37, "nt_name": "G", "nt_code": "G", "nt_id": "///R/37", "linked_nts": [ "///R/36", "///R/38" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -75.869, "beta": -176.605, "gamma": 57.599, "delta": 77.097, "epsilon": -149.723, "zeta": -69.089, "epsilon_zeta": -80.634, "bb_type": "BI", "chi": -168.579, "glyco_bond": "anti", "C5prime_xyz": [ -1.463, 8.677, 0.936 ], "P_xyz": [ 1.093, 9.194, 1.202 ], "form": "A", "ssZp": 4.662, "Dp": 4.736, "splay_angle": 26.098, "splay_distance": 4.107, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 168.489, "theta": -142.355, "eta_prime": 177.548, "theta_prime": -139.557, "eta_base": -154.989, "theta_base": -104.585, "v0": 2.416, "v1": -29.912, "v2": 44.087, "v3": -44.281, "v4": 26.283, "amplitude": 45.805, "phase_angle": 15.738, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.837, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 27.415, 0.034, 65.780 ], "x_axis": [ -0.858, 0.500, 0.117 ], "y_axis": [ 0.276, 0.256, 0.926 ], "z_axis": [ 0.433, 0.827, -0.358 ], "quaternion": [ 0.100, 0.247, 0.786, 0.558 ] } }, { "index": 359, "index_chain": 38, "chain_name": "R", "nt_resnum": 38, "nt_name": "G", "nt_code": "G", "nt_id": "///R/38", "linked_nts": [ "///R/37", "///R/39" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -54.516, "beta": 166.294, "gamma": 50.792, "delta": 77.571, "epsilon": -154.148, "zeta": -67.518, "epsilon_zeta": -86.630, "bb_type": "BI", "chi": -166.582, "glyco_bond": "anti", "C5prime_xyz": [ -1.478, 8.743, 0.925 ], "P_xyz": [ 1.114, 9.186, 1.224 ], "form": "A", "ssZp": 4.491, "Dp": 4.598, "splay_angle": 23.671, "splay_distance": 3.668, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 172.294, "theta": -147.884, "eta_prime": -171.453, "theta_prime": -145.649, "eta_base": -119.719, "theta_base": -113.931, "v0": 2.820, "v1": -28.572, "v2": 42.269, "v3": -41.507, "v4": 24.433, "amplitude": 43.734, "phase_angle": 14.872, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.846, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 26.511, 3.481, 63.739 ], "x_axis": [ -0.519, 0.466, 0.717 ], "y_axis": [ 0.778, -0.091, 0.622 ], "z_axis": [ 0.355, 0.880, -0.315 ], "quaternion": [ -0.137, 0.471, 0.660, 0.569 ] } }, { "index": 360, "index_chain": 39, "chain_name": "R", "nt_resnum": 39, "nt_name": "U", "nt_code": "U", "nt_id": "///R/39", "linked_nts": [ "///R/38", "///R/40" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -85.677, "beta": -179.668, "gamma": 68.122, "delta": 80.990, "epsilon": -140.107, "zeta": -69.015, "epsilon_zeta": -71.092, "bb_type": "BI", "chi": -164.638, "glyco_bond": "anti", "C5prime_xyz": [ -1.361, 8.642, 0.800 ], "P_xyz": [ 1.257, 8.962, 0.745 ], "form": "A", "ssZp": 4.487, "Dp": 4.711, "splay_angle": 21.585, "splay_distance": 3.346, "splay_ratio": 0.188, "d22": 3.975, "d64": 3.626, "eta": 169.608, "theta": -136.560, "eta_prime": -177.333, "theta_prime": -135.199, "eta_base": -132.059, "theta_base": -90.754, "v0": 12.734, "v1": -36.015, "v2": 44.956, "v3": -37.727, "v4": 16.156, "amplitude": 44.987, "phase_angle": 2.125, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.455, "filter_rmsd": 0.109, "frame": { "rmsd": 0.011, "origin": [ 26.200, 7.012, 62.792 ], "x_axis": [ 0.019, 0.291, 0.956 ], "y_axis": [ 0.953, -0.295, 0.071 ], "z_axis": [ 0.303, 0.910, -0.283 ], "quaternion": [ -0.332, 0.632, 0.492, 0.498 ] } }, { "index": 361, "index_chain": 40, "chain_name": "R", "nt_resnum": 40, "nt_name": "U", "nt_code": "U", "nt_id": "///R/40", "linked_nts": [ "///R/39", "///R/41" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -65.241, "beta": 174.774, "gamma": 52.683, "delta": 84.326, "epsilon": -165.607, "zeta": -79.432, "epsilon_zeta": -86.176, "bb_type": "BI", "chi": -151.493, "glyco_bond": "anti", "C5prime_xyz": [ -1.167, 8.699, 0.025 ], "P_xyz": [ 1.441, 8.918, -0.199 ], "form": ".", "ssZp": 4.201, "Dp": 4.518, "splay_angle": 127.069, "splay_distance": 16.265, "splay_ratio": 0.895, "d22": 9.887, "d64": 13.050, "eta": 162.794, "theta": -151.537, "eta_prime": -176.610, "theta_prime": 165.679, "eta_base": -111.441, "theta_base": 133.080, "v0": 8.216, "v1": -30.403, "v2": 40.121, "v3": -36.164, "v4": 17.757, "amplitude": 40.428, "phase_angle": 7.064, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.941, "filter_rmsd": 0.108, "frame": { "rmsd": 0.008, "origin": [ 26.763, 9.985, 64.220 ], "x_axis": [ 0.668, 0.001, 0.744 ], "y_axis": [ 0.733, -0.175, -0.658 ], "z_axis": [ 0.129, 0.985, -0.118 ], "quaternion": [ 0.586, -0.700, -0.262, -0.312 ] } }, { "index": 362, "index_chain": 41, "chain_name": "R", "nt_resnum": 41, "nt_name": "U", "nt_code": "U", "nt_id": "///R/41", "linked_nts": [ "///R/40", "///R/42" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -179.121, "beta": 152.344, "gamma": 36.609, "delta": 146.148, "epsilon": -71.592, "zeta": -100.002, "epsilon_zeta": 28.409, "bb_type": "--", "chi": -126.099, "glyco_bond": "anti", "C5prime_xyz": [ -1.819, 8.708, -0.841 ], "P_xyz": [ 0.555, 9.348, 0.031 ], "form": ".", "ssZp": 0.349, "Dp": 0.319, "splay_angle": 159.301, "splay_distance": 19.221, "splay_ratio": 0.984, "d22": null, "d64": null, "eta": 47.825, "theta": -59.108, "eta_prime": 67.178, "theta_prime": -91.140, "eta_base": 38.626, "theta_base": -61.470, "v0": -25.366, "v1": 41.678, "v2": -40.973, "v3": 27.636, "v4": -1.665, "amplitude": 42.769, "phase_angle": 163.337, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1z", "suiteness": 0.552, "filter_rmsd": 0.112, "frame": { "rmsd": 0.013, "origin": [ 27.492, 14.711, 48.673 ], "x_axis": [ 0.809, -0.449, -0.380 ], "y_axis": [ 0.340, -0.172, 0.925 ], "z_axis": [ -0.480, -0.877, 0.014 ], "quaternion": [ 0.642, 0.701, -0.039, -0.307 ] } }, { "index": 363, "index_chain": 42, "chain_name": "R", "nt_resnum": 42, "nt_name": "A", "nt_code": "A", "nt_id": "///R/42", "linked_nts": [ "///R/41", "///R/43" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -42.876, "beta": -142.233, "gamma": 62.775, "delta": 144.263, "epsilon": -102.780, "zeta": 161.355, "epsilon_zeta": 95.865, "bb_type": "BII", "chi": -143.560, "glyco_bond": "anti", "C5prime_xyz": [ -2.074, 8.694, -0.214 ], "P_xyz": [ -0.448, 9.310, 1.734 ], "form": ".", "ssZp": 0.918, "Dp": 0.892, "splay_angle": 76.073, "splay_distance": 11.528, "splay_ratio": 0.618, "d22": null, "d64": null, "eta": -131.486, "theta": 167.717, "eta_prime": -84.009, "theta_prime": 172.122, "eta_base": -98.233, "theta_base": -154.296, "v0": -30.460, "v1": 42.609, "v2": -37.978, "v3": 20.985, "v4": 5.893, "amplitude": 42.393, "phase_angle": 153.617, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.134, "filter_rmsd": 0.042, "frame": { "rmsd": 0.021, "origin": [ 23.481, 13.163, 67.407 ], "x_axis": [ 0.964, -0.181, 0.196 ], "y_axis": [ 0.213, 0.077, -0.974 ], "z_axis": [ 0.161, 0.981, 0.112 ], "quaternion": [ 0.734, -0.666, -0.012, -0.134 ] } }, { "index": 364, "index_chain": 43, "chain_name": "R", "nt_resnum": 43, "nt_name": "U", "nt_code": "U", "nt_id": "///R/43", "linked_nts": [ "///R/42", "///R/44" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,non-stack,canonical,helix-end,stem-end,hairpin-loop,A-minor,phosphate", "alpha": -83.278, "beta": -176.776, "gamma": 53.755, "delta": 86.658, "epsilon": -145.262, "zeta": -69.021, "epsilon_zeta": -76.241, "bb_type": "BI", "chi": -160.566, "glyco_bond": "anti", "C5prime_xyz": [ -1.344, 8.586, 0.581 ], "P_xyz": [ 1.297, 8.669, 0.939 ], "form": "A", "ssZp": 4.381, "Dp": 4.585, "splay_angle": 28.430, "splay_distance": 4.551, "splay_ratio": 0.250, "d22": 4.152, "d64": 4.742, "eta": -150.221, "theta": -133.000, "eta_prime": -163.515, "theta_prime": -132.640, "eta_base": -148.805, "theta_base": -108.433, "v0": 7.556, "v1": -28.909, "v2": 37.987, "v3": -34.761, "v4": 17.150, "amplitude": 38.317, "phase_angle": 7.526, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.568, "filter_rmsd": 0.108, "frame": { "rmsd": 0.013, "origin": [ 13.352, 18.114, 64.999 ], "x_axis": [ 0.662, 0.735, 0.146 ], "y_axis": [ 0.627, -0.437, -0.645 ], "z_axis": [ -0.410, 0.518, -0.750 ], "quaternion": [ -0.344, 0.844, 0.404, -0.078 ] } }, { "index": 365, "index_chain": 44, "chain_name": "R", "nt_resnum": 44, "nt_name": "C", "nt_code": "C", "nt_id": "///R/44", "linked_nts": [ "///R/43", "///R/45" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,hairpin-loop,A-minor,ribose-zipper", "alpha": -74.436, "beta": -172.618, "gamma": 56.467, "delta": 80.135, "epsilon": -119.495, "zeta": -140.434, "epsilon_zeta": 20.939, "bb_type": "--", "chi": -166.920, "glyco_bond": "anti", "C5prime_xyz": [ -1.675, 8.744, 0.854 ], "P_xyz": [ 0.820, 9.434, 1.158 ], "form": "A", "ssZp": 4.513, "Dp": 4.829, "splay_angle": 21.905, "splay_distance": 3.420, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 172.845, "theta": -153.008, "eta_prime": -175.508, "theta_prime": -151.543, "eta_base": -136.760, "theta_base": -124.467, "v0": 5.292, "v1": -31.348, "v2": 44.168, "v3": -41.548, "v4": 23.133, "amplitude": 45.098, "phase_angle": 11.655, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.825, "filter_rmsd": 0.075, "frame": { "rmsd": 0.015, "origin": [ 12.162, 22.130, 63.221 ], "x_axis": [ 0.964, 0.248, -0.093 ], "y_axis": [ 0.152, -0.807, -0.570 ], "z_axis": [ -0.217, 0.536, -0.816 ], "quaternion": [ -0.292, 0.947, 0.106, -0.082 ] } }, { "index": 366, "index_chain": 45, "chain_name": "R", "nt_resnum": 45, "nt_name": "G", "nt_code": "G", "nt_id": "///R/45", "linked_nts": [ "///R/44", "///R/46" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,junction-loop,A-minor,ribose-zipper", "alpha": 101.466, "beta": -98.211, "gamma": 179.707, "delta": 90.319, "epsilon": -133.279, "zeta": -70.238, "epsilon_zeta": -63.040, "bb_type": "BI", "chi": 177.097, "glyco_bond": "anti", "C5prime_xyz": [ -1.278, 8.045, 1.989 ], "P_xyz": [ 0.495, 9.037, 0.289 ], "form": "A", "ssZp": 4.386, "Dp": 4.537, "splay_angle": 24.742, "splay_distance": 3.825, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 166.621, "theta": -144.806, "eta_prime": -176.073, "theta_prime": -153.879, "eta_base": -135.534, "theta_base": -133.046, "v0": 16.639, "v1": -33.867, "v2": 38.775, "v3": -30.201, "v4": 8.518, "amplitude": 38.964, "phase_angle": 354.359, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 12.108, 24.854, 61.154 ], "x_axis": [ 0.956, -0.197, -0.218 ], "y_axis": [ -0.289, -0.763, -0.578 ], "z_axis": [ -0.053, 0.616, -0.786 ], "quaternion": [ -0.319, 0.936, -0.130, -0.072 ] } }, { "index": 367, "index_chain": 46, "chain_name": "R", "nt_resnum": 46, "nt_name": "A", "nt_code": "A", "nt_id": "///R/46", "linked_nts": [ "///R/45", "///R/47" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,junction-loop", "alpha": -91.295, "beta": -172.332, "gamma": 63.392, "delta": 81.051, "epsilon": -138.523, "zeta": -70.404, "epsilon_zeta": -68.120, "bb_type": "BI", "chi": -166.317, "glyco_bond": "anti", "C5prime_xyz": [ -1.414, 8.540, 0.976 ], "P_xyz": [ 1.123, 8.946, 1.333 ], "form": ".", "ssZp": 4.550, "Dp": 4.714, "splay_angle": 29.286, "splay_distance": 4.408, "splay_ratio": 0.253, "d22": null, "d64": null, "eta": 159.938, "theta": -138.060, "eta_prime": 174.873, "theta_prime": -132.121, "eta_base": -144.772, "theta_base": -88.266, "v0": 9.898, "v1": -34.088, "v2": 44.342, "v3": -39.438, "v4": 18.718, "amplitude": 44.581, "phase_angle": 5.928, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.340, "filter_rmsd": 0.034, "frame": { "rmsd": 0.017, "origin": [ 12.797, 28.208, 59.447 ], "x_axis": [ 0.601, -0.627, -0.495 ], "y_axis": [ -0.797, -0.518, -0.312 ], "z_axis": [ -0.061, 0.582, -0.811 ], "quaternion": [ -0.261, 0.856, -0.416, -0.162 ] } }, { "index": 368, "index_chain": 47, "chain_name": "R", "nt_resnum": 47, "nt_name": "G", "nt_code": "G", "nt_id": "///R/47", "linked_nts": [ "///R/46", "///R/48" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,junction-loop", "alpha": -65.396, "beta": 171.136, "gamma": 62.213, "delta": 88.879, "epsilon": -151.171, "zeta": -60.668, "epsilon_zeta": -90.503, "bb_type": "BI", "chi": -162.614, "glyco_bond": "anti", "C5prime_xyz": [ -1.300, 8.571, 0.853 ], "P_xyz": [ 1.270, 8.685, 0.994 ], "form": ".", "ssZp": 4.342, "Dp": 4.511, "splay_angle": 24.211, "splay_distance": 3.741, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 172.748, "theta": -128.249, "eta_prime": -165.540, "theta_prime": -129.010, "eta_base": -104.652, "theta_base": -84.173, "v0": 11.192, "v1": -31.911, "v2": 39.225, "v3": -33.775, "v4": 14.398, "amplitude": 39.259, "phase_angle": 2.405, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.735, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 14.303, 28.502, 55.315 ], "x_axis": [ -0.190, -0.854, -0.484 ], "y_axis": [ -0.981, 0.139, 0.138 ], "z_axis": [ -0.051, 0.501, -0.864 ], "quaternion": [ 0.146, -0.620, 0.740, 0.216 ] } }, { "index": 369, "index_chain": 48, "chain_name": "R", "nt_resnum": 48, "nt_name": "A", "nt_code": "A", "nt_id": "///R/48", "linked_nts": [ "///R/47", "///R/49" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,junction-loop", "alpha": -89.986, "beta": 163.420, "gamma": 79.660, "delta": 95.592, "epsilon": -157.875, "zeta": -101.511, "epsilon_zeta": -56.365, "bb_type": "BI", "chi": -161.999, "glyco_bond": "anti", "C5prime_xyz": [ -1.589, 8.588, 0.703 ], "P_xyz": [ 0.985, 8.898, 0.170 ], "form": ".", "ssZp": 4.146, "Dp": 4.248, "splay_angle": 75.561, "splay_distance": 12.070, "splay_ratio": 0.616, "d22": null, "d64": null, "eta": 161.404, "theta": -137.114, "eta_prime": -167.554, "theta_prime": -164.668, "eta_base": -97.638, "theta_base": -160.808, "v0": 6.110, "v1": -21.746, "v2": 28.872, "v3": -26.200, "v4": 12.644, "amplitude": 29.092, "phase_angle": 7.050, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.029, "filter_rmsd": 0.036, "frame": { "rmsd": 0.014, "origin": [ 13.600, 28.139, 51.658 ], "x_axis": [ -0.834, -0.460, -0.305 ], "y_axis": [ -0.546, 0.768, 0.336 ], "z_axis": [ 0.080, 0.446, -0.891 ], "quaternion": [ 0.103, -0.269, 0.935, 0.209 ] } }, { "index": 370, "index_chain": 49, "chain_name": "R", "nt_resnum": 49, "nt_name": "U", "nt_code": "U", "nt_id": "///R/49", "linked_nts": [ "///R/48", "///R/50" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,non-stack,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,phosphate,splayed-apart", "alpha": 106.502, "beta": -161.810, "gamma": -24.654, "delta": 114.563, "epsilon": 55.323, "zeta": 127.718, "epsilon_zeta": -72.395, "bb_type": "--", "chi": -95.338, "glyco_bond": "anti", "C5prime_xyz": [ -2.280, 7.677, -2.637 ], "P_xyz": [ -1.376, 9.920, -3.586 ], "form": ".", "ssZp": 0.374, "Dp": 0.453, "splay_angle": 87.621, "splay_distance": 13.424, "splay_ratio": 0.693, "d22": 8.164, "d64": 9.665, "eta": -45.727, "theta": -77.124, "eta_prime": -41.649, "theta_prime": -128.821, "eta_base": -69.624, "theta_base": -135.676, "v0": -6.921, "v1": 3.958, "v2": 0.154, "v3": -4.094, "v4": 6.917, "amplitude": 7.114, "phase_angle": 88.757, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.047, "origin": [ 20.857, 34.355, 44.284 ], "x_axis": [ -0.188, 0.728, -0.659 ], "y_axis": [ -0.452, 0.532, 0.716 ], "z_axis": [ 0.872, 0.432, 0.229 ], "quaternion": [ 0.627, 0.113, 0.610, 0.470 ] } }, { "index": 371, "index_chain": 50, "chain_name": "R", "nt_resnum": 50, "nt_name": "U", "nt_code": "U", "nt_id": "///R/50", "linked_nts": [ "///R/49", "///R/51" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,cap-donor,phosphate,splayed-apart", "alpha": -176.353, "beta": -133.128, "gamma": 3.405, "delta": 152.654, "epsilon": -100.203, "zeta": 88.883, "epsilon_zeta": 170.914, "bb_type": "--", "chi": -102.427, "glyco_bond": "anti", "C5prime_xyz": [ -1.185, 7.734, -1.833 ], "P_xyz": [ 0.016, 9.877, -1.071 ], "form": ".", "ssZp": -0.408, "Dp": 1.405, "splay_angle": 155.566, "splay_distance": 18.961, "splay_ratio": 0.977, "d22": 11.283, "d64": 14.592, "eta": 100.820, "theta": 105.872, "eta_prime": 169.528, "theta_prime": 69.452, "eta_base": -173.668, "theta_base": 62.762, "v0": 2.069, "v1": 18.841, "v2": -31.583, "v3": 33.383, "v4": -22.391, "amplitude": 34.031, "phase_angle": 201.863, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.007, "origin": [ 27.906, 38.088, 55.081 ], "x_axis": [ 0.110, 0.157, -0.981 ], "y_axis": [ -0.958, -0.245, -0.147 ], "z_axis": [ -0.264, 0.957, 0.123 ], "quaternion": [ 0.497, -0.555, 0.361, 0.561 ] } }, { "index": 372, "index_chain": 51, "chain_name": "R", "nt_resnum": 51, "nt_name": "U", "nt_code": "U", "nt_id": "///R/51", "linked_nts": [ "///R/50", "///R/52" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,junction-loop,cap-acceptor,splayed-apart", "alpha": 56.251, "beta": -177.828, "gamma": 44.123, "delta": 154.978, "epsilon": -58.230, "zeta": -68.367, "epsilon_zeta": 10.137, "bb_type": "--", "chi": -135.862, "glyco_bond": "anti", "C5prime_xyz": [ -1.507, 8.633, -0.285 ], "P_xyz": [ 0.514, 8.847, 1.374 ], "form": ".", "ssZp": -0.009, "Dp": 0.164, "splay_angle": 128.434, "splay_distance": 17.097, "splay_ratio": 0.901, "d22": 8.864, "d64": 10.791, "eta": -16.437, "theta": 6.948, "eta_prime": 8.251, "theta_prime": -22.999, "eta_base": 12.351, "theta_base": 17.700, "v0": -19.855, "v1": 36.970, "v2": -39.729, "v3": 28.889, "v4": -5.980, "amplitude": 40.364, "phase_angle": 169.820, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.612, "filter_rmsd": 0.114, "frame": { "rmsd": 0.015, "origin": [ 12.286, 28.684, 60.284 ], "x_axis": [ -0.471, 0.719, 0.511 ], "y_axis": [ 0.818, 0.573, -0.054 ], "z_axis": [ -0.332, 0.392, -0.858 ], "quaternion": [ -0.247, 0.451, 0.852, 0.099 ] } }, { "index": 373, "index_chain": 52, "chain_name": "R", "nt_resnum": 52, "nt_name": "C", "nt_code": "C", "nt_id": "///R/52", "linked_nts": [ "///R/51", "///R/53" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,bulge,junction-loop,cap-acceptor,splayed-apart", "alpha": -66.549, "beta": -170.126, "gamma": 52.924, "delta": 80.511, "epsilon": -142.394, "zeta": -64.218, "epsilon_zeta": -78.176, "bb_type": "BI", "chi": -167.478, "glyco_bond": "anti", "C5prime_xyz": [ -1.261, 8.656, 0.912 ], "P_xyz": [ 1.259, 8.802, 1.516 ], "form": ".", "ssZp": 4.563, "Dp": 4.672, "splay_angle": 30.171, "splay_distance": 4.555, "splay_ratio": 0.261, "d22": null, "d64": null, "eta": 147.197, "theta": -130.356, "eta_prime": -172.106, "theta_prime": -125.188, "eta_base": -171.333, "theta_base": -79.083, "v0": 4.375, "v1": -29.025, "v2": 40.998, "v3": -39.967, "v4": 22.403, "amplitude": 42.065, "phase_angle": 12.931, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.182, "filter_rmsd": 0.072, "frame": { "rmsd": 0.011, "origin": [ 27.815, 35.450, 57.972 ], "x_axis": [ -0.239, -0.136, 0.961 ], "y_axis": [ -0.771, -0.575, -0.273 ], "z_axis": [ 0.590, -0.807, 0.032 ], "quaternion": [ 0.233, 0.571, -0.397, 0.679 ] } }, { "index": 374, "index_chain": 53, "chain_name": "R", "nt_resnum": 53, "nt_name": "G", "nt_code": "G", "nt_id": "///R/53", "linked_nts": [ "///R/52", "///R/54" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,bulge", "alpha": -84.227, "beta": -165.044, "gamma": 58.425, "delta": 80.776, "epsilon": -150.074, "zeta": -66.413, "epsilon_zeta": -83.661, "bb_type": "BI", "chi": -167.812, "glyco_bond": "anti", "C5prime_xyz": [ -1.227, 8.603, 0.993 ], "P_xyz": [ 1.329, 8.653, 1.561 ], "form": "A", "ssZp": 4.602, "Dp": 4.683, "splay_angle": 25.137, "splay_distance": 3.988, "splay_ratio": 0.222, "d22": null, "d64": null, "eta": 162.631, "theta": -140.700, "eta_prime": 179.575, "theta_prime": -139.345, "eta_base": -116.808, "theta_base": -116.665, "v0": 8.791, "v1": -32.604, "v2": 43.200, "v3": -38.572, "v4": 19.023, "amplitude": 43.520, "phase_angle": 6.947, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.584, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ 28.698, 32.348, 61.188 ], "x_axis": [ -0.924, -0.228, 0.306 ], "y_axis": [ -0.240, -0.277, -0.930 ], "z_axis": [ 0.297, -0.934, 0.201 ], "quaternion": [ 0.004, 0.195, -0.601, 0.775 ] } }, { "index": 375, "index_chain": 54, "chain_name": "R", "nt_resnum": 54, "nt_name": "G", "nt_code": "G", "nt_id": "///R/54", "linked_nts": [ "///R/53", "///R/55" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -67.117, "beta": 177.894, "gamma": 55.249, "delta": 74.652, "epsilon": -146.018, "zeta": -73.136, "epsilon_zeta": -72.882, "bb_type": "BI", "chi": -168.158, "glyco_bond": "anti", "C5prime_xyz": [ -1.357, 8.689, 0.978 ], "P_xyz": [ 1.169, 9.243, 1.139 ], "form": "A", "ssZp": 4.621, "Dp": 4.764, "splay_angle": 21.942, "splay_distance": 3.500, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 170.597, "theta": -150.435, "eta_prime": -177.465, "theta_prime": -146.604, "eta_base": -138.677, "theta_base": -117.187, "v0": 3.425, "v1": -29.533, "v2": 43.198, "v3": -42.165, "v4": 24.677, "amplitude": 44.579, "phase_angle": 14.299, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.870, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ 29.120, 29.436, 63.880 ], "x_axis": [ -0.923, -0.311, -0.227 ], "y_axis": [ 0.278, -0.130, -0.952 ], "z_axis": [ 0.267, -0.941, 0.206 ], "quaternion": [ -0.196, 0.013, -0.630, 0.752 ] } }, { "index": 376, "index_chain": 55, "chain_name": "R", "nt_resnum": 55, "nt_name": "C", "nt_code": "C", "nt_id": "///R/55", "linked_nts": [ "///R/54", "///R/56" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -71.561, "beta": 165.841, "gamma": 64.845, "delta": 77.050, "epsilon": -143.205, "zeta": -76.468, "epsilon_zeta": -66.737, "bb_type": "BI", "chi": -165.204, "glyco_bond": "anti", "C5prime_xyz": [ -1.443, 8.799, 0.772 ], "P_xyz": [ 1.038, 9.295, 0.188 ], "form": "A", "ssZp": 4.579, "Dp": 4.775, "splay_angle": 24.236, "splay_distance": 3.883, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 167.186, "theta": -147.320, "eta_prime": -179.240, "theta_prime": -147.659, "eta_base": -136.117, "theta_base": -126.105, "v0": 3.825, "v1": -30.526, "v2": 44.301, "v3": -43.173, "v4": 24.903, "amplitude": 45.636, "phase_angle": 13.894, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.684, "filter_rmsd": 0.072, "frame": { "rmsd": 0.014, "origin": [ 28.039, 26.605, 65.631 ], "x_axis": [ -0.658, -0.326, -0.679 ], "y_axis": [ 0.742, -0.129, -0.657 ], "z_axis": [ 0.127, -0.937, 0.327 ], "quaternion": [ -0.367, -0.190, -0.548, 0.727 ] } }, { "index": 377, "index_chain": 56, "chain_name": "R", "nt_resnum": 56, "nt_name": "G", "nt_code": "G", "nt_id": "///R/56", "linked_nts": [ "///R/55", "///R/57" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor", "alpha": -54.676, "beta": 169.305, "gamma": 52.329, "delta": 80.528, "epsilon": -166.302, "zeta": -67.557, "epsilon_zeta": -98.744, "bb_type": "BI", "chi": -161.574, "glyco_bond": "anti", "C5prime_xyz": [ -1.577, 8.707, 0.627 ], "P_xyz": [ 0.937, 9.387, 0.689 ], "form": ".", "ssZp": 4.376, "Dp": 4.502, "splay_angle": 23.339, "splay_distance": 4.120, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 174.438, "theta": -126.599, "eta_prime": -171.951, "theta_prime": -133.443, "eta_base": -134.566, "theta_base": -108.654, "v0": 2.731, "v1": -26.988, "v2": 39.705, "v3": -39.359, "v4": 23.212, "amplitude": 41.115, "phase_angle": 15.048, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.860, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 26.233, 23.352, 66.741 ], "x_axis": [ -0.220, -0.180, -0.959 ], "y_axis": [ 0.975, -0.044, -0.216 ], "z_axis": [ -0.003, -0.983, 0.185 ], "quaternion": [ -0.480, -0.400, -0.498, 0.602 ] } }, { "index": 378, "index_chain": 57, "chain_name": "R", "nt_resnum": 57, "nt_name": "G", "nt_code": "G", "nt_id": "///R/57", "linked_nts": [ "///R/56", "///R/58" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": 163.759, "beta": -160.334, "gamma": 170.956, "delta": 79.927, "epsilon": -128.342, "zeta": -65.202, "epsilon_zeta": -63.140, "bb_type": "BI", "chi": -178.451, "glyco_bond": "anti", "C5prime_xyz": [ -1.661, 8.508, 1.583 ], "P_xyz": [ -0.115, 10.227, 0.439 ], "form": ".", "ssZp": 4.630, "Dp": 4.679, "splay_angle": 29.172, "splay_distance": 4.484, "splay_ratio": 0.252, "d22": null, "d64": null, "eta": 169.923, "theta": -149.121, "eta_prime": -172.477, "theta_prime": -145.136, "eta_base": -127.079, "theta_base": -86.846, "v0": 5.433, "v1": -30.653, "v2": 42.444, "v3": -39.662, "v4": 22.048, "amplitude": 43.253, "phase_angle": 11.098, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.803, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 23.955, 20.129, 65.558 ], "x_axis": [ 0.311, -0.168, -0.936 ], "y_axis": [ 0.946, -0.040, 0.321 ], "z_axis": [ -0.092, -0.985, 0.146 ], "quaternion": [ 0.595, 0.549, 0.355, -0.468 ] } }, { "index": 379, "index_chain": 58, "chain_name": "R", "nt_resnum": 58, "nt_name": "A", "nt_code": "A", "nt_id": "///R/58", "linked_nts": [ "///R/57", "///R/59" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -64.747, "beta": 173.283, "gamma": 46.468, "delta": 82.646, "epsilon": -118.344, "zeta": -143.084, "epsilon_zeta": 24.740, "bb_type": "--", "chi": -164.092, "glyco_bond": "anti", "C5prime_xyz": [ -1.113, 8.601, 0.694 ], "P_xyz": [ 1.482, 8.888, 0.724 ], "form": ".", "ssZp": 4.436, "Dp": 4.862, "splay_angle": 101.773, "splay_distance": 14.060, "splay_ratio": 0.776, "d22": null, "d64": null, "eta": 162.885, "theta": -174.748, "eta_prime": -177.015, "theta_prime": 155.826, "eta_base": -102.646, "theta_base": 107.621, "v0": 11.593, "v1": -34.402, "v2": 43.342, "v3": -37.060, "v4": 16.370, "amplitude": 43.409, "phase_angle": 3.190, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.724, "filter_rmsd": 0.049, "frame": { "rmsd": 0.016, "origin": [ 25.371, 16.621, 63.151 ], "x_axis": [ 0.969, -0.122, -0.216 ], "y_axis": [ 0.220, 0.017, 0.975 ], "z_axis": [ -0.115, -0.992, 0.043 ], "quaternion": [ 0.712, 0.691, 0.036, -0.120 ] } }, { "index": 380, "index_chain": 59, "chain_name": "R", "nt_resnum": 59, "nt_name": "U", "nt_code": "U", "nt_id": "///R/59", "linked_nts": [ "///R/58", "///R/60" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 66.559, "beta": -166.689, "gamma": 161.865, "delta": 154.014, "epsilon": -98.253, "zeta": -54.107, "epsilon_zeta": -44.146, "bb_type": "--", "chi": -145.643, "glyco_bond": "anti", "C5prime_xyz": [ -1.608, 8.524, 0.525 ], "P_xyz": [ 0.808, 9.117, -0.020 ], "form": ".", "ssZp": 0.426, "Dp": 0.553, "splay_angle": 118.629, "splay_distance": 16.556, "splay_ratio": 0.860, "d22": null, "d64": null, "eta": 121.507, "theta": -80.785, "eta_prime": 114.691, "theta_prime": -78.535, "eta_base": 87.306, "theta_base": -48.738, "v0": -12.130, "v1": 33.190, "v2": -40.481, "v3": 34.555, "v4": -14.420, "amplitude": 40.499, "phase_angle": 181.680, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.104, "frame": { "rmsd": 0.008, "origin": [ 17.098, 16.444, 74.518 ], "x_axis": [ 0.623, 0.692, 0.365 ], "y_axis": [ 0.775, -0.484, -0.406 ], "z_axis": [ -0.105, 0.536, -0.838 ], "quaternion": [ -0.275, 0.858, 0.427, 0.076 ] } }, { "index": 381, "index_chain": 60, "chain_name": "R", "nt_resnum": 60, "nt_name": "G", "nt_code": "G", "nt_id": "///R/60", "linked_nts": [ "///R/59", "///R/61" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -70.423, "beta": -177.147, "gamma": 64.196, "delta": 86.756, "epsilon": -136.068, "zeta": -72.606, "epsilon_zeta": -63.462, "bb_type": "BI", "chi": -175.998, "glyco_bond": "anti", "C5prime_xyz": [ -1.657, 8.527, 1.402 ], "P_xyz": [ 0.823, 8.860, 2.156 ], "form": ".", "ssZp": 4.433, "Dp": 4.543, "splay_angle": 22.398, "splay_distance": 3.480, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 165.692, "theta": -130.358, "eta_prime": -147.948, "theta_prime": -127.543, "eta_base": -123.518, "theta_base": -74.834, "v0": 3.857, "v1": -26.464, "v2": 38.130, "v3": -36.576, "v4": 20.838, "amplitude": 39.133, "phase_angle": 13.000, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.568, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 25.291, 9.904, 61.703 ], "x_axis": [ 0.715, -0.179, 0.676 ], "y_axis": [ -0.670, 0.105, 0.735 ], "z_axis": [ -0.203, -0.978, -0.045 ], "quaternion": [ 0.666, 0.643, -0.330, 0.184 ] } }, { "index": 382, "index_chain": 61, "chain_name": "R", "nt_resnum": 61, "nt_name": "A", "nt_code": "A", "nt_id": "///R/61", "linked_nts": [ "///R/60", "///R/62" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.106, "beta": 171.609, "gamma": 37.925, "delta": 85.890, "epsilon": -150.704, "zeta": -67.385, "epsilon_zeta": -83.319, "bb_type": "BI", "chi": -148.947, "glyco_bond": "anti", "C5prime_xyz": [ -1.368, 8.602, -0.094 ], "P_xyz": [ 1.188, 8.931, 0.115 ], "form": "A", "ssZp": 4.082, "Dp": 4.639, "splay_angle": 21.241, "splay_distance": 3.409, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 160.955, "theta": -140.922, "eta_prime": -178.199, "theta_prime": -141.678, "eta_base": -107.390, "theta_base": -116.348, "v0": 15.782, "v1": -38.642, "v2": 46.039, "v3": -36.965, "v4": 13.854, "amplitude": 46.054, "phase_angle": 358.542, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.528, "filter_rmsd": 0.043, "frame": { "rmsd": 0.025, "origin": [ 26.142, 6.845, 63.126 ], "x_axis": [ -0.060, -0.057, 0.997 ], "y_axis": [ -0.998, 0.034, -0.058 ], "z_axis": [ -0.030, -0.998, -0.058 ], "quaternion": [ -0.478, -0.491, 0.537, -0.492 ] } }, { "index": 383, "index_chain": 62, "chain_name": "R", "nt_resnum": 62, "nt_name": "C", "nt_code": "C", "nt_id": "///R/62", "linked_nts": [ "///R/61", "///R/63" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -77.802, "beta": 164.868, "gamma": 57.697, "delta": 75.571, "epsilon": -150.373, "zeta": -71.289, "epsilon_zeta": -79.084, "bb_type": "BI", "chi": -155.472, "glyco_bond": "anti", "C5prime_xyz": [ -1.554, 8.804, 0.321 ], "P_xyz": [ 0.939, 9.254, -0.052 ], "form": "A", "ssZp": 4.291, "Dp": 4.685, "splay_angle": 24.627, "splay_distance": 3.834, "splay_ratio": 0.213, "d22": 3.794, "d64": 3.696, "eta": 159.013, "theta": -143.873, "eta_prime": 173.630, "theta_prime": -142.953, "eta_base": -144.921, "theta_base": -104.545, "v0": 6.199, "v1": -34.247, "v2": 47.385, "v3": -44.636, "v4": 24.663, "amplitude": 48.303, "phase_angle": 11.191, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.770, "filter_rmsd": 0.068, "frame": { "rmsd": 0.012, "origin": [ 26.651, 3.609, 64.068 ], "x_axis": [ -0.556, 0.174, 0.813 ], "y_axis": [ -0.830, -0.068, -0.554 ], "z_axis": [ -0.041, -0.982, 0.182 ], "quaternion": [ 0.373, 0.287, -0.571, 0.672 ] } }, { "index": 384, "index_chain": 63, "chain_name": "R", "nt_resnum": 63, "nt_name": "U", "nt_code": "U", "nt_id": "///R/63", "linked_nts": [ "///R/62", "///R/64" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -48.471, "beta": 173.780, "gamma": 37.864, "delta": 77.942, "epsilon": -166.927, "zeta": -80.598, "epsilon_zeta": -86.329, "bb_type": "BI", "chi": -151.126, "glyco_bond": "anti", "C5prime_xyz": [ -1.246, 8.680, 0.088 ], "P_xyz": [ 1.361, 8.953, 0.311 ], "form": "A", "ssZp": 4.229, "Dp": 4.626, "splay_angle": 19.224, "splay_distance": 3.032, "splay_ratio": 0.167, "d22": 4.351, "d64": 4.134, "eta": 172.210, "theta": -147.729, "eta_prime": -173.288, "theta_prime": -153.443, "eta_base": -119.677, "theta_base": -142.651, "v0": 13.056, "v1": -36.196, "v2": 44.024, "v3": -37.759, "v4": 15.792, "amplitude": 44.046, "phase_angle": 1.817, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.475, "filter_rmsd": 0.107, "frame": { "rmsd": 0.007, "origin": [ 25.449, 1.027, 66.634 ], "x_axis": [ -0.945, 0.246, 0.214 ], "y_axis": [ -0.282, -0.290, -0.915 ], "z_axis": [ -0.163, -0.925, 0.343 ], "quaternion": [ 0.165, 0.016, -0.573, 0.803 ] } }, { "index": 385, "index_chain": 64, "chain_name": "R", "nt_resnum": 64, "nt_name": "C", "nt_code": "C", "nt_id": "///R/64", "linked_nts": [ "///R/63", "///R/65" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 171.256, "beta": -167.754, "gamma": 150.407, "delta": 85.469, "epsilon": -130.346, "zeta": -64.871, "epsilon_zeta": -65.476, "bb_type": "BI", "chi": -166.936, "glyco_bond": "anti", "C5prime_xyz": [ -0.791, 8.228, 1.188 ], "P_xyz": [ 1.301, 9.079, -0.089 ], "form": "A", "ssZp": 4.515, "Dp": 4.723, "splay_angle": 25.247, "splay_distance": 4.113, "splay_ratio": 0.224, "d22": 4.134, "d64": 4.608, "eta": 160.291, "theta": -140.530, "eta_prime": 169.663, "theta_prime": -139.870, "eta_base": -164.264, "theta_base": -117.628, "v0": 21.595, "v1": -38.231, "v2": 39.739, "v3": -29.084, "v4": 4.855, "amplitude": 40.620, "phase_angle": 348.049, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.057, "filter_rmsd": 0.070, "frame": { "rmsd": 0.009, "origin": [ 25.541, -1.184, 68.708 ], "x_axis": [ -0.933, 0.270, -0.236 ], "y_axis": [ 0.057, -0.538, -0.841 ], "z_axis": [ -0.354, -0.799, 0.486 ], "quaternion": [ 0.062, -0.172, -0.477, 0.860 ] } }, { "index": 386, "index_chain": 65, "chain_name": "R", "nt_resnum": 65, "nt_name": "C", "nt_code": "C", "nt_id": "///R/65", "linked_nts": [ "///R/64", "///R/66" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -61.411, "beta": 172.596, "gamma": 58.080, "delta": 77.453, "epsilon": -154.932, "zeta": -63.163, "epsilon_zeta": -91.769, "bb_type": "BI", "chi": -161.145, "glyco_bond": "anti", "C5prime_xyz": [ -1.687, 8.860, 0.527 ], "P_xyz": [ 0.800, 9.585, 0.703 ], "form": "A", "ssZp": 4.314, "Dp": 4.535, "splay_angle": 23.100, "splay_distance": 3.768, "splay_ratio": 0.201, "d22": 4.142, "d64": 4.192, "eta": 171.287, "theta": -147.302, "eta_prime": -168.657, "theta_prime": -146.862, "eta_base": -129.091, "theta_base": -117.003, "v0": 0.135, "v1": -26.934, "v2": 41.562, "v3": -43.050, "v4": 27.176, "amplitude": 43.864, "phase_angle": 18.644, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.765, "filter_rmsd": 0.071, "frame": { "rmsd": 0.011, "origin": [ 22.554, -2.573, 71.171 ], "x_axis": [ -0.684, 0.064, -0.726 ], "y_axis": [ 0.526, -0.646, -0.552 ], "z_axis": [ -0.505, -0.760, 0.409 ], "quaternion": [ -0.140, -0.372, -0.397, 0.828 ] } }, { "index": 387, "index_chain": 66, "chain_name": "R", "nt_resnum": 66, "nt_name": "C", "nt_code": "C", "nt_id": "///R/66", "linked_nts": [ "///R/65", "///R/67" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -72.951, "beta": 174.660, "gamma": 55.179, "delta": 81.462, "epsilon": -138.460, "zeta": -78.154, "epsilon_zeta": -60.306, "bb_type": "BI", "chi": -161.564, "glyco_bond": "anti", "C5prime_xyz": [ -1.533, 8.829, 0.600 ], "P_xyz": [ 1.007, 9.473, 0.806 ], "form": "A", "ssZp": 4.398, "Dp": 4.653, "splay_angle": 17.909, "splay_distance": 2.937, "splay_ratio": 0.157, "d22": null, "d64": null, "eta": 168.185, "theta": -144.183, "eta_prime": -178.847, "theta_prime": -141.975, "eta_base": -135.782, "theta_base": -112.081, "v0": 0.647, "v1": -24.353, "v2": 37.391, "v3": -38.175, "v4": 23.656, "amplitude": 39.259, "phase_angle": 17.747, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.877, "filter_rmsd": 0.069, "frame": { "rmsd": 0.007, "origin": [ 19.496, -4.427, 72.359 ], "x_axis": [ -0.202, -0.212, -0.956 ], "y_axis": [ 0.809, -0.587, -0.041 ], "z_axis": [ -0.552, -0.781, 0.291 ], "quaternion": [ -0.354, -0.523, -0.285, 0.721 ] } }, { "index": 388, "index_chain": 67, "chain_name": "R", "nt_resnum": 67, "nt_name": "G", "nt_code": "G", "nt_id": "///R/67", "linked_nts": [ "///R/66", "///R/68" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor", "alpha": -66.488, "beta": 166.265, "gamma": 52.807, "delta": 80.752, "epsilon": -176.512, "zeta": -64.458, "epsilon_zeta": -112.054, "bb_type": "BI", "chi": -154.463, "glyco_bond": "anti", "C5prime_xyz": [ -1.910, 8.867, 0.174 ], "P_xyz": [ 0.602, 9.533, -0.066 ], "form": "A", "ssZp": 4.325, "Dp": 4.452, "splay_angle": 25.510, "splay_distance": 4.252, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 156.341, "theta": -131.615, "eta_prime": 176.173, "theta_prime": -144.153, "eta_base": -136.741, "theta_base": -115.072, "v0": -0.549, "v1": -24.860, "v2": 38.820, "v3": -40.059, "v4": 25.832, "amplitude": 41.104, "phase_angle": 19.189, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.911, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 17.097, -6.070, 71.940 ], "x_axis": [ 0.334, -0.358, -0.872 ], "y_axis": [ 0.664, -0.567, 0.487 ], "z_axis": [ -0.668, -0.742, 0.048 ], "quaternion": [ 0.452, 0.681, 0.113, -0.566 ] } }, { "index": 389, "index_chain": 68, "chain_name": "R", "nt_resnum": 68, "nt_name": "G", "nt_code": "G", "nt_id": "///R/68", "linked_nts": [ "///R/67", "///R/69" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": 158.116, "beta": -177.701, "gamma": 174.175, "delta": 88.933, "epsilon": -142.798, "zeta": -84.050, "epsilon_zeta": -58.748, "bb_type": "BI", "chi": -176.632, "glyco_bond": "anti", "C5prime_xyz": [ -0.902, 8.029, 1.563 ], "P_xyz": [ 0.715, 9.825, 0.634 ], "form": "A", "ssZp": 4.712, "Dp": 4.725, "splay_angle": 24.381, "splay_distance": 3.777, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 166.976, "theta": -171.837, "eta_prime": -179.491, "theta_prime": -165.253, "eta_base": -125.511, "theta_base": -150.433, "v0": 23.880, "v1": -41.439, "v2": 42.701, "v3": -30.096, "v4": 4.082, "amplitude": 43.883, "phase_angle": 346.669, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.796, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 14.590, -8.636, 69.657 ], "x_axis": [ 0.657, -0.626, -0.420 ], "y_axis": [ 0.327, -0.265, 0.907 ], "z_axis": [ -0.679, -0.734, 0.030 ], "quaternion": [ 0.596, 0.688, -0.109, -0.399 ] } }, { "index": 390, "index_chain": 69, "chain_name": "R", "nt_resnum": 69, "nt_name": "U", "nt_code": "U", "nt_id": "///R/69", "linked_nts": [ "///R/68", "///R/70" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor", "alpha": -46.417, "beta": 171.778, "gamma": 42.311, "delta": 77.877, "epsilon": -154.632, "zeta": -65.993, "epsilon_zeta": -88.639, "bb_type": "BI", "chi": -154.866, "glyco_bond": "anti", "C5prime_xyz": [ -1.420, 8.792, 0.223 ], "P_xyz": [ 1.218, 9.050, 0.501 ], "form": "A", "ssZp": 4.293, "Dp": 4.642, "splay_angle": 24.419, "splay_distance": 3.828, "splay_ratio": 0.212, "d22": 3.878, "d64": 3.839, "eta": 174.638, "theta": -142.102, "eta_prime": -174.965, "theta_prime": -139.427, "eta_base": -154.978, "theta_base": -105.112, "v0": 4.963, "v1": -30.243, "v2": 43.100, "v3": -41.347, "v4": 22.862, "amplitude": 44.119, "phase_angle": 12.333, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.514, "filter_rmsd": 0.106, "frame": { "rmsd": 0.007, "origin": [ 11.732, -9.972, 67.581 ], "x_axis": [ 0.722, -0.692, 0.016 ], "y_axis": [ -0.093, -0.074, 0.993 ], "z_axis": [ -0.686, -0.718, -0.118 ], "quaternion": [ 0.618, 0.692, -0.284, -0.242 ] } }, { "index": 391, "index_chain": 70, "chain_name": "R", "nt_resnum": 70, "nt_name": "U", "nt_code": "U", "nt_id": "///R/70", "linked_nts": [ "///R/69", "///R/71" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.091, "beta": 175.624, "gamma": 52.088, "delta": 77.842, "epsilon": -139.841, "zeta": -76.309, "epsilon_zeta": -63.532, "bb_type": "BI", "chi": -157.212, "glyco_bond": "anti", "C5prime_xyz": [ -1.403, 8.760, 0.412 ], "P_xyz": [ 1.191, 9.062, 0.456 ], "form": "A", "ssZp": 4.376, "Dp": 4.775, "splay_angle": 20.228, "splay_distance": 3.298, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 168.218, "theta": -143.373, "eta_prime": -178.813, "theta_prime": -142.327, "eta_base": -130.574, "theta_base": -120.894, "v0": 10.258, "v1": -35.570, "v2": 46.077, "v3": -40.659, "v4": 19.535, "amplitude": 46.313, "phase_angle": 5.784, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.918, "filter_rmsd": 0.113, "frame": { "rmsd": 0.013, "origin": [ 10.964, -13.615, 66.690 ], "x_axis": [ 0.635, -0.444, 0.632 ], "y_axis": [ -0.567, 0.287, 0.772 ], "z_axis": [ -0.525, -0.849, -0.069 ], "quaternion": [ 0.681, 0.595, -0.425, 0.045 ] } }, { "index": 392, "index_chain": 71, "chain_name": "R", "nt_resnum": 71, "nt_name": "G", "nt_code": "G", "nt_id": "///R/71", "linked_nts": [ "///R/70", "///R/72" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -64.568, "beta": 163.468, "gamma": 61.862, "delta": 77.345, "epsilon": -141.365, "zeta": 116.296, "epsilon_zeta": 102.339, "bb_type": "--", "chi": -162.619, "glyco_bond": "anti", "C5prime_xyz": [ -1.712, 8.859, 0.533 ], "P_xyz": [ 0.777, 9.502, 0.212 ], "form": ".", "ssZp": 4.386, "Dp": 4.650, "splay_angle": 106.674, "splay_distance": 12.780, "splay_ratio": 0.807, "d22": null, "d64": null, "eta": 169.427, "theta": 39.249, "eta_prime": -177.762, "theta_prime": 40.229, "eta_base": -142.366, "theta_base": 69.353, "v0": -3.213, "v1": -25.566, "v2": 43.121, "v3": -45.802, "v4": 30.889, "amplitude": 46.595, "phase_angle": 22.266, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.806, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 11.055, -16.882, 66.255 ], "x_axis": [ 0.394, -0.068, 0.916 ], "y_axis": [ -0.866, 0.307, 0.395 ], "z_axis": [ -0.308, -0.949, 0.062 ], "quaternion": [ 0.664, 0.506, -0.461, 0.300 ] } }, { "index": 393, "index_chain": 72, "chain_name": "R", "nt_resnum": 72, "nt_name": "U", "nt_code": "U", "nt_id": "///R/72", "linked_nts": [ "///R/71", "///R/73" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,BII,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -103.372, "beta": 177.207, "gamma": 45.948, "delta": 117.509, "epsilon": -98.147, "zeta": 167.874, "epsilon_zeta": 93.979, "bb_type": "BII", "chi": 55.892, "glyco_bond": "syn", "C5prime_xyz": [ -5.632, 4.374, 1.389 ], "P_xyz": [ -6.420, 1.877, 1.068 ], "form": ".", "ssZp": -1.308, "Dp": 1.826, "splay_angle": 149.688, "splay_distance": 18.326, "splay_ratio": 0.965, "d22": 12.267, "d64": 15.429, "eta": -176.933, "theta": 134.967, "eta_prime": -155.232, "theta_prime": 122.959, "eta_base": -159.213, "theta_base": -3.493, "v0": -26.083, "v1": 25.577, "v2": -16.191, "v3": 1.741, "v4": 15.194, "amplitude": 26.641, "phase_angle": 127.425, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.108, "frame": { "rmsd": 0.012, "origin": [ -1.037, -13.244, 64.287 ], "x_axis": [ -0.517, 0.852, -0.081 ], "y_axis": [ -0.465, -0.201, 0.862 ], "z_axis": [ 0.718, 0.483, 0.500 ], "quaternion": [ 0.442, 0.214, 0.452, 0.745 ] } }, { "index": 394, "index_chain": 73, "chain_name": "R", "nt_resnum": 73, "nt_name": "U", "nt_code": "U", "nt_id": "///R/73", "linked_nts": [ "///R/72", "///R/74" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -49.572, "beta": -138.415, "gamma": 99.820, "delta": 80.417, "epsilon": -151.901, "zeta": -65.556, "epsilon_zeta": -86.345, "bb_type": "BI", "chi": -172.386, "glyco_bond": "anti", "C5prime_xyz": [ -1.801, 8.694, 1.273 ], "P_xyz": [ 0.810, 8.863, 1.515 ], "form": "A", "ssZp": 4.550, "Dp": 4.575, "splay_angle": 23.005, "splay_distance": 3.722, "splay_ratio": 0.204, "d22": 4.236, "d64": 4.484, "eta": -43.932, "theta": -134.396, "eta_prime": -46.287, "theta_prime": -138.081, "eta_base": 84.914, "theta_base": -106.631, "v0": 3.672, "v1": -27.842, "v2": 40.124, "v3": -38.476, "v4": 22.201, "amplitude": 41.227, "phase_angle": 13.288, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.009, "origin": [ 1.815, -28.496, 74.037 ], "x_axis": [ 0.128, -0.297, -0.946 ], "y_axis": [ -0.561, 0.765, -0.316 ], "z_axis": [ 0.818, 0.571, -0.069 ], "quaternion": [ 0.675, -0.329, 0.653, 0.098 ] } }, { "index": 395, "index_chain": 74, "chain_name": "R", "nt_resnum": 74, "nt_name": "C", "nt_code": "C", "nt_id": "///R/74", "linked_nts": [ "///R/73", "///R/75" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -72.001, "beta": 173.136, "gamma": 58.607, "delta": 77.911, "epsilon": -138.610, "zeta": -83.131, "epsilon_zeta": -55.479, "bb_type": "BI", "chi": -165.940, "glyco_bond": "anti", "C5prime_xyz": [ -1.560, 8.806, 0.881 ], "P_xyz": [ 0.992, 9.414, 1.041 ], "form": "A", "ssZp": 4.565, "Dp": 4.728, "splay_angle": 22.282, "splay_distance": 3.519, "splay_ratio": 0.194, "d22": null, "d64": null, "eta": 168.892, "theta": -151.049, "eta_prime": -176.674, "theta_prime": -148.303, "eta_base": -125.017, "theta_base": -123.699, "v0": 3.599, "v1": -28.594, "v2": 41.301, "v3": -40.290, "v4": 23.209, "amplitude": 42.535, "phase_angle": 13.836, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.900, "filter_rmsd": 0.067, "frame": { "rmsd": 0.007, "origin": [ 5.325, -28.266, 72.820 ], "x_axis": [ -0.202, 0.287, -0.936 ], "y_axis": [ -0.484, 0.802, 0.350 ], "z_axis": [ 0.852, 0.524, -0.024 ], "quaternion": [ 0.628, -0.069, 0.712, 0.307 ] } }, { "index": 396, "index_chain": 75, "chain_name": "R", "nt_resnum": 75, "nt_name": "A", "nt_code": "A", "nt_id": "///R/75", "linked_nts": [ "///R/74", "///R/76" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -63.505, "beta": 171.089, "gamma": 46.380, "delta": 77.701, "epsilon": -150.721, "zeta": -71.097, "epsilon_zeta": -79.623, "bb_type": "BI", "chi": -158.772, "glyco_bond": "anti", "C5prime_xyz": [ -1.346, 8.712, 0.488 ], "P_xyz": [ 1.229, 9.109, 0.655 ], "form": "A", "ssZp": 4.463, "Dp": 4.736, "splay_angle": 21.985, "splay_distance": 3.599, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 164.004, "theta": -149.339, "eta_prime": 173.409, "theta_prime": -149.267, "eta_base": -151.163, "theta_base": -136.729, "v0": 8.577, "v1": -33.525, "v2": 44.144, "v3": -40.264, "v4": 20.232, "amplitude": 44.546, "phase_angle": 7.710, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.797, "filter_rmsd": 0.036, "frame": { "rmsd": 0.006, "origin": [ 8.502, -27.356, 71.611 ], "x_axis": [ -0.639, 0.524, -0.564 ], "y_axis": [ -0.206, 0.589, 0.781 ], "z_axis": [ 0.741, 0.615, -0.268 ], "quaternion": [ 0.413, 0.100, 0.790, 0.442 ] } }, { "index": 397, "index_chain": 76, "chain_name": "R", "nt_resnum": 76, "nt_name": "U", "nt_code": "U", "nt_id": "///R/76", "linked_nts": [ "///R/75", "///R/77" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -63.848, "beta": 173.816, "gamma": 49.991, "delta": 76.163, "epsilon": -175.597, "zeta": -76.060, "epsilon_zeta": -99.538, "bb_type": "BI", "chi": -156.616, "glyco_bond": "anti", "C5prime_xyz": [ -1.540, 8.835, 0.331 ], "P_xyz": [ 0.976, 9.554, 0.424 ], "form": "A", "ssZp": 4.336, "Dp": 4.486, "splay_angle": 22.899, "splay_distance": 3.701, "splay_ratio": 0.201, "d22": 4.014, "d64": 4.269, "eta": 167.623, "theta": -139.998, "eta_prime": 179.481, "theta_prime": -142.395, "eta_base": -154.298, "theta_base": -109.097, "v0": 0.871, "v1": -26.102, "v2": 39.736, "v3": -40.521, "v4": 25.168, "amplitude": 41.679, "phase_angle": 17.567, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.897, "filter_rmsd": 0.108, "frame": { "rmsd": 0.009, "origin": [ 11.003, -26.445, 69.189 ], "x_axis": [ -0.790, 0.597, -0.138 ], "y_axis": [ 0.151, 0.408, 0.900 ], "z_axis": [ 0.594, 0.691, -0.413 ], "quaternion": [ 0.227, 0.231, 0.808, 0.492 ] } }, { "index": 398, "index_chain": 77, "chain_name": "R", "nt_resnum": 77, "nt_name": "C", "nt_code": "C", "nt_id": "///R/77", "linked_nts": [ "///R/76", "///R/78" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": 177.734, "beta": -136.874, "gamma": 135.210, "delta": 72.748, "epsilon": -110.947, "zeta": -103.932, "epsilon_zeta": -7.015, "bb_type": "--", "chi": -172.217, "glyco_bond": "anti", "C5prime_xyz": [ -1.642, 8.733, 1.275 ], "P_xyz": [ 0.633, 9.484, 0.192 ], "form": "A", "ssZp": 4.652, "Dp": 4.863, "splay_angle": 23.741, "splay_distance": 3.791, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 163.916, "theta": -150.538, "eta_prime": 178.995, "theta_prime": -149.713, "eta_base": -132.420, "theta_base": -126.077, "v0": 3.101, "v1": -30.534, "v2": 44.777, "v3": -44.189, "v4": 25.964, "amplitude": 46.323, "phase_angle": 14.842, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.005, "origin": [ 11.256, -23.639, 66.788 ], "x_axis": [ -0.594, 0.688, 0.417 ], "y_axis": [ 0.634, 0.081, 0.769 ], "z_axis": [ 0.495, 0.721, -0.485 ], "quaternion": [ 0.026, 0.450, 0.735, 0.507 ] } }, { "index": 399, "index_chain": 78, "chain_name": "R", "nt_resnum": 78, "nt_name": "A", "nt_code": "A", "nt_id": "///R/78", "linked_nts": [ "///R/77", "///R/79" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -51.474, "beta": 133.482, "gamma": 60.549, "delta": 72.875, "epsilon": -155.142, "zeta": -61.427, "epsilon_zeta": -93.716, "bb_type": "BI", "chi": -176.628, "glyco_bond": "anti", "C5prime_xyz": [ -2.123, 8.650, 1.401 ], "P_xyz": [ 0.376, 9.303, 1.071 ], "form": ".", "ssZp": 4.584, "Dp": 4.562, "splay_angle": 26.573, "splay_distance": 4.103, "splay_ratio": 0.234, "d22": null, "d64": null, "eta": 160.950, "theta": -134.570, "eta_prime": 178.085, "theta_prime": -137.581, "eta_base": -140.171, "theta_base": -89.279, "v0": -6.978, "v1": -21.242, "v2": 40.035, "v3": -45.100, "v4": 32.610, "amplitude": 45.031, "phase_angle": 27.245, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.503, "filter_rmsd": 0.032, "frame": { "rmsd": 0.010, "origin": [ 11.302, -20.388, 64.840 ], "x_axis": [ -0.335, 0.421, 0.843 ], "y_axis": [ 0.862, -0.224, 0.455 ], "z_axis": [ 0.381, 0.879, -0.288 ], "quaternion": [ -0.195, 0.543, 0.591, 0.564 ] } }, { "index": 400, "index_chain": 79, "chain_name": "R", "nt_resnum": 79, "nt_name": "C", "nt_code": "C", "nt_id": "///R/79", "linked_nts": [ "///R/78", "///R/80" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -97.868, "beta": -162.309, "gamma": 65.161, "delta": 78.564, "epsilon": -153.797, "zeta": -81.989, "epsilon_zeta": -71.808, "bb_type": "BI", "chi": -156.589, "glyco_bond": "anti", "C5prime_xyz": [ -1.265, 8.788, 0.321 ], "P_xyz": [ 1.371, 9.054, 0.373 ], "form": "A", "ssZp": 4.390, "Dp": 4.686, "splay_angle": 21.221, "splay_distance": 3.294, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 159.778, "theta": -156.012, "eta_prime": 175.305, "theta_prime": -154.191, "eta_base": -115.172, "theta_base": -139.043, "v0": 8.753, "v1": -33.737, "v2": 44.412, "v3": -40.330, "v4": 20.124, "amplitude": 44.794, "phase_angle": 7.487, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.164, "filter_rmsd": 0.071, "frame": { "rmsd": 0.010, "origin": [ 11.172, -16.574, 66.350 ], "x_axis": [ 0.486, 0.036, 0.873 ], "y_axis": [ 0.830, -0.331, -0.448 ], "z_axis": [ 0.273, 0.943, -0.191 ], "quaternion": [ -0.491, 0.708, 0.306, 0.405 ] } }, { "index": 401, "index_chain": 80, "chain_name": "R", "nt_resnum": 80, "nt_name": "A", "nt_code": "A", "nt_id": "///R/80", "linked_nts": [ "///R/79", "///R/81" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -48.108, "beta": 168.686, "gamma": 44.555, "delta": 78.977, "epsilon": -158.370, "zeta": -64.715, "epsilon_zeta": -93.655, "bb_type": "BI", "chi": -153.529, "glyco_bond": "anti", "C5prime_xyz": [ -1.237, 8.715, 0.263 ], "P_xyz": [ 1.360, 8.963, 0.437 ], "form": "A", "ssZp": 4.240, "Dp": 4.594, "splay_angle": 21.160, "splay_distance": 3.297, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 174.623, "theta": -147.354, "eta_prime": -176.604, "theta_prime": -148.021, "eta_base": -151.898, "theta_base": -123.052, "v0": 8.942, "v1": -31.798, "v2": 41.520, "v3": -37.227, "v4": 18.029, "amplitude": 41.787, "phase_angle": 6.480, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.647, "filter_rmsd": 0.037, "frame": { "rmsd": 0.007, "origin": [ 10.845, -13.305, 66.584 ], "x_axis": [ 0.742, -0.258, 0.619 ], "y_axis": [ 0.591, -0.185, -0.785 ], "z_axis": [ 0.317, 0.948, 0.015 ], "quaternion": [ 0.627, -0.691, -0.121, -0.338 ] } }, { "index": 402, "index_chain": 81, "chain_name": "R", "nt_resnum": 81, "nt_name": "A", "nt_code": "A", "nt_id": "///R/81", "linked_nts": [ "///R/80", "///R/82" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,ribose-zipper", "alpha": -91.681, "beta": 174.248, "gamma": 71.996, "delta": 80.406, "epsilon": -150.588, "zeta": -63.177, "epsilon_zeta": -87.412, "bb_type": "BI", "chi": -162.927, "glyco_bond": "anti", "C5prime_xyz": [ -1.140, 8.559, 0.722 ], "P_xyz": [ 1.399, 8.890, 0.182 ], "form": "A", "ssZp": 4.579, "Dp": 4.746, "splay_angle": 25.435, "splay_distance": 4.006, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 160.844, "theta": -138.440, "eta_prime": 174.096, "theta_prime": -137.397, "eta_base": -144.132, "theta_base": -108.952, "v0": 10.153, "v1": -33.618, "v2": 42.462, "v3": -37.742, "v4": 17.735, "amplitude": 42.632, "phase_angle": 5.118, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.241, "filter_rmsd": 0.039, "frame": { "rmsd": 0.012, "origin": [ 11.838, -10.382, 67.742 ], "x_axis": [ 0.907, -0.401, 0.132 ], "y_axis": [ 0.180, 0.084, -0.980 ], "z_axis": [ 0.382, 0.912, 0.149 ], "quaternion": [ 0.731, -0.647, 0.085, -0.199 ] } }, { "index": 403, "index_chain": 82, "chain_name": "R", "nt_resnum": 82, "nt_name": "C", "nt_code": "C", "nt_id": "///R/82", "linked_nts": [ "///R/81", "///R/83" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper", "alpha": -73.108, "beta": 172.288, "gamma": 71.269, "delta": 77.127, "epsilon": -158.029, "zeta": -70.625, "epsilon_zeta": -87.404, "bb_type": "BI", "chi": -166.063, "glyco_bond": "anti", "C5prime_xyz": [ -1.616, 8.774, 0.857 ], "P_xyz": [ 0.917, 9.260, 0.618 ], "form": "A", "ssZp": 4.517, "Dp": 4.612, "splay_angle": 23.544, "splay_distance": 3.751, "splay_ratio": 0.206, "d22": 4.466, "d64": 4.478, "eta": 174.687, "theta": -150.048, "eta_prime": -164.709, "theta_prime": -149.583, "eta_base": -115.682, "theta_base": -126.853, "v0": -0.173, "v1": -27.366, "v2": 42.905, "v3": -43.777, "v4": 28.158, "amplitude": 45.301, "phase_angle": 18.718, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.470, "filter_rmsd": 0.067, "frame": { "rmsd": 0.009, "origin": [ 14.862, -8.614, 69.686 ], "x_axis": [ 0.847, -0.280, -0.452 ], "y_axis": [ -0.332, 0.386, -0.861 ], "z_axis": [ 0.416, 0.879, 0.234 ], "quaternion": [ 0.785, -0.554, 0.276, 0.017 ] } }, { "index": 404, "index_chain": 83, "chain_name": "R", "nt_resnum": 83, "nt_name": "C", "nt_code": "C", "nt_id": "///R/83", "linked_nts": [ "///R/82", "///R/84" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor,ribose-zipper", "alpha": -64.832, "beta": 179.834, "gamma": 52.587, "delta": 79.103, "epsilon": -157.755, "zeta": -67.986, "epsilon_zeta": -89.769, "bb_type": "BI", "chi": -153.364, "glyco_bond": "anti", "C5prime_xyz": [ -1.463, 8.878, 0.159 ], "P_xyz": [ 1.062, 9.296, 0.607 ], "form": "A", "ssZp": 4.025, "Dp": 4.431, "splay_angle": 22.459, "splay_distance": 3.623, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 176.335, "theta": -153.965, "eta_prime": -172.801, "theta_prime": -144.723, "eta_base": -139.431, "theta_base": -134.126, "v0": 6.928, "v1": -32.129, "v2": 44.297, "v3": -41.012, "v4": 21.546, "amplitude": 44.950, "phase_angle": 9.781, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.892, "filter_rmsd": 0.075, "frame": { "rmsd": 0.019, "origin": [ 17.439, -6.522, 71.432 ], "x_axis": [ 0.467, -0.172, -0.867 ], "y_axis": [ -0.687, 0.547, -0.478 ], "z_axis": [ 0.557, 0.819, 0.137 ], "quaternion": [ 0.733, -0.442, 0.486, 0.176 ] } }, { "index": 405, "index_chain": 84, "chain_name": "R", "nt_resnum": 84, "nt_name": "G", "nt_code": "G", "nt_id": "///R/84", "linked_nts": [ "///R/83", "///R/85" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -71.532, "beta": -178.912, "gamma": 74.899, "delta": 145.537, "epsilon": -88.513, "zeta": 67.102, "epsilon_zeta": 204.385, "bb_type": "--", "chi": -123.747, "glyco_bond": "anti", "C5prime_xyz": [ -2.133, 8.539, -0.853 ], "P_xyz": [ 0.245, 9.277, -0.240 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -147.339, "theta": 106.013, "eta_prime": -127.256, "theta_prime": 103.102, "eta_base": -122.125, "theta_base": null, "v0": -14.148, "v1": 30.135, "v2": -33.815, "v3": 26.728, "v4": -8.119, "amplitude": 33.953, "phase_angle": 174.820, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.477, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 19.939, -4.192, 72.635 ], "x_axis": [ 0.011, -0.218, -0.976 ], "y_axis": [ -0.747, 0.647, -0.153 ], "z_axis": [ 0.664, 0.731, -0.156 ], "quaternion": [ 0.613, -0.361, 0.669, 0.216 ] } }, { "index": 406, "index_chain": 85, "chain_name": "R", "nt_resnum": 85, "nt_name": "C", "nt_code": "C", "nt_id": "///R/85", "linked_nts": [ "///R/84", "///R/86" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-stack,ss-non-loop", "alpha": 159.739, "beta": -137.815, "gamma": -175.636, "delta": 125.431, "epsilon": -109.887, "zeta": 119.382, "epsilon_zeta": 130.730, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -97.475, "theta": 93.462, "eta_prime": -113.077, "theta_prime": 69.872, "eta_base": null, "theta_base": null, "v0": -27.014, "v1": 31.644, "v2": -25.241, "v3": 10.020, "v4": 10.732, "amplitude": 31.768, "phase_angle": 142.611, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null }, { "index": 407, "index_chain": 86, "chain_name": "R", "nt_resnum": 86, "nt_name": "A", "nt_code": "A", "nt_id": "///R/86", "linked_nts": [ "///R/85", "///R/87" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,ss-non-loop,A-minor,ribose-zipper", "alpha": 63.171, "beta": -144.436, "gamma": 166.012, "delta": 74.198, "epsilon": 77.914, "zeta": 77.485, "epsilon_zeta": 0.428, "bb_type": "--", "chi": -133.810, "glyco_bond": "anti", "C5prime_xyz": [ -0.984, 8.337, -1.065 ], "P_xyz": [ -0.154, 8.225, -3.564 ], "form": ".", "ssZp": 2.787, "Dp": 3.916, "splay_angle": 19.492, "splay_distance": 3.414, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 165.849, "theta": -179.335, "eta_prime": 147.358, "theta_prime": -166.827, "eta_base": null, "theta_base": -130.869, "v0": 20.271, "v1": -44.474, "v2": 50.779, "v3": -39.911, "v4": 12.813, "amplitude": 50.929, "phase_angle": 355.602, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "0i", "suiteness": 0.010, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 13.669, -4.300, 77.469 ], "x_axis": [ -0.258, -0.446, 0.857 ], "y_axis": [ -0.913, 0.404, -0.064 ], "z_axis": [ -0.317, -0.799, -0.511 ], "quaternion": [ -0.398, -0.461, 0.737, -0.293 ] } }, { "index": 408, "index_chain": 87, "chain_name": "R", "nt_resnum": 87, "nt_name": "A", "nt_code": "A", "nt_id": "///R/87", "linked_nts": [ "///R/86", "///R/88" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,ribose-zipper,cap-acceptor,phosphate,splayed-apart", "alpha": -143.715, "beta": 162.139, "gamma": 66.245, "delta": 91.390, "epsilon": -151.330, "zeta": -152.917, "epsilon_zeta": 1.587, "bb_type": "--", "chi": -119.087, "glyco_bond": "anti", "C5prime_xyz": [ -1.550, 8.244, -1.730 ], "P_xyz": [ 0.838, 7.917, -2.721 ], "form": ".", "ssZp": 2.395, "Dp": 4.284, "splay_angle": 149.794, "splay_distance": 18.102, "splay_ratio": 0.966, "d22": null, "d64": null, "eta": 161.860, "theta": 169.718, "eta_prime": -173.701, "theta_prime": 171.786, "eta_base": -131.016, "theta_base": -132.602, "v0": 1.962, "v1": -19.356, "v2": 28.359, "v3": -27.841, "v4": 16.580, "amplitude": 29.336, "phase_angle": 14.826, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ 11.183, -6.431, 76.502 ], "x_axis": [ -0.672, -0.077, 0.736 ], "y_axis": [ -0.720, 0.298, -0.626 ], "z_axis": [ -0.172, -0.951, -0.256 ], "quaternion": [ -0.304, -0.267, 0.746, -0.529 ] } }, { "index": 409, "index_chain": 88, "chain_name": "R", "nt_resnum": 88, "nt_name": "G", "nt_code": "G", "nt_id": "///R/88", "linked_nts": [ "///R/87", "///R/89" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,ribose-zipper,splayed-apart", "alpha": 41.540, "beta": 159.941, "gamma": 56.275, "delta": 81.178, "epsilon": -138.981, "zeta": -71.409, "epsilon_zeta": -67.572, "bb_type": "BI", "chi": 179.524, "glyco_bond": "anti", "C5prime_xyz": [ -1.266, 8.287, 1.769 ], "P_xyz": [ 1.320, 8.343, 2.005 ], "form": "A", "ssZp": 4.751, "Dp": 4.748, "splay_angle": 24.897, "splay_distance": 3.841, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": -77.207, "theta": -135.552, "eta_prime": -92.938, "theta_prime": -133.918, "eta_base": -138.768, "theta_base": -102.789, "v0": 11.380, "v1": -33.823, "v2": 42.276, "v3": -36.624, "v4": 16.085, "amplitude": 42.346, "phase_angle": 3.302, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3d", "suiteness": 0.188, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 0.166, -9.344, 62.437 ], "x_axis": [ -0.653, 0.146, 0.743 ], "y_axis": [ 0.756, 0.180, 0.629 ], "z_axis": [ -0.043, 0.973, -0.228 ], "quaternion": [ -0.274, 0.314, 0.718, 0.558 ] } }, { "index": 410, "index_chain": 89, "chain_name": "R", "nt_resnum": 89, "nt_name": "C", "nt_code": "C", "nt_id": "///R/89", "linked_nts": [ "///R/88", "///R/90" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -67.201, "beta": 174.733, "gamma": 54.906, "delta": 76.114, "epsilon": -138.045, "zeta": -83.242, "epsilon_zeta": -54.802, "bb_type": "BI", "chi": -166.142, "glyco_bond": "anti", "C5prime_xyz": [ -1.225, 8.731, 0.917 ], "P_xyz": [ 1.390, 8.946, 1.100 ], "form": "A", "ssZp": 4.626, "Dp": 4.818, "splay_angle": 20.898, "splay_distance": 3.388, "splay_ratio": 0.185, "d22": 4.350, "d64": 4.574, "eta": 169.580, "theta": -149.064, "eta_prime": -175.413, "theta_prime": -146.669, "eta_base": -126.077, "theta_base": -136.275, "v0": 6.863, "v1": -31.665, "v2": 43.186, "v3": -40.086, "v4": 21.181, "amplitude": 43.813, "phase_angle": 9.708, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.899, "filter_rmsd": 0.069, "frame": { "rmsd": 0.010, "origin": [ -2.109, -6.288, 61.948 ], "x_axis": [ -0.007, 0.291, 0.957 ], "y_axis": [ 0.996, 0.083, -0.018 ], "z_axis": [ -0.085, 0.953, -0.290 ], "quaternion": [ -0.443, 0.548, 0.588, 0.398 ] } }, { "index": 411, "index_chain": 90, "chain_name": "R", "nt_resnum": 90, "nt_name": "U", "nt_code": "U", "nt_id": "///R/90", "linked_nts": [ "///R/89", "///R/91" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.796, "beta": 162.872, "gamma": 57.800, "delta": 74.532, "epsilon": -147.653, "zeta": -80.707, "epsilon_zeta": -66.946, "bb_type": "BI", "chi": -160.441, "glyco_bond": "anti", "C5prime_xyz": [ -1.823, 8.841, 0.482 ], "P_xyz": [ 0.705, 9.467, 0.213 ], "form": "A", "ssZp": 4.396, "Dp": 4.648, "splay_angle": 24.204, "splay_distance": 3.811, "splay_ratio": 0.211, "d22": 4.066, "d64": 4.223, "eta": 165.407, "theta": -152.095, "eta_prime": 177.441, "theta_prime": -151.371, "eta_base": -158.754, "theta_base": -123.950, "v0": 1.033, "v1": -29.978, "v2": 45.906, "v3": -46.597, "v4": 28.447, "amplitude": 48.083, "phase_angle": 17.310, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.737, "filter_rmsd": 0.109, "frame": { "rmsd": 0.011, "origin": [ -4.209, -3.708, 61.305 ], "x_axis": [ 0.365, 0.163, 0.917 ], "y_axis": [ 0.909, 0.150, -0.388 ], "z_axis": [ -0.201, 0.975, -0.093 ], "quaternion": [ 0.596, -0.572, -0.469, -0.313 ] } }, { "index": 412, "index_chain": 91, "chain_name": "R", "nt_resnum": 91, "nt_name": "U", "nt_code": "U", "nt_id": "///R/91", "linked_nts": [ "///R/90", "///R/92" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.214, "beta": 166.610, "gamma": 52.879, "delta": 79.510, "epsilon": -154.738, "zeta": -65.467, "epsilon_zeta": -89.271, "bb_type": "BI", "chi": -163.289, "glyco_bond": "anti", "C5prime_xyz": [ -1.628, 8.743, 0.662 ], "P_xyz": [ 0.955, 9.183, 0.774 ], "form": "A", "ssZp": 4.448, "Dp": 4.592, "splay_angle": 23.195, "splay_distance": 3.722, "splay_ratio": 0.204, "d22": 4.139, "d64": 4.340, "eta": 172.229, "theta": -142.665, "eta_prime": -175.587, "theta_prime": -143.188, "eta_base": -134.777, "theta_base": -116.536, "v0": 2.742, "v1": -28.485, "v2": 41.655, "v3": -41.266, "v4": 24.438, "amplitude": 43.135, "phase_angle": 15.053, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.782, "filter_rmsd": 0.110, "frame": { "rmsd": 0.009, "origin": [ -5.509, -0.397, 62.673 ], "x_axis": [ 0.819, 0.055, 0.571 ], "y_axis": [ 0.566, 0.086, -0.820 ], "z_axis": [ -0.095, 0.995, 0.039 ], "quaternion": [ 0.697, -0.651, -0.239, -0.183 ] } }, { "index": 413, "index_chain": 92, "chain_name": "R", "nt_resnum": 92, "nt_name": "U", "nt_code": "U", "nt_id": "///R/92", "linked_nts": [ "///R/91", "///R/93" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.694, "beta": 172.401, "gamma": 63.840, "delta": 77.089, "epsilon": -161.656, "zeta": -47.893, "epsilon_zeta": -113.763, "bb_type": "BI", "chi": -163.231, "glyco_bond": "anti", "C5prime_xyz": [ -1.776, 8.755, 0.665 ], "P_xyz": [ 0.743, 9.392, 0.686 ], "form": "A", "ssZp": 4.322, "Dp": 4.484, "splay_angle": 24.625, "splay_distance": 3.918, "splay_ratio": 0.215, "d22": 3.805, "d64": 3.741, "eta": 169.600, "theta": -136.593, "eta_prime": -174.655, "theta_prime": -136.967, "eta_base": -131.388, "theta_base": -93.044, "v0": 1.631, "v1": -28.091, "v2": 42.604, "v3": -43.018, "v4": 26.058, "amplitude": 44.482, "phase_angle": 16.706, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.734, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ -5.520, 2.758, 64.648 ], "x_axis": [ 1.000, 0.004, 0.027 ], "y_axis": [ 0.026, 0.108, -0.994 ], "z_axis": [ -0.007, 0.994, 0.107 ], "quaternion": [ 0.744, -0.668, -0.012, -0.007 ] } }, { "index": 414, "index_chain": 93, "chain_name": "R", "nt_resnum": 93, "nt_name": "U", "nt_code": "U", "nt_id": "///R/93", "linked_nts": [ "///R/92", "///R/94" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -88.948, "beta": 179.840, "gamma": 65.829, "delta": 84.461, "epsilon": -163.539, "zeta": -73.917, "epsilon_zeta": -89.622, "bb_type": "BI", "chi": -158.310, "glyco_bond": "anti", "C5prime_xyz": [ -1.541, 8.739, 0.450 ], "P_xyz": [ 0.979, 9.299, 0.489 ], "form": "A", "ssZp": 4.248, "Dp": 4.444, "splay_angle": 21.025, "splay_distance": 3.298, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 165.569, "theta": -158.297, "eta_prime": -173.116, "theta_prime": -160.357, "eta_base": -109.659, "theta_base": -147.569, "v0": 8.035, "v1": -31.458, "v2": 41.019, "v3": -37.552, "v4": 18.902, "amplitude": 41.388, "phase_angle": 7.652, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.305, "filter_rmsd": 0.107, "frame": { "rmsd": 0.007, "origin": [ -3.109, 5.776, 65.302 ], "x_axis": [ 0.720, 0.007, -0.694 ], "y_axis": [ -0.686, 0.164, -0.709 ], "z_axis": [ 0.109, 0.986, 0.123 ], "quaternion": [ 0.708, -0.599, 0.284, 0.244 ] } }, { "index": 415, "index_chain": 94, "chain_name": "R", "nt_resnum": 94, "nt_name": "A", "nt_code": "A", "nt_id": "///R/94", "linked_nts": [ "///R/93", "///R/95" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -73.489, "beta": -179.531, "gamma": 49.000, "delta": 83.312, "epsilon": -161.073, "zeta": -50.072, "epsilon_zeta": -111.001, "bb_type": "BI", "chi": -149.396, "glyco_bond": "anti", "C5prime_xyz": [ -1.136, 8.626, 0.027 ], "P_xyz": [ 1.470, 8.953, 0.123 ], "form": "A", "ssZp": 4.130, "Dp": 4.568, "splay_angle": 21.179, "splay_distance": 3.609, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 166.969, "theta": -133.552, "eta_prime": 174.604, "theta_prime": -136.344, "eta_base": -161.064, "theta_base": -116.334, "v0": 11.672, "v1": -33.297, "v2": 41.193, "v3": -35.873, "v4": 15.202, "amplitude": 41.241, "phase_angle": 2.757, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.790, "filter_rmsd": 0.032, "frame": { "rmsd": 0.020, "origin": [ -2.371, 8.380, 67.187 ], "x_axis": [ 0.332, 0.076, -0.940 ], "y_axis": [ -0.912, 0.280, -0.299 ], "z_axis": [ 0.241, 0.957, 0.162 ], "quaternion": [ 0.666, -0.472, 0.443, 0.371 ] } }, { "index": 416, "index_chain": 95, "chain_name": "R", "nt_resnum": 95, "nt_name": "C", "nt_code": "C", "nt_id": "///R/95", "linked_nts": [ "///R/94", "///R/96" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -113.079, "beta": 161.617, "gamma": 103.976, "delta": 77.679, "epsilon": -141.597, "zeta": -71.942, "epsilon_zeta": -69.655, "bb_type": "BI", "chi": -166.114, "glyco_bond": "anti", "C5prime_xyz": [ -1.627, 8.817, 0.937 ], "P_xyz": [ 0.485, 9.929, -0.178 ], "form": "A", "ssZp": 4.519, "Dp": 4.646, "splay_angle": 22.632, "splay_distance": 3.572, "splay_ratio": 0.197, "d22": 4.046, "d64": 3.690, "eta": 166.594, "theta": -151.827, "eta_prime": -174.829, "theta_prime": -151.445, "eta_base": -135.999, "theta_base": -109.086, "v0": 1.572, "v1": -26.644, "v2": 39.875, "v3": -40.021, "v4": 24.354, "amplitude": 41.570, "phase_angle": 16.417, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.009, "origin": [ 0.223, 10.845, 66.721 ], "x_axis": [ -0.123, 0.123, -0.985 ], "y_axis": [ -0.921, 0.355, 0.159 ], "z_axis": [ 0.370, 0.927, 0.070 ], "quaternion": [ 0.570, -0.336, 0.593, 0.457 ] } }, { "index": 417, "index_chain": 96, "chain_name": "R", "nt_resnum": 96, "nt_name": "U", "nt_code": "U", "nt_id": "///R/96", "linked_nts": [ "///R/95", "///R/97" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop,splayed-apart", "alpha": -60.603, "beta": 171.897, "gamma": 48.178, "delta": 79.784, "epsilon": -160.425, "zeta": 127.474, "epsilon_zeta": 72.102, "bb_type": "--", "chi": -153.944, "glyco_bond": "anti", "C5prime_xyz": [ -1.062, 8.733, 0.205 ], "P_xyz": [ 1.524, 9.104, 0.273 ], "form": ".", "ssZp": 4.164, "Dp": 4.488, "splay_angle": 176.406, "splay_distance": 18.710, "splay_ratio": 1.000, "d22": 10.690, "d64": 14.003, "eta": 164.200, "theta": 28.103, "eta_prime": -178.869, "theta_prime": 23.584, "eta_base": -120.035, "theta_base": -121.489, "v0": 6.814, "v1": -30.683, "v2": 42.318, "v3": -39.217, "v4": 20.318, "amplitude": 42.920, "phase_angle": 9.604, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.904, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 1.485, 13.563, 64.776 ], "x_axis": [ -0.766, 0.230, -0.600 ], "y_axis": [ -0.517, 0.334, 0.788 ], "z_axis": [ 0.381, 0.914, -0.137 ], "quaternion": [ 0.328, -0.096, 0.748, 0.569 ] } }, { "index": 418, "index_chain": 97, "chain_name": "R", "nt_resnum": 97, "nt_name": "U", "nt_code": "U", "nt_id": "///R/97", "linked_nts": [ "///R/96", "///R/98" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,internal-loop,splayed-apart", "alpha": -74.711, "beta": -145.119, "gamma": 50.325, "delta": 144.432, "epsilon": -95.179, "zeta": -71.606, "epsilon_zeta": -23.574, "bb_type": "--", "chi": -125.608, "glyco_bond": "anti", "C5prime_xyz": [ -1.883, 8.681, -0.916 ], "P_xyz": [ -0.104, 9.843, 0.678 ], "form": ".", "ssZp": 0.877, "Dp": 0.912, "splay_angle": 113.560, "splay_distance": 17.717, "splay_ratio": 0.837, "d22": null, "d64": null, "eta": -121.583, "theta": -54.947, "eta_prime": -92.737, "theta_prime": -71.524, "eta_base": 48.385, "theta_base": -80.687, "v0": -25.269, "v1": 39.922, "v2": -38.425, "v3": 25.332, "v4": -0.250, "amplitude": 40.523, "phase_angle": 161.482, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.040, "filter_rmsd": 0.106, "frame": { "rmsd": 0.014, "origin": [ 0.868, 26.103, 78.648 ], "x_axis": [ 0.541, -0.591, 0.598 ], "y_axis": [ -0.029, -0.723, -0.690 ], "z_axis": [ 0.840, 0.356, -0.409 ], "quaternion": [ -0.320, 0.818, -0.190, 0.440 ] } }, { "index": 419, "index_chain": 98, "chain_name": "R", "nt_resnum": 98, "nt_name": "A", "nt_code": "A", "nt_id": "///R/98", "linked_nts": [ "///R/97", "///R/99" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper,splayed-apart", "alpha": -67.722, "beta": 141.935, "gamma": 176.249, "delta": 82.538, "epsilon": -125.585, "zeta": -90.753, "epsilon_zeta": -34.832, "bb_type": "--", "chi": -156.850, "glyco_bond": "anti", "C5prime_xyz": [ -1.590, 8.791, 0.296 ], "P_xyz": [ -1.295, 10.925, -1.204 ], "form": "B", "ssZp": 3.914, "Dp": 4.482, "splay_angle": 18.880, "splay_distance": 3.089, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": -98.187, "theta": 169.484, "eta_prime": -66.390, "theta_prime": -177.468, "eta_base": -37.650, "theta_base": -131.592, "v0": -1.947, "v1": -21.827, "v2": 36.119, "v3": -37.740, "v4": 25.214, "amplitude": 38.735, "phase_angle": 21.181, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "2h", "suiteness": 0.481, "filter_rmsd": 0.041, "frame": { "rmsd": 0.013, "origin": [ 6.420, 25.252, 61.845 ], "x_axis": [ -0.577, 0.202, -0.791 ], "y_axis": [ -0.806, 0.013, 0.592 ], "z_axis": [ 0.130, 0.979, 0.155 ], "quaternion": [ 0.384, -0.252, 0.599, 0.656 ] } }, { "index": 420, "index_chain": 99, "chain_name": "R", "nt_resnum": 99, "nt_name": "A", "nt_code": "A", "nt_id": "///R/99", "linked_nts": [ "///R/98", "///R/100" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,A-minor,ribose-zipper", "alpha": -65.952, "beta": 144.203, "gamma": 58.704, "delta": 80.742, "epsilon": -148.033, "zeta": -75.733, "epsilon_zeta": -72.300, "bb_type": "BI", "chi": -150.134, "glyco_bond": "anti", "C5prime_xyz": [ -1.529, 8.681, -0.086 ], "P_xyz": [ 0.930, 8.719, -1.054 ], "form": "A", "ssZp": 4.026, "Dp": 4.615, "splay_angle": 19.891, "splay_distance": 3.219, "splay_ratio": 0.175, "d22": null, "d64": null, "eta": 151.708, "theta": -139.920, "eta_prime": 170.594, "theta_prime": -147.477, "eta_base": -136.100, "theta_base": -131.851, "v0": 2.759, "v1": -28.889, "v2": 43.162, "v3": -42.351, "v4": 24.816, "amplitude": 44.678, "phase_angle": 14.970, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.406, "filter_rmsd": 0.039, "frame": { "rmsd": 0.024, "origin": [ 5.917, 28.297, 61.715 ], "x_axis": [ -0.943, 0.064, -0.325 ], "y_axis": [ -0.314, 0.143, 0.939 ], "z_axis": [ 0.107, 0.988, -0.114 ], "quaternion": [ 0.146, -0.084, 0.742, 0.649 ] } }, { "index": 421, "index_chain": 100, "chain_name": "R", "nt_resnum": 100, "nt_name": "A", "nt_code": "A", "nt_id": "///R/100", "linked_nts": [ "///R/99", "///R/101" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -85.436, "beta": 156.311, "gamma": 82.755, "delta": 78.354, "epsilon": -149.410, "zeta": -55.843, "epsilon_zeta": -93.567, "bb_type": "BI", "chi": -162.885, "glyco_bond": "anti", "C5prime_xyz": [ -1.709, 8.805, 0.581 ], "P_xyz": [ 0.536, 9.420, -0.709 ], "form": ".", "ssZp": 4.515, "Dp": 4.681, "splay_angle": 33.797, "splay_distance": 5.371, "splay_ratio": 0.295, "d22": null, "d64": null, "eta": 160.186, "theta": -130.573, "eta_prime": 177.348, "theta_prime": -134.270, "eta_base": -145.610, "theta_base": -101.117, "v0": 0.875, "v1": -28.003, "v2": 42.595, "v3": -42.423, "v4": 26.607, "amplitude": 44.548, "phase_angle": 17.029, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.039, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ 5.581, 30.988, 59.979 ], "x_axis": [ -0.995, 0.019, 0.101 ], "y_axis": [ 0.102, 0.308, 0.946 ], "z_axis": [ -0.013, 0.951, -0.308 ], "quaternion": [ -0.035, 0.037, 0.808, 0.587 ] } }, { "index": 422, "index_chain": 101, "chain_name": "R", "nt_resnum": 101, "nt_name": "U", "nt_code": "U", "nt_id": "///R/101", "linked_nts": [ "///R/100", "///R/102" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -71.183, "beta": 174.219, "gamma": 62.870, "delta": 78.902, "epsilon": -125.652, "zeta": -62.463, "epsilon_zeta": -63.190, "bb_type": "--", "chi": -171.898, "glyco_bond": "anti", "C5prime_xyz": [ -1.742, 8.676, 1.199 ], "P_xyz": [ 0.754, 9.453, 1.292 ], "form": ".", "ssZp": 4.716, "Dp": 4.821, "splay_angle": 48.359, "splay_distance": 7.142, "splay_ratio": 0.410, "d22": 3.358, "d64": 3.850, "eta": 174.038, "theta": -114.174, "eta_prime": -166.366, "theta_prime": -106.379, "eta_base": -110.068, "theta_base": -50.461, "v0": 0.982, "v1": -26.869, "v2": 40.972, "v3": -41.117, "v4": 25.587, "amplitude": 42.873, "phase_angle": 17.125, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.722, "filter_rmsd": 0.101, "frame": { "rmsd": 0.007, "origin": [ 1.608, 34.506, 59.152 ], "x_axis": [ -0.596, 0.126, 0.793 ], "y_axis": [ 0.801, 0.161, 0.576 ], "z_axis": [ -0.055, 0.979, -0.197 ], "quaternion": [ -0.303, 0.332, 0.699, 0.556 ] } }, { "index": 423, "index_chain": 102, "chain_name": "R", "nt_resnum": 102, "nt_name": "C", "nt_code": "C", "nt_id": "///R/102", "linked_nts": [ "///R/101", "///R/103" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -60.083, "beta": 173.407, "gamma": 47.393, "delta": 79.294, "epsilon": -139.509, "zeta": -56.764, "epsilon_zeta": -82.745, "bb_type": "BI", "chi": -159.943, "glyco_bond": "anti", "C5prime_xyz": [ -0.937, 8.657, 0.590 ], "P_xyz": [ 1.657, 8.480, 0.972 ], "form": "A", "ssZp": 4.364, "Dp": 4.742, "splay_angle": 24.762, "splay_distance": 3.982, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 163.660, "theta": -127.291, "eta_prime": -168.300, "theta_prime": -126.255, "eta_base": -92.083, "theta_base": -98.972, "v0": 8.748, "v1": -30.005, "v2": 39.424, "v3": -34.874, "v4": 16.831, "amplitude": 39.648, "phase_angle": 6.093, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.663, "filter_rmsd": 0.071, "frame": { "rmsd": 0.011, "origin": [ 1.585, 38.308, 65.199 ], "x_axis": [ 0.750, -0.076, 0.657 ], "y_axis": [ 0.661, 0.088, -0.745 ], "z_axis": [ -0.001, 0.993, 0.116 ], "quaternion": [ 0.699, -0.622, -0.235, -0.264 ] } }, { "index": 424, "index_chain": 103, "chain_name": "R", "nt_resnum": 103, "nt_name": "A", "nt_code": "A", "nt_id": "///R/103", "linked_nts": [ "///R/102", "///R/104" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.630, "beta": -177.791, "gamma": 47.967, "delta": 78.336, "epsilon": -148.873, "zeta": -60.947, "epsilon_zeta": -87.926, "bb_type": "BI", "chi": -163.122, "glyco_bond": "anti", "C5prime_xyz": [ -1.438, 8.606, 0.690 ], "P_xyz": [ 0.993, 9.331, 0.961 ], "form": "A", "ssZp": 4.657, "Dp": 4.828, "splay_angle": 23.023, "splay_distance": 3.663, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 161.060, "theta": -142.156, "eta_prime": 177.559, "theta_prime": -138.425, "eta_base": -136.038, "theta_base": -99.227, "v0": 10.413, "v1": -35.582, "v2": 44.698, "v3": -40.016, "v4": 19.104, "amplitude": 44.901, "phase_angle": 5.450, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.785, "filter_rmsd": 0.037, "frame": { "rmsd": 0.014, "origin": [ 2.659, 41.392, 67.477 ], "x_axis": [ 0.943, -0.329, 0.056 ], "y_axis": [ 0.115, 0.163, -0.980 ], "z_axis": [ 0.313, 0.930, 0.192 ], "quaternion": [ 0.758, -0.630, 0.085, -0.147 ] } }, { "index": 425, "index_chain": 104, "chain_name": "R", "nt_resnum": 104, "nt_name": "U", "nt_code": "U", "nt_id": "///R/104", "linked_nts": [ "///R/103", "///R/105" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -88.254, "beta": 167.960, "gamma": 75.580, "delta": 79.223, "epsilon": -151.799, "zeta": -86.423, "epsilon_zeta": -65.376, "bb_type": "BI", "chi": -164.379, "glyco_bond": "anti", "C5prime_xyz": [ -1.683, 8.765, 0.746 ], "P_xyz": [ 0.781, 9.331, 0.010 ], "form": ".", "ssZp": 4.614, "Dp": 4.725, "splay_angle": 29.438, "splay_distance": 4.664, "splay_ratio": 0.258, "d22": 4.915, "d64": 5.410, "eta": 160.835, "theta": -160.967, "eta_prime": -176.991, "theta_prime": -163.225, "eta_base": -118.308, "theta_base": -158.317, "v0": 5.149, "v1": -31.741, "v2": 44.579, "v3": -42.133, "v4": 23.632, "amplitude": 45.555, "phase_angle": 11.885, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.193, "filter_rmsd": 0.103, "frame": { "rmsd": 0.009, "origin": [ 5.646, 42.946, 68.918 ], "x_axis": [ 0.819, -0.157, -0.551 ], "y_axis": [ -0.406, 0.520, -0.752 ], "z_axis": [ 0.405, 0.839, 0.363 ], "quaternion": [ 0.822, -0.484, 0.291, 0.076 ] } }, { "index": 426, "index_chain": 105, "chain_name": "R", "nt_resnum": 105, "nt_name": "U", "nt_code": "U", "nt_id": "///R/105", "linked_nts": [ "///R/104", "///R/106" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -69.664, "beta": 176.198, "gamma": 57.955, "delta": 77.582, "epsilon": -150.071, "zeta": -80.227, "epsilon_zeta": -69.844, "bb_type": "BI", "chi": -167.824, "glyco_bond": "anti", "C5prime_xyz": [ -1.862, 8.731, 0.965 ], "P_xyz": [ 0.605, 9.350, 1.307 ], "form": "A", "ssZp": 4.532, "Dp": 4.610, "splay_angle": 20.639, "splay_distance": 3.160, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 172.921, "theta": -151.318, "eta_prime": 175.664, "theta_prime": -149.562, "eta_base": -170.897, "theta_base": -108.861, "v0": 1.148, "v1": -28.221, "v2": 43.143, "v3": -44.145, "v4": 26.928, "amplitude": 45.221, "phase_angle": 17.437, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.794, "filter_rmsd": 0.114, "frame": { "rmsd": 0.013, "origin": [ 7.547, 45.025, 72.636 ], "x_axis": [ 0.512, -0.260, -0.819 ], "y_axis": [ -0.644, 0.516, -0.566 ], "z_axis": [ 0.569, 0.816, 0.097 ], "quaternion": [ 0.729, -0.474, 0.476, 0.132 ] } }, { "index": 427, "index_chain": 106, "chain_name": "R", "nt_resnum": 106, "nt_name": "A", "nt_code": "A", "nt_id": "///R/106", "linked_nts": [ "///R/105", "///R/107" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.221, "beta": 165.260, "gamma": 45.476, "delta": 83.024, "epsilon": -151.404, "zeta": -79.207, "epsilon_zeta": -72.197, "bb_type": "BI", "chi": -155.314, "glyco_bond": "anti", "C5prime_xyz": [ -1.139, 8.649, 0.317 ], "P_xyz": [ 1.501, 8.796, 0.212 ], "form": "A", "ssZp": 4.343, "Dp": 4.641, "splay_angle": 21.928, "splay_distance": 3.367, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 167.470, "theta": -151.677, "eta_prime": -179.530, "theta_prime": -152.200, "eta_base": -123.820, "theta_base": -136.657, "v0": 13.787, "v1": -35.995, "v2": 43.509, "v3": -36.756, "v4": 14.447, "amplitude": 43.512, "phase_angle": 0.608, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.727, "filter_rmsd": 0.042, "frame": { "rmsd": 0.008, "origin": [ 10.329, 46.472, 72.250 ], "x_axis": [ 0.020, 0.191, -0.981 ], "y_axis": [ -0.714, 0.690, 0.120 ], "z_axis": [ 0.700, 0.698, 0.150 ], "quaternion": [ 0.682, -0.212, 0.616, 0.332 ] } }, { "index": 428, "index_chain": 107, "chain_name": "R", "nt_resnum": 107, "nt_name": "A", "nt_code": "A", "nt_id": "///R/107", "linked_nts": [ "///R/106", "///R/108" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -69.151, "beta": 168.336, "gamma": 56.747, "delta": 79.790, "epsilon": -140.097, "zeta": -73.410, "epsilon_zeta": -66.687, "bb_type": "BI", "chi": -159.898, "glyco_bond": "anti", "C5prime_xyz": [ -1.188, 8.611, 0.525 ], "P_xyz": [ 1.369, 8.855, 0.052 ], "form": "A", "ssZp": 4.405, "Dp": 4.757, "splay_angle": 24.662, "splay_distance": 3.898, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 166.701, "theta": -142.110, "eta_prime": 176.401, "theta_prime": -142.977, "eta_base": -153.846, "theta_base": -119.535, "v0": 14.865, "v1": -37.981, "v2": 46.227, "v3": -38.707, "v4": 15.124, "amplitude": 46.228, "phase_angle": 0.397, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.926, "filter_rmsd": 0.034, "frame": { "rmsd": 0.011, "origin": [ 13.454, 47.722, 72.364 ], "x_axis": [ -0.323, 0.434, -0.841 ], "y_axis": [ -0.547, 0.640, 0.540 ], "z_axis": [ 0.773, 0.634, 0.031 ], "quaternion": [ 0.581, -0.041, 0.695, 0.422 ] } }, { "index": 429, "index_chain": 108, "chain_name": "R", "nt_resnum": 108, "nt_name": "G", "nt_code": "G", "nt_id": "///R/108", "linked_nts": [ "///R/107", "///R/109" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -54.485, "beta": 174.037, "gamma": 46.174, "delta": 77.931, "epsilon": -153.234, "zeta": -53.857, "epsilon_zeta": -99.377, "bb_type": "BI", "chi": -161.650, "glyco_bond": "anti", "C5prime_xyz": [ -1.090, 8.679, 0.636 ], "P_xyz": [ 1.457, 9.192, 0.792 ], "form": "A", "ssZp": 4.501, "Dp": 4.696, "splay_angle": 22.850, "splay_distance": 3.787, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": 171.845, "theta": -135.645, "eta_prime": -177.304, "theta_prime": -134.740, "eta_base": -138.172, "theta_base": -106.947, "v0": 9.984, "v1": -33.379, "v2": 42.530, "v3": -38.091, "v4": 17.893, "amplitude": 42.727, "phase_angle": 5.508, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.816, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 16.118, 49.581, 70.209 ], "x_axis": [ -0.763, 0.522, -0.381 ], "y_axis": [ -0.209, 0.359, 0.910 ], "z_axis": [ 0.612, 0.774, -0.165 ], "quaternion": [ 0.328, 0.104, 0.756, 0.557 ] } }, { "index": 430, "index_chain": 109, "chain_name": "R", "nt_resnum": 109, "nt_name": "G", "nt_code": "G", "nt_id": "///R/109", "linked_nts": [ "///R/108", "///R/110" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor", "alpha": -108.267, "beta": -173.255, "gamma": 78.205, "delta": 72.444, "epsilon": -127.195, "zeta": -66.154, "epsilon_zeta": -61.041, "bb_type": "--", "chi": -159.240, "glyco_bond": "anti", "C5prime_xyz": [ -1.632, 8.865, 0.533 ], "P_xyz": [ 0.790, 9.697, 0.072 ], "form": ".", "ssZp": 4.316, "Dp": 4.818, "splay_angle": 82.205, "splay_distance": 11.702, "splay_ratio": 0.657, "d22": null, "d64": null, "eta": 159.850, "theta": -119.273, "eta_prime": 175.273, "theta_prime": -159.970, "eta_base": -142.278, "theta_base": 147.118, "v0": 3.809, "v1": -32.622, "v2": 46.871, "v3": -46.448, "v4": 26.806, "amplitude": 48.374, "phase_angle": 14.320, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 16.591, 52.323, 67.639 ], "x_axis": [ -0.852, 0.476, 0.220 ], "y_axis": [ 0.333, 0.167, 0.928 ], "z_axis": [ 0.405, 0.864, -0.301 ], "quaternion": [ 0.061, 0.265, 0.762, 0.588 ] } }, { "index": 431, "index_chain": 110, "chain_name": "R", "nt_resnum": 110, "nt_name": "U", "nt_code": "U", "nt_id": "///R/110", "linked_nts": [ "///R/109", "///R/111" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -170.451, "beta": 149.523, "gamma": 28.441, "delta": 89.009, "epsilon": -130.109, "zeta": -83.084, "epsilon_zeta": -47.025, "bb_type": "BI", "chi": -158.475, "glyco_bond": "anti", "C5prime_xyz": [ -1.170, 8.660, 0.426 ], "P_xyz": [ 1.465, 8.750, 0.713 ], "form": ".", "ssZp": 4.282, "Dp": 4.666, "splay_angle": 26.503, "splay_distance": 4.174, "splay_ratio": 0.231, "d22": null, "d64": null, "eta": 20.827, "theta": -128.568, "eta_prime": 46.086, "theta_prime": -123.144, "eta_base": 25.137, "theta_base": -71.925, "v0": 10.398, "v1": -29.231, "v2": 35.964, "v3": -30.687, "v4": 12.970, "amplitude": 35.987, "phase_angle": 2.085, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.153, "filter_rmsd": 0.109, "frame": { "rmsd": 0.007, "origin": [ 28.063, 54.305, 66.445 ], "x_axis": [ 0.361, -0.581, 0.730 ], "y_axis": [ -0.653, 0.401, 0.642 ], "z_axis": [ -0.665, -0.709, -0.235 ], "quaternion": [ 0.618, 0.547, -0.564, 0.029 ] } }, { "index": 432, "index_chain": 111, "chain_name": "R", "nt_resnum": 111, "nt_name": "G", "nt_code": "G", "nt_id": "///R/111", "linked_nts": [ "///R/110", "///R/112" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,ribose-zipper,cap-donor,phosphate", "alpha": -45.765, "beta": 150.987, "gamma": 53.617, "delta": 84.041, "epsilon": -163.754, "zeta": -65.430, "epsilon_zeta": -98.323, "bb_type": "BI", "chi": -139.658, "glyco_bond": "anti", "C5prime_xyz": [ -1.037, 8.773, -0.633 ], "P_xyz": [ 1.580, 8.585, -1.059 ], "form": ".", "ssZp": 3.568, "Dp": 4.343, "splay_angle": 18.174, "splay_distance": 3.049, "splay_ratio": 0.161, "d22": null, "d64": null, "eta": 169.061, "theta": -144.356, "eta_prime": -163.732, "theta_prime": -149.078, "eta_base": -97.248, "theta_base": -136.967, "v0": 6.958, "v1": -28.322, "v2": 37.719, "v3": -33.692, "v4": 17.247, "amplitude": 38.061, "phase_angle": 7.682, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.453, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 26.478, 51.142, 68.659 ], "x_axis": [ -0.252, -0.009, 0.968 ], "y_axis": [ -0.862, 0.456, -0.220 ], "z_axis": [ -0.439, -0.890, -0.123 ], "quaternion": [ 0.520, 0.322, -0.677, 0.410 ] } }, { "index": 433, "index_chain": 112, "chain_name": "R", "nt_resnum": 112, "nt_name": "A", "nt_code": "A", "nt_id": "///R/112", "linked_nts": [ "///R/111", "///R/113" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,phosphate", "alpha": -83.399, "beta": -178.600, "gamma": 62.386, "delta": 84.028, "epsilon": -152.558, "zeta": -47.942, "epsilon_zeta": -104.615, "bb_type": "BI", "chi": -128.346, "glyco_bond": "anti", "C5prime_xyz": [ -1.545, 8.557, -1.318 ], "P_xyz": [ 0.939, 8.856, -1.967 ], "form": ".", "ssZp": 3.049, "Dp": 4.501, "splay_angle": 58.816, "splay_distance": 9.458, "splay_ratio": 0.491, "d22": null, "d64": null, "eta": 168.262, "theta": -87.779, "eta_prime": -178.714, "theta_prime": -84.617, "eta_base": -154.318, "theta_base": -54.881, "v0": 0.427, "v1": -22.513, "v2": 34.388, "v3": -34.857, "v4": 22.150, "amplitude": 36.126, "phase_angle": 17.843, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.584, "filter_rmsd": 0.043, "frame": { "rmsd": 0.008, "origin": [ 25.256, 48.401, 68.121 ], "x_axis": [ -0.553, 0.176, 0.814 ], "y_axis": [ -0.799, 0.166, -0.579 ], "z_axis": [ -0.237, -0.970, 0.049 ], "quaternion": [ -0.407, -0.241, 0.646, -0.599 ] } }, { "index": 434, "index_chain": 113, "chain_name": "R", "nt_resnum": 113, "nt_name": "C", "nt_code": "C", "nt_id": "///R/113", "linked_nts": [ "///R/112", "///R/114" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": 150.949, "beta": -145.932, "gamma": 167.162, "delta": 84.892, "epsilon": -146.148, "zeta": -71.303, "epsilon_zeta": -74.844, "bb_type": "BI", "chi": -175.774, "glyco_bond": "anti", "C5prime_xyz": [ -0.865, 8.224, 1.478 ], "P_xyz": [ 0.895, 9.368, -0.133 ], "form": "A", "ssZp": 4.814, "Dp": 4.804, "splay_angle": 28.693, "splay_distance": 4.305, "splay_ratio": 0.251, "d22": 4.646, "d64": 4.975, "eta": 159.519, "theta": -156.295, "eta_prime": -151.914, "theta_prime": -161.121, "eta_base": -87.061, "theta_base": -144.672, "v0": 19.887, "v1": -40.912, "v2": 45.121, "v3": -34.541, "v4": 9.461, "amplitude": 45.450, "phase_angle": 353.103, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.502, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ 16.033, 49.465, 69.931 ], "x_axis": [ -0.772, 0.437, -0.462 ], "y_axis": [ 0.320, -0.361, -0.876 ], "z_axis": [ -0.550, -0.824, 0.139 ], "quaternion": [ 0.039, -0.336, -0.564, 0.754 ] } }, { "index": 435, "index_chain": 114, "chain_name": "R", "nt_resnum": 114, "nt_name": "U", "nt_code": "U", "nt_id": "///R/114", "linked_nts": [ "///R/113", "///R/115" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -58.531, "beta": -173.728, "gamma": 29.664, "delta": 65.501, "epsilon": 76.843, "zeta": 85.031, "epsilon_zeta": -8.188, "bb_type": "--", "chi": -175.036, "glyco_bond": "anti", "C5prime_xyz": [ -1.112, 8.380, 1.342 ], "P_xyz": [ 1.380, 8.572, 2.053 ], "form": "A", "ssZp": 4.326, "Dp": 4.307, "splay_angle": 17.484, "splay_distance": 2.848, "splay_ratio": 0.157, "d22": 4.549, "d64": 4.482, "eta": -175.490, "theta": -139.820, "eta_prime": -163.492, "theta_prime": -138.669, "eta_base": -133.853, "theta_base": -118.854, "v0": 20.095, "v1": -48.002, "v2": 56.660, "v3": -45.944, "v4": 16.786, "amplitude": 56.686, "phase_angle": 358.237, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.102, "filter_rmsd": 0.112, "frame": { "rmsd": 0.012, "origin": [ 13.076, 47.344, 72.232 ], "x_axis": [ -0.446, 0.284, -0.849 ], "y_axis": [ 0.715, -0.458, -0.528 ], "z_axis": [ -0.539, -0.842, 0.001 ], "quaternion": [ -0.156, -0.503, -0.497, 0.690 ] } }, { "index": 436, "index_chain": 115, "chain_name": "R", "nt_resnum": 115, "nt_name": "U", "nt_code": "U", "nt_id": "///R/115", "linked_nts": [ "///R/114", "///R/116" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate", "alpha": -136.701, "beta": 154.287, "gamma": 58.925, "delta": 74.535, "epsilon": -143.705, "zeta": -79.234, "epsilon_zeta": -64.471, "bb_type": "BI", "chi": -157.411, "glyco_bond": "anti", "C5prime_xyz": [ -1.596, 8.868, 0.410 ], "P_xyz": [ 0.939, 9.384, -0.110 ], "form": "A", "ssZp": 4.254, "Dp": 4.629, "splay_angle": 21.891, "splay_distance": 3.480, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 154.104, "theta": -150.954, "eta_prime": 174.275, "theta_prime": -151.969, "eta_base": -149.043, "theta_base": -129.058, "v0": 4.637, "v1": -32.606, "v2": 46.887, "v3": -45.190, "v4": 25.394, "amplitude": 48.122, "phase_angle": 13.010, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ 10.518, 46.290, 72.906 ], "x_axis": [ -0.109, -0.083, -0.991 ], "y_axis": [ 0.705, -0.709, -0.018 ], "z_axis": [ -0.701, -0.700, 0.136 ], "quaternion": [ -0.282, -0.605, -0.257, 0.699 ] } }, { "index": 437, "index_chain": 116, "chain_name": "R", "nt_resnum": 116, "nt_name": "A", "nt_code": "A", "nt_id": "///R/116", "linked_nts": [ "///R/115", "///R/117" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -51.558, "beta": 167.562, "gamma": 45.611, "delta": 76.297, "epsilon": -157.733, "zeta": -86.285, "epsilon_zeta": -71.448, "bb_type": "BI", "chi": -155.966, "glyco_bond": "anti", "C5prime_xyz": [ -1.334, 8.702, 0.300 ], "P_xyz": [ 1.231, 9.229, 0.199 ], "form": ".", "ssZp": 4.342, "Dp": 4.613, "splay_angle": 25.510, "splay_distance": 4.383, "splay_ratio": 0.237, "d22": null, "d64": null, "eta": 164.146, "theta": -138.218, "eta_prime": 175.764, "theta_prime": -145.048, "eta_base": -144.832, "theta_base": -133.453, "v0": 8.392, "v1": -34.975, "v2": 46.608, "v3": -43.389, "v4": 21.925, "amplitude": 47.150, "phase_angle": 8.699, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.681, "filter_rmsd": 0.030, "frame": { "rmsd": 0.012, "origin": [ 7.386, 44.873, 72.363 ], "x_axis": [ 0.362, -0.314, -0.878 ], "y_axis": [ 0.578, -0.663, 0.476 ], "z_axis": [ -0.731, -0.680, -0.058 ], "quaternion": [ 0.400, 0.722, 0.092, -0.557 ] } }, { "index": 438, "index_chain": 117, "chain_name": "R", "nt_resnum": 117, "nt_name": "G", "nt_code": "G", "nt_id": "///R/117", "linked_nts": [ "///R/116", "///R/118" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 151.694, "beta": -153.936, "gamma": -174.247, "delta": 81.958, "epsilon": -133.245, "zeta": -70.319, "epsilon_zeta": -62.926, "bb_type": "BI", "chi": 177.121, "glyco_bond": "anti", "C5prime_xyz": [ -1.160, 8.113, 1.886 ], "P_xyz": [ 0.338, 10.017, 0.916 ], "form": "A", "ssZp": 4.842, "Dp": 4.818, "splay_angle": 26.960, "splay_distance": 4.100, "splay_ratio": 0.237, "d22": null, "d64": null, "eta": 176.464, "theta": -158.324, "eta_prime": -173.885, "theta_prime": -150.848, "eta_base": -144.293, "theta_base": -106.617, "v0": 13.995, "v1": -35.238, "v2": 42.043, "v3": -35.192, "v4": 13.538, "amplitude": 42.044, "phase_angle": 359.778, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.707, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 3.805, 43.962, 70.005 ], "x_axis": [ 0.593, -0.487, -0.641 ], "y_axis": [ 0.403, -0.510, 0.760 ], "z_axis": [ -0.697, -0.709, -0.106 ], "quaternion": [ 0.494, 0.743, -0.028, -0.450 ] } }, { "index": 439, "index_chain": 118, "chain_name": "R", "nt_resnum": 118, "nt_name": "U", "nt_code": "U", "nt_id": "///R/118", "linked_nts": [ "///R/117", "///R/119" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -53.177, "beta": 170.906, "gamma": 41.047, "delta": 80.410, "epsilon": -147.457, "zeta": -76.252, "epsilon_zeta": -71.205, "bb_type": "BI", "chi": -164.904, "glyco_bond": "anti", "C5prime_xyz": [ -1.376, 8.635, 0.870 ], "P_xyz": [ 1.241, 8.856, 1.223 ], "form": "A", "ssZp": 4.604, "Dp": 4.730, "splay_angle": 21.594, "splay_distance": 3.380, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 164.503, "theta": -146.830, "eta_prime": -175.628, "theta_prime": -144.411, "eta_base": -115.233, "theta_base": -123.155, "v0": 11.997, "v1": -35.682, "v2": 44.698, "v3": -38.667, "v4": 16.852, "amplitude": 44.771, "phase_angle": 3.262, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.627, "filter_rmsd": 0.113, "frame": { "rmsd": 0.012, "origin": [ 2.707, 41.008, 67.383 ], "x_axis": [ 0.689, -0.718, 0.100 ], "y_axis": [ -0.184, -0.040, 0.982 ], "z_axis": [ -0.701, -0.695, -0.159 ], "quaternion": [ 0.610, 0.687, -0.328, -0.219 ] } }, { "index": 440, "index_chain": 119, "chain_name": "R", "nt_resnum": 119, "nt_name": "G", "nt_code": "G", "nt_id": "///R/119", "linked_nts": [ "///R/118", "///R/120" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -52.091, "beta": -176.010, "gamma": 33.272, "delta": 81.028, "epsilon": -136.614, "zeta": -81.787, "epsilon_zeta": -54.827, "bb_type": "BI", "chi": -153.552, "glyco_bond": "anti", "C5prime_xyz": [ -0.909, 8.641, 0.194 ], "P_xyz": [ 1.586, 9.002, 0.899 ], "form": "A", "ssZp": 4.163, "Dp": 4.740, "splay_angle": 20.541, "splay_distance": 3.277, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 173.702, "theta": -153.108, "eta_prime": 178.350, "theta_prime": -148.640, "eta_base": -153.077, "theta_base": -135.581, "v0": 10.422, "v1": -32.459, "v2": 40.959, "v3": -36.301, "v4": 16.393, "amplitude": 41.083, "phase_angle": 4.451, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.346, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 1.606, 38.495, 65.408 ], "x_axis": [ 0.646, -0.341, 0.683 ], "y_axis": [ -0.639, 0.247, 0.728 ], "z_axis": [ -0.417, -0.907, -0.059 ], "quaternion": [ 0.677, 0.604, -0.406, 0.110 ] } }, { "index": 441, "index_chain": 120, "chain_name": "R", "nt_resnum": 120, "nt_name": "G", "nt_code": "G", "nt_id": "///R/120", "linked_nts": [ "///R/119", "///R/121" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -64.916, "beta": 161.904, "gamma": 51.117, "delta": 75.203, "epsilon": -157.085, "zeta": -62.128, "epsilon_zeta": -94.957, "bb_type": "BI", "chi": -151.537, "glyco_bond": "anti", "C5prime_xyz": [ -1.278, 8.780, 0.046 ], "P_xyz": [ 1.172, 9.142, -0.602 ], "form": ".", "ssZp": 4.243, "Dp": 4.713, "splay_angle": 23.595, "splay_distance": 4.094, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": 155.967, "theta": -149.588, "eta_prime": 168.053, "theta_prime": -153.660, "eta_base": -167.256, "theta_base": -159.392, "v0": 12.070, "v1": -38.539, "v2": 48.454, "v3": -41.866, "v4": 19.398, "amplitude": 48.578, "phase_angle": 4.086, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.789, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 0.939, 35.473, 64.330 ], "x_axis": [ 0.440, -0.101, 0.892 ], "y_axis": [ -0.879, 0.154, 0.451 ], "z_axis": [ -0.183, -0.983, -0.021 ], "quaternion": [ 0.627, 0.572, -0.429, 0.310 ] } }, { "index": 442, "index_chain": 121, "chain_name": "R", "nt_resnum": 121, "nt_name": "A", "nt_code": "A", "nt_id": "///R/121", "linked_nts": [ "///R/120", "///R/122" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -65.891, "beta": 160.627, "gamma": 84.412, "delta": 66.875, "epsilon": -143.104, "zeta": -76.231, "epsilon_zeta": -66.873, "bb_type": "BI", "chi": -163.900, "glyco_bond": "anti", "C5prime_xyz": [ -2.103, 8.849, 0.678 ], "P_xyz": [ -0.031, 10.116, 0.000 ], "form": "A", "ssZp": 4.369, "Dp": 4.658, "splay_angle": 20.695, "splay_distance": 3.298, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": -172.396, "theta": -164.758, "eta_prime": -162.537, "theta_prime": -162.594, "eta_base": -155.684, "theta_base": -126.740, "v0": -4.887, "v1": -27.288, "v2": 46.572, "v3": -50.809, "v4": 35.696, "amplitude": 51.017, "phase_angle": 24.096, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.034, "frame": { "rmsd": 0.008, "origin": [ 2.496, 32.018, 62.782 ], "x_axis": [ 0.320, -0.115, 0.941 ], "y_axis": [ -0.943, 0.058, 0.328 ], "z_axis": [ -0.092, -0.992, -0.090 ], "quaternion": [ 0.567, 0.581, -0.455, 0.365 ] } }, { "index": 443, "index_chain": 122, "chain_name": "R", "nt_resnum": 122, "nt_name": "C", "nt_code": "C", "nt_id": "///R/122", "linked_nts": [ "///R/121", "///R/123" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop", "alpha": -72.667, "beta": 158.908, "gamma": 65.377, "delta": 79.016, "epsilon": -148.203, "zeta": -69.359, "epsilon_zeta": -78.843, "bb_type": "BI", "chi": -157.746, "glyco_bond": "anti", "C5prime_xyz": [ -1.372, 8.798, 0.413 ], "P_xyz": [ 1.047, 9.207, -0.281 ], "form": ".", "ssZp": 4.304, "Dp": 4.641, "splay_angle": 44.897, "splay_distance": 7.838, "splay_ratio": 0.393, "d22": null, "d64": null, "eta": 166.665, "theta": -131.678, "eta_prime": 179.506, "theta_prime": -140.366, "eta_base": -133.615, "theta_base": -139.535, "v0": 3.581, "v1": -29.534, "v2": 42.370, "v3": -41.586, "v4": 24.204, "amplitude": 43.680, "phase_angle": 14.067, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.374, "filter_rmsd": 0.061, "frame": { "rmsd": 0.009, "origin": [ 3.379, 28.892, 63.352 ], "x_axis": [ -0.250, -0.062, 0.966 ], "y_axis": [ -0.964, -0.071, -0.254 ], "z_axis": [ 0.085, -0.995, -0.042 ], "quaternion": [ 0.399, 0.465, -0.552, 0.566 ] } }, { "index": 444, "index_chain": 123, "chain_name": "R", "nt_resnum": 123, "nt_name": "A", "nt_code": "A", "nt_id": "///R/123", "linked_nts": [ "///R/122", "///R/124" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper", "alpha": -178.480, "beta": 162.849, "gamma": -167.381, "delta": 85.777, "epsilon": -142.721, "zeta": -78.578, "epsilon_zeta": -64.143, "bb_type": "BI", "chi": -155.109, "glyco_bond": "anti", "C5prime_xyz": [ -1.388, 8.704, 0.285 ], "P_xyz": [ -0.716, 10.911, -0.881 ], "form": ".", "ssZp": 4.036, "Dp": 4.456, "splay_angle": 18.725, "splay_distance": 2.989, "splay_ratio": 0.164, "d22": null, "d64": null, "eta": -164.338, "theta": 169.928, "eta_prime": -162.118, "theta_prime": -178.852, "eta_base": -154.113, "theta_base": -140.271, "v0": 6.286, "v1": -28.035, "v2": 38.380, "v3": -35.340, "v4": 18.474, "amplitude": 38.899, "phase_angle": 9.371, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1f", "suiteness": 0.419, "filter_rmsd": 0.043, "frame": { "rmsd": 0.011, "origin": [ 6.292, 21.686, 64.357 ], "x_axis": [ -0.458, -0.057, 0.887 ], "y_axis": [ -0.883, 0.149, -0.446 ], "z_axis": [ -0.107, -0.987, -0.118 ], "quaternion": [ -0.378, -0.358, 0.657, -0.546 ] } }, { "index": 445, "index_chain": 124, "chain_name": "R", "nt_resnum": 124, "nt_name": "A", "nt_code": "A", "nt_id": "///R/124", "linked_nts": [ "///R/123", "///R/125" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,A-minor,ribose-zipper", "alpha": -78.356, "beta": 168.712, "gamma": 62.201, "delta": 80.162, "epsilon": -164.256, "zeta": -67.021, "epsilon_zeta": -97.235, "bb_type": "BI", "chi": -148.687, "glyco_bond": "anti", "C5prime_xyz": [ -1.175, 8.653, -0.101 ], "P_xyz": [ 1.344, 8.753, -0.655 ], "form": "A", "ssZp": 4.098, "Dp": 4.564, "splay_angle": 19.043, "splay_distance": 2.976, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 159.281, "theta": -149.996, "eta_prime": 174.473, "theta_prime": -155.052, "eta_base": -140.612, "theta_base": -138.753, "v0": 7.658, "v1": -33.529, "v2": 45.137, "v3": -41.357, "v4": 21.640, "amplitude": 45.690, "phase_angle": 8.923, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.734, "filter_rmsd": 0.047, "frame": { "rmsd": 0.021, "origin": [ 5.964, 18.723, 64.572 ], "x_axis": [ -0.859, 0.085, 0.505 ], "y_axis": [ -0.510, -0.052, -0.858 ], "z_axis": [ -0.047, -0.995, 0.088 ], "quaternion": [ 0.211, 0.162, -0.656, 0.707 ] } }, { "index": 446, "index_chain": 125, "chain_name": "R", "nt_resnum": 125, "nt_name": "A", "nt_code": "A", "nt_id": "///R/125", "linked_nts": [ "///R/124", "///R/126" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,A-minor", "alpha": -73.962, "beta": 174.685, "gamma": 57.679, "delta": 77.845, "epsilon": -152.528, "zeta": -57.674, "epsilon_zeta": -94.854, "bb_type": "BI", "chi": -148.436, "glyco_bond": "anti", "C5prime_xyz": [ -0.949, 8.695, -0.229 ], "P_xyz": [ 1.591, 8.807, -0.753 ], "form": "A", "ssZp": 4.117, "Dp": 4.783, "splay_angle": 26.556, "splay_distance": 4.180, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 166.086, "theta": -136.673, "eta_prime": 175.785, "theta_prime": -136.365, "eta_base": -152.341, "theta_base": -106.601, "v0": 4.191, "v1": -29.427, "v2": 41.346, "v3": -39.341, "v4": 22.755, "amplitude": 42.369, "phase_angle": 12.615, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.779, "filter_rmsd": 0.044, "frame": { "rmsd": 0.016, "origin": [ 6.100, 15.951, 65.648 ], "x_axis": [ -0.997, 0.054, 0.060 ], "y_axis": [ -0.074, -0.307, -0.949 ], "z_axis": [ -0.033, -0.950, 0.310 ], "quaternion": [ 0.040, 0.008, -0.587, 0.808 ] } }, { "index": 447, "index_chain": 126, "chain_name": "R", "nt_resnum": 126, "nt_name": "G", "nt_code": "G", "nt_id": "///R/126", "linked_nts": [ "///R/125", "///R/127" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop", "alpha": -79.123, "beta": 164.289, "gamma": 67.227, "delta": 77.190, "epsilon": -147.225, "zeta": -67.697, "epsilon_zeta": -79.528, "bb_type": "BI", "chi": -168.800, "glyco_bond": "anti", "C5prime_xyz": [ -1.350, 8.553, 1.050 ], "P_xyz": [ 1.159, 9.096, 0.546 ], "form": "A", "ssZp": 4.690, "Dp": 4.800, "splay_angle": 27.470, "splay_distance": 4.196, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": 162.998, "theta": -140.673, "eta_prime": -176.247, "theta_prime": -138.486, "eta_base": -124.107, "theta_base": -102.432, "v0": 8.951, "v1": -33.230, "v2": 43.661, "v3": -39.381, "v4": 19.598, "amplitude": 44.001, "phase_angle": 7.125, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.545, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ 3.402, 13.106, 67.099 ], "x_axis": [ -0.824, 0.085, -0.560 ], "y_axis": [ 0.503, -0.347, -0.792 ], "z_axis": [ -0.262, -0.934, 0.243 ], "quaternion": [ -0.134, -0.265, -0.556, 0.777 ] } }, { "index": 448, "index_chain": 127, "chain_name": "R", "nt_resnum": 127, "nt_name": "G", "nt_code": "G", "nt_id": "///R/127", "linked_nts": [ "///R/126", "///R/128" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.045, "beta": 163.694, "gamma": 64.235, "delta": 78.672, "epsilon": -139.307, "zeta": -85.399, "epsilon_zeta": -53.908, "bb_type": "BI", "chi": -171.209, "glyco_bond": "anti", "C5prime_xyz": [ -1.472, 8.624, 1.224 ], "P_xyz": [ 1.137, 8.908, 1.270 ], "form": "A", "ssZp": 4.505, "Dp": 4.612, "splay_angle": 22.313, "splay_distance": 3.443, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 173.623, "theta": -146.888, "eta_prime": -166.905, "theta_prime": -146.813, "eta_base": -110.757, "theta_base": -121.635, "v0": 7.042, "v1": -33.109, "v2": 45.940, "v3": -42.822, "v4": 22.397, "amplitude": 46.657, "phase_angle": 10.054, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.754, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ -0.051, 10.723, 67.040 ], "x_axis": [ -0.247, -0.098, -0.964 ], "y_axis": [ 0.914, -0.355, -0.198 ], "z_axis": [ -0.323, -0.930, 0.177 ], "quaternion": [ -0.379, -0.483, -0.423, 0.667 ] } }, { "index": 449, "index_chain": 128, "chain_name": "R", "nt_resnum": 128, "nt_name": "U", "nt_code": "U", "nt_id": "///R/128", "linked_nts": [ "///R/127", "///R/129" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -43.102, "beta": 169.073, "gamma": 32.543, "delta": 84.745, "epsilon": -150.575, "zeta": -76.363, "epsilon_zeta": -74.211, "bb_type": "BI", "chi": -158.496, "glyco_bond": "anti", "C5prime_xyz": [ -1.226, 8.600, 0.393 ], "P_xyz": [ 1.384, 8.914, 0.611 ], "form": "A", "ssZp": 4.440, "Dp": 4.678, "splay_angle": 24.943, "splay_distance": 3.909, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 165.210, "theta": -150.072, "eta_prime": 176.008, "theta_prime": -149.807, "eta_base": -142.875, "theta_base": -135.195, "v0": 12.123, "v1": -34.911, "v2": 43.107, "v3": -37.639, "v4": 16.092, "amplitude": 43.162, "phase_angle": 2.890, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.223, "filter_rmsd": 0.112, "frame": { "rmsd": 0.012, "origin": [ -2.504, 8.318, 67.263 ], "x_axis": [ 0.313, -0.255, -0.915 ], "y_axis": [ 0.861, -0.330, 0.387 ], "z_axis": [ -0.400, -0.909, 0.116 ], "quaternion": [ 0.524, 0.618, 0.245, -0.532 ] } }, { "index": 450, "index_chain": 129, "chain_name": "R", "nt_resnum": 129, "nt_name": "G", "nt_code": "G", "nt_id": "///R/129", "linked_nts": [ "///R/128", "///R/130" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.956, "beta": 171.047, "gamma": 54.974, "delta": 81.984, "epsilon": -142.107, "zeta": -75.404, "epsilon_zeta": -66.703, "bb_type": "BI", "chi": -169.155, "glyco_bond": "anti", "C5prime_xyz": [ -1.517, 8.560, 1.059 ], "P_xyz": [ 1.039, 9.125, 1.227 ], "form": "A", "ssZp": 4.644, "Dp": 4.722, "splay_angle": 23.002, "splay_distance": 3.559, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 171.176, "theta": -142.750, "eta_prime": -179.533, "theta_prime": -139.930, "eta_base": -152.070, "theta_base": -102.701, "v0": 6.099, "v1": -30.206, "v2": 40.704, "v3": -39.359, "v4": 20.840, "amplitude": 41.438, "phase_angle": 10.799, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.952, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ -5.390, 5.766, 66.596 ], "x_axis": [ 0.720, -0.162, -0.675 ], "y_axis": [ 0.646, -0.199, 0.737 ], "z_axis": [ -0.254, -0.967, -0.039 ], "quaternion": [ 0.609, 0.700, 0.173, -0.332 ] } }, { "index": 451, "index_chain": 130, "chain_name": "R", "nt_resnum": 130, "nt_name": "A", "nt_code": "A", "nt_id": "///R/130", "linked_nts": [ "///R/129", "///R/131" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -68.909, "beta": 162.563, "gamma": 61.378, "delta": 80.356, "epsilon": -149.491, "zeta": -75.479, "epsilon_zeta": -74.012, "bb_type": "BI", "chi": -166.782, "glyco_bond": "anti", "C5prime_xyz": [ -1.622, 8.630, 0.934 ], "P_xyz": [ 0.925, 9.027, 0.678 ], "form": "A", "ssZp": 4.623, "Dp": 4.706, "splay_angle": 22.987, "splay_distance": 3.517, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 166.552, "theta": -148.518, "eta_prime": -175.478, "theta_prime": -150.195, "eta_base": -120.732, "theta_base": -122.666, "v0": 4.258, "v1": -28.383, "v2": 40.131, "v3": -39.119, "v4": 22.112, "amplitude": 41.192, "phase_angle": 13.033, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.844, "filter_rmsd": 0.030, "frame": { "rmsd": 0.012, "origin": [ -5.366, 2.902, 64.482 ], "x_axis": [ 0.965, -0.253, -0.062 ], "y_axis": [ 0.018, -0.173, 0.985 ], "z_axis": [ -0.260, -0.952, -0.163 ], "quaternion": [ 0.638, 0.759, -0.077, -0.106 ] } }, { "index": 452, "index_chain": 131, "chain_name": "R", "nt_resnum": 131, "nt_name": "A", "nt_code": "A", "nt_id": "///R/131", "linked_nts": [ "///R/130", "///R/132" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.883, "beta": 179.588, "gamma": 49.270, "delta": 79.777, "epsilon": -148.205, "zeta": -68.915, "epsilon_zeta": -79.290, "bb_type": "BI", "chi": -159.744, "glyco_bond": "anti", "C5prime_xyz": [ -1.028, 8.545, 0.573 ], "P_xyz": [ 1.574, 8.733, 0.739 ], "form": "A", "ssZp": 4.474, "Dp": 4.734, "splay_angle": 24.142, "splay_distance": 3.758, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 166.255, "theta": -146.339, "eta_prime": 175.438, "theta_prime": -143.760, "eta_base": -141.611, "theta_base": -122.927, "v0": 14.044, "v1": -36.604, "v2": 44.295, "v3": -37.503, "v4": 14.877, "amplitude": 44.298, "phase_angle": 0.728, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.933, "filter_rmsd": 0.034, "frame": { "rmsd": 0.017, "origin": [ -5.335, -0.190, 62.807 ], "x_axis": [ 0.803, -0.189, 0.566 ], "y_axis": [ -0.587, -0.083, 0.805 ], "z_axis": [ -0.105, -0.979, -0.177 ], "quaternion": [ 0.621, 0.718, -0.270, 0.160 ] } }, { "index": 453, "index_chain": 132, "chain_name": "R", "nt_resnum": 132, "nt_name": "A", "nt_code": "A", "nt_id": "///R/132", "linked_nts": [ "///R/131", "///R/133" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -65.263, "beta": 175.314, "gamma": 53.958, "delta": 77.291, "epsilon": -138.771, "zeta": -76.761, "epsilon_zeta": -62.010, "bb_type": "BI", "chi": -161.801, "glyco_bond": "anti", "C5prime_xyz": [ -1.339, 8.631, 0.688 ], "P_xyz": [ 1.240, 9.059, 0.751 ], "form": "A", "ssZp": 4.498, "Dp": 4.778, "splay_angle": 22.063, "splay_distance": 3.527, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 171.340, "theta": -147.788, "eta_prime": -176.930, "theta_prime": -146.381, "eta_base": -143.004, "theta_base": -127.632, "v0": 9.104, "v1": -33.997, "v2": 44.436, "v3": -40.770, "v4": 20.059, "amplitude": 44.807, "phase_angle": 7.386, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.953, "filter_rmsd": 0.032, "frame": { "rmsd": 0.010, "origin": [ -3.986, -3.464, 61.547 ], "x_axis": [ 0.425, -0.070, 0.903 ], "y_axis": [ -0.905, -0.049, 0.422 ], "z_axis": [ 0.014, -0.996, -0.084 ], "quaternion": [ 0.568, 0.624, -0.391, 0.367 ] } }, { "index": 454, "index_chain": 133, "chain_name": "R", "nt_resnum": 133, "nt_name": "G", "nt_code": "G", "nt_id": "///R/133", "linked_nts": [ "///R/132", "///R/134" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -75.228, "beta": 166.470, "gamma": 65.997, "delta": 76.074, "epsilon": -145.036, "zeta": -69.712, "epsilon_zeta": -75.324, "bb_type": "BI", "chi": -161.726, "glyco_bond": "anti", "C5prime_xyz": [ -1.561, 8.708, 0.642 ], "P_xyz": [ 0.866, 9.348, 0.019 ], "form": ".", "ssZp": 4.539, "Dp": 4.797, "splay_angle": 27.024, "splay_distance": 4.200, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 165.695, "theta": -140.874, "eta_prime": 176.884, "theta_prime": -139.660, "eta_base": -150.942, "theta_base": -99.147, "v0": 4.146, "v1": -31.159, "v2": 43.964, "v3": -43.648, "v4": 25.030, "amplitude": 45.282, "phase_angle": 13.855, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.642, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ -2.064, -6.416, 61.378 ], "x_axis": [ -0.017, 0.028, 0.999 ], "y_axis": [ -0.983, -0.184, -0.012 ], "z_axis": [ 0.184, -0.983, 0.030 ], "quaternion": [ 0.455, 0.533, -0.448, 0.555 ] } }, { "index": 455, "index_chain": 134, "chain_name": "R", "nt_resnum": 134, "nt_name": "U", "nt_code": "U", "nt_id": "///R/134", "linked_nts": [ "///R/133", "///R/135" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end", "alpha": -54.493, "beta": 163.771, "gamma": 50.468, "delta": 81.364, "epsilon": -164.701, "zeta": -70.262, "epsilon_zeta": -94.438, "bb_type": "BI", "chi": -163.607, "glyco_bond": "anti", "C5prime_xyz": [ -1.370, 8.686, 0.727 ], "P_xyz": [ 1.240, 9.084, 0.518 ], "form": ".", "ssZp": 4.564, "Dp": 4.616, "splay_angle": 29.032, "splay_distance": 4.802, "splay_ratio": 0.263, "d22": null, "d64": null, "eta": 165.773, "theta": -153.817, "eta_prime": -172.543, "theta_prime": -156.029, "eta_base": -108.493, "theta_base": -156.474, "v0": 8.838, "v1": -31.942, "v2": 41.654, "v3": -37.477, "v4": 18.185, "amplitude": 41.934, "phase_angle": 6.622, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.826, "filter_rmsd": 0.108, "frame": { "rmsd": 0.007, "origin": [ -1.274, -9.089, 64.519 ], "x_axis": [ -0.702, -0.053, 0.710 ], "y_axis": [ -0.671, -0.284, -0.685 ], "z_axis": [ 0.238, -0.957, 0.164 ], "quaternion": [ 0.211, 0.323, -0.560, 0.733 ] } }, { "index": 456, "index_chain": 135, "chain_name": "R", "nt_resnum": 135, "nt_name": "G", "nt_code": "G", "nt_id": "///R/135", "linked_nts": [ "///R/134", "///R/136" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop", "alpha": -82.359, "beta": -168.790, "gamma": 63.430, "delta": 78.754, "epsilon": -124.731, "zeta": -97.819, "epsilon_zeta": -26.912, "bb_type": "--", "chi": -166.196, "glyco_bond": "anti", "C5prime_xyz": [ -1.824, 8.887, 0.731 ], "P_xyz": [ 0.609, 9.791, 1.173 ], "form": ".", "ssZp": 4.483, "Dp": 4.696, "splay_angle": 79.362, "splay_distance": 13.015, "splay_ratio": 0.642, "d22": null, "d64": null, "eta": 179.668, "theta": 173.096, "eta_prime": -178.771, "theta_prime": 165.547, "eta_base": -173.723, "theta_base": 172.414, "v0": -2.575, "v1": -25.056, "v2": 40.907, "v3": -43.558, "v4": 29.193, "amplitude": 44.048, "phase_angle": 21.766, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.551, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 2.376, -11.459, 66.549 ], "x_axis": [ -0.887, 0.135, 0.442 ], "y_axis": [ -0.462, -0.273, -0.844 ], "z_axis": [ 0.007, -0.953, 0.304 ], "quaternion": [ 0.190, 0.143, -0.572, 0.785 ] } }, { "index": 457, "index_chain": 136, "chain_name": "R", "nt_resnum": 136, "nt_name": "U", "nt_code": "U", "nt_id": "///R/136", "linked_nts": [ "///R/135", "///R/137" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -33.445, "beta": -79.423, "gamma": -74.144, "delta": 87.398, "epsilon": 139.241, "zeta": 40.471, "epsilon_zeta": 98.770, "bb_type": "--", "chi": -153.330, "glyco_bond": "anti", "C5prime_xyz": [ -0.822, 8.400, 0.026 ], "P_xyz": [ -1.338, 10.937, 0.522 ], "form": "A", "ssZp": 4.158, "Dp": 4.254, "splay_angle": 20.626, "splay_distance": 3.473, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": -153.700, "theta": -177.518, "eta_prime": -179.261, "theta_prime": -169.914, "eta_base": 161.749, "theta_base": -135.106, "v0": 23.782, "v1": -42.167, "v2": 43.514, "v3": -30.832, "v4": 4.710, "amplitude": 44.621, "phase_angle": 347.208, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.116, "frame": { "rmsd": 0.015, "origin": [ 11.352, -20.704, 64.717 ], "x_axis": [ -0.244, 0.199, 0.949 ], "y_axis": [ -0.907, 0.300, -0.296 ], "z_axis": [ -0.343, -0.933, 0.107 ], "quaternion": [ 0.539, 0.295, -0.599, 0.513 ] } }, { "index": 458, "index_chain": 137, "chain_name": "R", "nt_resnum": 137, "nt_name": "G", "nt_code": "G", "nt_id": "///R/137", "linked_nts": [ "///R/136", "///R/138" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 178.557, "beta": 123.185, "gamma": 127.667, "delta": 85.440, "epsilon": -125.942, "zeta": -76.277, "epsilon_zeta": -49.665, "bb_type": "--", "chi": 178.910, "glyco_bond": "anti", "C5prime_xyz": [ -1.266, 8.161, 1.881 ], "P_xyz": [ 0.230, 9.807, 0.572 ], "form": "A", "ssZp": 4.719, "Dp": 4.743, "splay_angle": 23.309, "splay_distance": 3.615, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 153.331, "theta": -161.058, "eta_prime": 174.256, "theta_prime": -157.575, "eta_base": -142.857, "theta_base": -122.359, "v0": 14.494, "v1": -32.562, "v2": 37.666, "v3": -30.283, "v4": 10.140, "amplitude": 37.727, "phase_angle": 356.725, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 11.409, -23.611, 66.617 ], "x_axis": [ -0.598, 0.476, 0.645 ], "y_axis": [ -0.695, 0.093, -0.713 ], "z_axis": [ -0.399, -0.874, 0.275 ], "quaternion": [ 0.439, 0.092, -0.595, 0.667 ] } }, { "index": 459, "index_chain": 138, "chain_name": "R", "nt_resnum": 138, "nt_name": "A", "nt_code": "A", "nt_id": "///R/138", "linked_nts": [ "///R/137", "///R/139" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.639, "beta": 165.457, "gamma": 46.205, "delta": 80.520, "epsilon": -131.388, "zeta": -83.239, "epsilon_zeta": -48.149, "bb_type": "BI", "chi": -170.166, "glyco_bond": "anti", "C5prime_xyz": [ -1.387, 8.526, 1.143 ], "P_xyz": [ 1.170, 8.905, 1.429 ], "form": "A", "ssZp": 4.689, "Dp": 4.814, "splay_angle": 22.189, "splay_distance": 3.495, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 162.588, "theta": -144.085, "eta_prime": 178.874, "theta_prime": -142.444, "eta_base": -131.278, "theta_base": -114.276, "v0": 9.616, "v1": -33.259, "v2": 42.688, "v3": -38.314, "v4": 18.318, "amplitude": 42.921, "phase_angle": 5.977, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.657, "filter_rmsd": 0.035, "frame": { "rmsd": 0.005, "origin": [ 10.251, -25.922, 69.143 ], "x_axis": [ -0.885, 0.464, 0.029 ], "y_axis": [ -0.162, -0.248, -0.955 ], "z_axis": [ -0.436, -0.850, 0.294 ], "quaternion": [ 0.201, -0.130, -0.579, 0.779 ] } }, { "index": 460, "index_chain": 139, "chain_name": "R", "nt_resnum": 139, "nt_name": "U", "nt_code": "U", "nt_id": "///R/139", "linked_nts": [ "///R/138", "///R/140" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.660, "beta": 156.418, "gamma": 55.872, "delta": 77.682, "epsilon": -143.262, "zeta": -78.770, "epsilon_zeta": -64.492, "bb_type": "BI", "chi": -168.301, "glyco_bond": "anti", "C5prime_xyz": [ -1.410, 8.679, 1.012 ], "P_xyz": [ 1.145, 9.147, 0.713 ], "form": "A", "ssZp": 4.712, "Dp": 4.800, "splay_angle": 21.376, "splay_distance": 3.318, "splay_ratio": 0.188, "d22": null, "d64": null, "eta": 162.315, "theta": -146.496, "eta_prime": 176.556, "theta_prime": -145.469, "eta_base": -138.398, "theta_base": -112.621, "v0": 6.498, "v1": -31.809, "v2": 43.355, "v3": -40.697, "v4": 21.770, "amplitude": 44.060, "phase_angle": 10.263, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.704, "filter_rmsd": 0.107, "frame": { "rmsd": 0.008, "origin": [ 8.100, -27.542, 71.372 ], "x_axis": [ -0.786, 0.317, -0.531 ], "y_axis": [ 0.296, -0.562, -0.773 ], "z_axis": [ -0.543, -0.764, 0.348 ], "quaternion": [ 0.006, -0.327, -0.468, 0.821 ] } }, { "index": 461, "index_chain": 140, "chain_name": "R", "nt_resnum": 140, "nt_name": "G", "nt_code": "G", "nt_id": "///R/140", "linked_nts": [ "///R/139", "///R/141" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.708, "beta": 164.907, "gamma": 52.628, "delta": 81.743, "epsilon": -152.495, "zeta": -77.235, "epsilon_zeta": -75.260, "bb_type": "BI", "chi": -163.317, "glyco_bond": "anti", "C5prime_xyz": [ -1.382, 8.718, 0.757 ], "P_xyz": [ 1.251, 8.983, 0.750 ], "form": "A", "ssZp": 4.543, "Dp": 4.663, "splay_angle": 19.928, "splay_distance": 3.086, "splay_ratio": 0.174, "d22": null, "d64": null, "eta": 166.631, "theta": -149.372, "eta_prime": -177.827, "theta_prime": -148.398, "eta_base": -127.471, "theta_base": -126.638, "v0": 7.699, "v1": -30.017, "v2": 39.939, "v3": -36.365, "v4": 18.140, "amplitude": 40.310, "phase_angle": 7.778, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.897, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 5.048, -28.419, 72.333 ], "x_axis": [ -0.390, -0.015, -0.921 ], "y_axis": [ 0.610, -0.754, -0.246 ], "z_axis": [ -0.690, -0.657, 0.303 ], "quaternion": [ -0.200, -0.515, -0.289, 0.782 ] } }, { "index": 462, "index_chain": 141, "chain_name": "R", "nt_resnum": 141, "nt_name": "A", "nt_code": "A", "nt_id": "///R/141", "linked_nts": [ "///R/140", null ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -68.625, "beta": 178.199, "gamma": 58.282, "delta": 86.972, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -145.778, "glyco_bond": "anti", "C5prime_xyz": [ -1.178, 8.709, -0.293 ], "P_xyz": [ 1.440, 8.889, -0.575 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 7.241, "v1": -27.390, "v2": 35.802, "v3": -32.308, "v4": 16.026, "amplitude": 36.078, "phase_angle": 7.088, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.861, "filter_rmsd": 0.040, "frame": { "rmsd": 0.010, "origin": [ 2.155, -29.278, 72.976 ], "x_axis": [ -0.022, -0.415, -0.910 ], "y_axis": [ 0.518, -0.783, 0.345 ], "z_axis": [ -0.855, -0.464, 0.232 ], "quaternion": [ -0.327, -0.618, -0.042, 0.714 ] } }, { "index": 463, "index_chain": 1, "chain_name": "H", "nt_resnum": -1, "nt_name": "A", "nt_code": "A", "nt_id": "///H/-1", "linked_nts": [ null, "///H/0" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor", "alpha": null, "beta": null, "gamma": 11.069, "delta": 92.088, "epsilon": -139.360, "zeta": 109.681, "epsilon_zeta": 110.960, "bb_type": "--", "chi": -105.357, "glyco_bond": "anti", "C5prime_xyz": [ -4.067, 7.234, -2.654 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 1.472, "Dp": 2.507, "splay_angle": 84.861, "splay_distance": 13.548, "splay_ratio": 0.675, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -50.685, "v1": 29.430, "v2": 0.480, "v3": -28.984, "v4": 48.016, "amplitude": 51.052, "phase_angle": 89.461, "puckering": "O4'-endo", "sugar_class": "--", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.017, "origin": [ 24.111, 24.015, 72.419 ], "x_axis": [ 0.819, -0.031, -0.572 ], "y_axis": [ 0.529, -0.345, 0.776 ], "z_axis": [ -0.221, -0.938, -0.266 ], "quaternion": [ 0.550, 0.779, 0.160, -0.254 ] } }, { "index": 464, "index_chain": 2, "chain_name": "H", "nt_resnum": 0, "nt_name": "A2M", "nt_code": "a", "is_modified": true, "nt_id": "///H/0", "linked_nts": [ "///H/-1", "///H/1" ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,splayed-apart", "alpha": -30.667, "beta": 149.361, "gamma": 27.820, "delta": 146.143, "epsilon": -174.214, "zeta": 135.937, "epsilon_zeta": 49.848, "bb_type": "--", "chi": -125.345, "glyco_bond": "anti", "C5prime_xyz": [ -2.383, 8.719, -0.870 ], "P_xyz": [ -0.108, 9.687, 0.142 ], "form": ".", "ssZp": 2.219, "Dp": 2.508, "splay_angle": 112.493, "splay_distance": 14.513, "splay_ratio": 0.831, "d22": null, "d64": null, "eta": -177.543, "theta": 122.494, "eta_prime": -148.722, "theta_prime": 90.840, "eta_base": -149.703, "theta_base": 147.465, "v0": -29.245, "v1": 42.025, "v2": -38.589, "v3": 22.380, "v4": 4.266, "amplitude": 42.278, "phase_angle": 155.888, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.051, "origin": [ 15.020, 22.261, 82.309 ], "x_axis": [ -0.172, -0.429, -0.887 ], "y_axis": [ 0.965, -0.255, -0.063 ], "z_axis": [ -0.199, -0.866, 0.458 ], "quaternion": [ 0.508, 0.396, 0.339, -0.686 ] } }, { "index": 465, "index_chain": 3, "chain_name": "H", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///H/1", "linked_nts": [ "///H/0", "///H/2" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,phosphate,splayed-apart", "alpha": -47.899, "beta": 122.143, "gamma": 168.982, "delta": 141.529, "epsilon": -86.600, "zeta": 94.580, "epsilon_zeta": 178.820, "bb_type": "--", "chi": -68.869, "glyco_bond": "--", "C5prime_xyz": [ -3.015, 6.609, -3.212 ], "P_xyz": [ -3.747, 5.525, -5.449 ], "form": ".", "ssZp": -0.342, "Dp": 0.684, "splay_angle": 43.289, "splay_distance": 7.829, "splay_ratio": 0.370, "d22": null, "d64": null, "eta": -8.220, "theta": 63.005, "eta_prime": -36.727, "theta_prime": 52.417, "eta_base": -105.160, "theta_base": 60.141, "v0": -20.885, "v1": 32.345, "v2": -30.973, "v3": 19.872, "v4": 0.443, "amplitude": 32.862, "phase_angle": 160.476, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.018, "frame": { "rmsd": 0.018, "origin": [ 21.095, 26.681, 94.726 ], "x_axis": [ 0.234, -0.381, 0.895 ], "y_axis": [ 0.801, -0.447, -0.399 ], "z_axis": [ 0.552, 0.810, 0.200 ], "quaternion": [ -0.497, 0.608, 0.173, 0.594 ] } }, { "index": 466, "index_chain": 4, "chain_name": "H", "nt_resnum": 2, "nt_name": "C", "nt_code": "C", "nt_id": "///H/2", "linked_nts": [ "///H/1", "///H/3" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor,phosphate", "alpha": 42.210, "beta": 177.185, "gamma": -160.066, "delta": 82.448, "epsilon": -158.721, "zeta": -68.781, "epsilon_zeta": -89.940, "bb_type": "BI", "chi": -169.812, "glyco_bond": "anti", "C5prime_xyz": [ -1.197, 8.530, 1.205 ], "P_xyz": [ -0.473, 10.874, 0.467 ], "form": "A", "ssZp": 4.578, "Dp": 4.617, "splay_angle": 25.459, "splay_distance": 3.925, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 128.674, "theta": 165.605, "eta_prime": 106.587, "theta_prime": -179.150, "eta_base": 121.172, "theta_base": -151.674, "v0": 8.397, "v1": -31.989, "v2": 41.429, "v3": -37.429, "v4": 18.680, "amplitude": 41.743, "phase_angle": 7.030, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "6n", "suiteness": 0.146, "filter_rmsd": 0.065, "frame": { "rmsd": 0.007, "origin": [ 15.904, 26.802, 88.867 ], "x_axis": [ 0.227, 0.023, 0.974 ], "y_axis": [ 0.952, -0.216, -0.217 ], "z_axis": [ 0.205, 0.976, -0.071 ], "quaternion": [ -0.485, 0.615, 0.396, 0.479 ] } }, { "index": 467, "index_chain": 5, "chain_name": "H", "nt_resnum": 3, "nt_name": "G", "nt_code": "G", "nt_id": "///H/3", "linked_nts": [ "///H/2", "///H/4" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -81.562, "beta": -167.927, "gamma": 54.633, "delta": 82.026, "epsilon": -154.454, "zeta": -68.497, "epsilon_zeta": -85.957, "bb_type": "BI", "chi": -161.266, "glyco_bond": "anti", "C5prime_xyz": [ -1.235, 8.634, 0.682 ], "P_xyz": [ 1.303, 8.868, 1.308 ], "form": "A", "ssZp": 4.434, "Dp": 4.614, "splay_angle": 22.456, "splay_distance": 3.545, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 170.305, "theta": -145.551, "eta_prime": -179.759, "theta_prime": -142.140, "eta_base": -151.914, "theta_base": -113.034, "v0": 12.165, "v1": -34.039, "v2": 42.044, "v3": -35.953, "v4": 15.262, "amplitude": 42.075, "phase_angle": 2.218, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.668, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 14.867, 30.587, 88.907 ], "x_axis": [ 0.626, -0.254, 0.737 ], "y_axis": [ 0.714, -0.195, -0.673 ], "z_axis": [ 0.314, 0.947, 0.059 ], "quaternion": [ 0.610, -0.664, -0.173, -0.396 ] } }, { "index": 468, "index_chain": 6, "chain_name": "H", "nt_resnum": 4, "nt_name": "C", "nt_code": "C", "nt_id": "///H/4", "linked_nts": [ "///H/3", "///H/5" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.389, "beta": 169.524, "gamma": 60.137, "delta": 83.031, "epsilon": -144.385, "zeta": -69.145, "epsilon_zeta": -75.240, "bb_type": "BI", "chi": -160.090, "glyco_bond": "anti", "C5prime_xyz": [ -1.460, 8.857, 0.566 ], "P_xyz": [ 1.169, 9.145, 0.759 ], "form": "A", "ssZp": 4.195, "Dp": 4.457, "splay_angle": 19.172, "splay_distance": 3.248, "splay_ratio": 0.169, "d22": 4.418, "d64": 4.351, "eta": 176.911, "theta": -137.175, "eta_prime": -166.847, "theta_prime": -130.861, "eta_base": -125.149, "theta_base": -124.252, "v0": 3.027, "v1": -25.213, "v2": 37.276, "v3": -36.234, "v4": 20.873, "amplitude": 38.438, "phase_angle": 14.124, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.898, "filter_rmsd": 0.074, "frame": { "rmsd": 0.014, "origin": [ 15.611, 33.586, 90.645 ], "x_axis": [ 0.914, -0.322, 0.248 ], "y_axis": [ 0.272, 0.028, -0.962 ], "z_axis": [ 0.303, 0.946, 0.113 ], "quaternion": [ 0.717, -0.666, 0.019, -0.207 ] } }, { "index": 469, "index_chain": 7, "chain_name": "H", "nt_resnum": 5, "nt_name": "C", "nt_code": "C", "nt_id": "///H/5", "linked_nts": [ "///H/4", "///H/6" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge", "alpha": -63.236, "beta": -178.894, "gamma": 64.974, "delta": 143.347, "epsilon": -133.134, "zeta": -174.642, "epsilon_zeta": 41.508, "bb_type": "BII", "chi": -111.447, "glyco_bond": "anti", "C5prime_xyz": [ -2.550, 8.515, -1.643 ], "P_xyz": [ -0.277, 9.778, -1.464 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -174.231, "theta": -167.438, "eta_prime": -143.373, "theta_prime": 152.060, "eta_base": -132.611, "theta_base": null, "v0": -32.119, "v1": 44.914, "v2": -40.592, "v3": 23.356, "v4": 5.408, "amplitude": 44.903, "phase_angle": 154.688, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.907, "filter_rmsd": 0.070, "frame": { "rmsd": 0.011, "origin": [ 16.526, 36.127, 92.450 ], "x_axis": [ 0.833, -0.527, -0.166 ], "y_axis": [ 0.052, 0.374, -0.926 ], "z_axis": [ 0.550, 0.763, 0.339 ], "quaternion": [ 0.798, -0.529, 0.225, -0.181 ] } }, { "index": 470, "index_chain": 8, "chain_name": "H", "nt_resnum": 6, "nt_name": "A", "nt_code": "A", "nt_id": "///H/6", "linked_nts": [ "///H/5", "///H/7" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-stack,bulge,phosphate", "alpha": 51.983, "beta": -152.113, "gamma": -151.247, "delta": 79.446, "epsilon": -126.020, "zeta": -48.440, "epsilon_zeta": -77.581, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": 139.157, "theta": -146.153, "eta_prime": 119.016, "theta_prime": -132.281, "eta_base": null, "theta_base": null, "v0": -3.224, "v1": -21.056, "v2": 35.967, "v3": -38.454, "v4": 26.668, "amplitude": 39.111, "phase_angle": 23.133, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "4n", "suiteness": 0.381, "filter_rmsd": null }, { "index": 471, "index_chain": 9, "chain_name": "H", "nt_resnum": 7, "nt_name": "G", "nt_code": "G", "nt_id": "///H/7", "linked_nts": [ "///H/6", "///H/8" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,junction-loop", "alpha": -76.765, "beta": -177.354, "gamma": 59.978, "delta": 80.226, "epsilon": -130.668, "zeta": -73.252, "epsilon_zeta": -57.416, "bb_type": "BI", "chi": 177.895, "glyco_bond": "anti", "C5prime_xyz": [ -1.530, 8.407, 1.814 ], "P_xyz": [ 0.907, 8.705, 2.670 ], "form": ".", "ssZp": 4.795, "Dp": 4.774, "splay_angle": 29.314, "splay_distance": 4.400, "splay_ratio": 0.253, "d22": null, "d64": null, "eta": 167.558, "theta": -128.281, "eta_prime": -164.126, "theta_prime": -122.324, "eta_base": null, "theta_base": -62.854, "v0": 6.199, "v1": -29.249, "v2": 39.672, "v3": -37.199, "v4": 19.862, "amplitude": 40.289, "phase_angle": 10.038, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.471, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 18.632, 40.240, 95.772 ], "x_axis": [ 0.250, -0.088, -0.964 ], "y_axis": [ -0.889, 0.373, -0.265 ], "z_axis": [ 0.383, 0.924, 0.015 ], "quaternion": [ 0.640, -0.464, 0.526, 0.313 ] } }, { "index": 472, "index_chain": 10, "chain_name": "H", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///H/8", "linked_nts": [ "///H/7", "///H/9" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop", "alpha": -46.332, "beta": 162.741, "gamma": 34.001, "delta": 88.009, "epsilon": -123.682, "zeta": -101.861, "epsilon_zeta": -21.821, "bb_type": "--", "chi": -164.262, "glyco_bond": "anti", "C5prime_xyz": [ -0.969, 8.537, 0.728 ], "P_xyz": [ 1.683, 8.498, 1.075 ], "form": "A", "ssZp": 4.468, "Dp": 4.786, "splay_angle": 22.024, "splay_distance": 3.405, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 165.766, "theta": -143.079, "eta_prime": -172.443, "theta_prime": -137.036, "eta_base": -94.704, "theta_base": -106.871, "v0": 11.233, "v1": -30.932, "v2": 38.231, "v3": -32.381, "v4": 13.459, "amplitude": 38.249, "phase_angle": 1.789, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.279, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ 19.823, 43.063, 92.614 ], "x_axis": [ -0.643, 0.314, -0.699 ], "y_axis": [ -0.618, 0.327, 0.715 ], "z_axis": [ 0.453, 0.891, -0.017 ], "quaternion": [ 0.409, -0.108, 0.705, 0.570 ] } }, { "index": 473, "index_chain": 11, "chain_name": "H", "nt_resnum": 9, "nt_name": "A", "nt_code": "A", "nt_id": "///H/9", "linked_nts": [ "///H/8", "///H/10" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -46.474, "beta": 139.172, "gamma": 53.137, "delta": 80.240, "epsilon": -143.341, "zeta": -73.033, "epsilon_zeta": -70.307, "bb_type": "BI", "chi": -164.155, "glyco_bond": "anti", "C5prime_xyz": [ -1.579, 8.707, 0.736 ], "P_xyz": [ 1.041, 8.720, 0.410 ], "form": "A", "ssZp": 4.456, "Dp": 4.641, "splay_angle": 25.666, "splay_distance": 4.059, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 165.791, "theta": -132.191, "eta_prime": -175.590, "theta_prime": -136.553, "eta_base": -130.673, "theta_base": -104.396, "v0": 2.752, "v1": -27.124, "v2": 39.707, "v3": -39.108, "v4": 23.070, "amplitude": 41.071, "phase_angle": 14.806, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.767, "filter_rmsd": 0.033, "frame": { "rmsd": 0.012, "origin": [ 20.773, 46.089, 91.375 ], "x_axis": [ -0.928, 0.309, -0.209 ], "y_axis": [ -0.141, 0.227, 0.964 ], "z_axis": [ 0.345, 0.924, -0.167 ], "quaternion": [ 0.182, 0.055, 0.762, 0.619 ] } }, { "index": 474, "index_chain": 12, "chain_name": "H", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///H/10", "linked_nts": [ "///H/9", "///H/11" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper", "alpha": -58.088, "beta": 172.446, "gamma": 43.311, "delta": 78.778, "epsilon": -154.769, "zeta": -72.805, "epsilon_zeta": -81.964, "bb_type": "BI", "chi": -163.571, "glyco_bond": "anti", "C5prime_xyz": [ -1.329, 8.746, 0.765 ], "P_xyz": [ 1.274, 9.114, 1.187 ], "form": "A", "ssZp": 4.545, "Dp": 4.661, "splay_angle": 24.033, "splay_distance": 3.823, "splay_ratio": 0.212, "d22": 4.450, "d64": 4.736, "eta": 162.703, "theta": -153.917, "eta_prime": 177.766, "theta_prime": -150.997, "eta_base": -127.672, "theta_base": -137.141, "v0": 7.130, "v1": -31.259, "v2": 42.264, "v3": -39.299, "v4": 20.337, "amplitude": 42.824, "phase_angle": 9.277, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.786, "filter_rmsd": 0.066, "frame": { "rmsd": 0.007, "origin": [ 20.167, 49.781, 89.800 ], "x_axis": [ -0.836, 0.162, 0.524 ], "y_axis": [ 0.527, -0.029, 0.849 ], "z_axis": [ 0.152, 0.986, -0.061 ], "quaternion": [ -0.136, 0.252, 0.683, 0.671 ] } }, { "index": 475, "index_chain": 13, "chain_name": "H", "nt_resnum": 11, "nt_name": "U", "nt_code": "U", "nt_id": "///H/11", "linked_nts": [ "///H/10", null ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,ribose-zipper", "alpha": -75.595, "beta": 173.322, "gamma": 71.908, "delta": 85.492, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -166.645, "glyco_bond": "anti", "C5prime_xyz": [ -1.648, 8.727, 0.898 ], "P_xyz": [ 0.894, 9.286, 1.002 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -1.426, "v1": -20.042, "v2": 32.299, "v3": -33.769, "v4": 22.622, "amplitude": 34.553, "phase_angle": 20.807, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.432, "filter_rmsd": 0.111, "frame": { "rmsd": 0.011, "origin": [ 19.645, 53.031, 87.855 ], "x_axis": [ -0.575, -0.005, 0.818 ], "y_axis": [ 0.817, -0.043, 0.575 ], "z_axis": [ 0.032, 0.999, 0.028 ], "quaternion": [ -0.320, 0.331, 0.613, 0.642 ] } }, { "index": 476, "index_chain": 1, "chain_name": "S", "nt_resnum": 12, "nt_name": "GTP", "nt_code": "g", "is_modified": true, "nt_id": "///S/12", "linked_nts": [ null, "///S/13" ], "nt_type": "RNA", "dbn": "(", "summary": "modified,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": -39.478, "delta": 95.687, "epsilon": -157.642, "zeta": -60.788, "epsilon_zeta": -96.854, "bb_type": "BI", "chi": -177.217, "glyco_bond": "anti", "C5prime_xyz": [ -1.108, 8.196, 1.491 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.677, "Dp": 4.652, "splay_angle": 23.092, "splay_distance": 3.593, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 15.849, "v1": -29.494, "v2": 31.657, "v3": -22.834, "v4": 4.464, "amplitude": 32.196, "phase_angle": 349.508, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.060, "frame": { "rmsd": 0.060, "origin": [ 17.123, 55.842, 86.906 ], "x_axis": [ -0.098, -0.070, 0.993 ], "y_axis": [ 0.991, 0.080, 0.103 ], "z_axis": [ -0.086, 0.994, 0.062 ], "quaternion": [ 0.511, -0.436, -0.528, -0.520 ] } }, { "index": 477, "index_chain": 2, "chain_name": "S", "nt_resnum": 13, "nt_name": "G", "nt_code": "G", "nt_id": "///S/13", "linked_nts": [ "///S/12", "///S/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -76.621, "beta": 179.577, "gamma": 49.808, "delta": 77.073, "epsilon": -170.504, "zeta": -73.526, "epsilon_zeta": -96.978, "bb_type": "BI", "chi": -160.115, "glyco_bond": "anti", "C5prime_xyz": [ -1.162, 8.685, 0.595 ], "P_xyz": [ 1.420, 9.010, 0.852 ], "form": "A", "ssZp": 4.439, "Dp": 4.570, "splay_angle": 21.729, "splay_distance": 3.388, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 159.959, "theta": -138.147, "eta_prime": 177.869, "theta_prime": -140.109, "eta_base": -133.950, "theta_base": -104.666, "v0": 12.689, "v1": -37.354, "v2": 46.724, "v3": -40.369, "v4": 17.683, "amplitude": 46.796, "phase_angle": 3.188, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.436, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 15.012, 58.576, 87.895 ], "x_axis": [ 0.548, 0.067, 0.833 ], "y_axis": [ 0.813, 0.190, -0.550 ], "z_axis": [ -0.196, 0.979, 0.050 ], "quaternion": [ 0.669, -0.572, -0.385, -0.279 ] } }, { "index": 478, "index_chain": 3, "chain_name": "S", "nt_resnum": 14, "nt_name": "C", "nt_code": "C", "nt_id": "///S/14", "linked_nts": [ "///S/13", "///S/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 179.697, "beta": -150.793, "gamma": 146.410, "delta": 84.492, "epsilon": -114.773, "zeta": -146.571, "epsilon_zeta": 31.799, "bb_type": "--", "chi": -163.944, "glyco_bond": "anti", "C5prime_xyz": [ -0.878, 8.499, 0.859 ], "P_xyz": [ 1.193, 9.047, -0.692 ], "form": "A", "ssZp": 4.418, "Dp": 4.817, "splay_angle": 22.050, "splay_distance": 3.470, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 170.373, "theta": -149.743, "eta_prime": -173.612, "theta_prime": -154.284, "eta_base": -120.959, "theta_base": -158.269, "v0": 17.677, "v1": -37.280, "v2": 42.399, "v3": -33.469, "v4": 9.965, "amplitude": 42.564, "phase_angle": 354.953, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.067, "frame": { "rmsd": 0.008, "origin": [ 14.561, 61.111, 90.098 ], "x_axis": [ 0.863, 0.348, 0.366 ], "y_axis": [ 0.246, 0.343, -0.907 ], "z_axis": [ -0.441, 0.873, 0.210 ], "quaternion": [ 0.777, -0.572, -0.259, 0.033 ] } }, { "index": 479, "index_chain": 4, "chain_name": "S", "nt_resnum": 15, "nt_name": "A", "nt_code": "A", "nt_id": "///S/15", "linked_nts": [ "///S/14", "///S/16" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 130.997, "beta": -95.795, "gamma": 149.010, "delta": 61.640, "epsilon": -130.538, "zeta": -76.767, "epsilon_zeta": -53.771, "bb_type": "BI", "chi": -166.733, "glyco_bond": "anti", "C5prime_xyz": [ -1.728, 8.841, 0.997 ], "P_xyz": [ 0.179, 9.124, -0.789 ], "form": "A", "ssZp": 4.408, "Dp": 4.734, "splay_angle": 27.108, "splay_distance": 4.293, "splay_ratio": 0.239, "d22": null, "d64": null, "eta": 146.055, "theta": -143.138, "eta_prime": 160.697, "theta_prime": -150.581, "eta_base": 171.690, "theta_base": -121.807, "v0": -0.228, "v1": -30.044, "v2": 48.171, "v3": -49.752, "v4": 30.952, "amplitude": 50.930, "phase_angle": 18.944, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.007, "origin": [ 12.373, 63.154, 91.853 ], "x_axis": [ 0.986, 0.147, 0.077 ], "y_axis": [ -0.001, 0.474, -0.881 ], "z_axis": [ -0.166, 0.868, 0.467 ], "quaternion": [ 0.855, -0.511, -0.071, 0.043 ] } }, { "index": 480, "index_chain": 5, "chain_name": "S", "nt_resnum": 16, "nt_name": "C", "nt_code": "C", "nt_id": "///S/16", "linked_nts": [ "///S/15", "///S/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -42.390, "beta": -175.647, "gamma": 29.938, "delta": 80.782, "epsilon": -160.247, "zeta": -60.237, "epsilon_zeta": -100.010, "bb_type": "BI", "chi": -157.701, "glyco_bond": "anti", "C5prime_xyz": [ -1.016, 8.695, 0.423 ], "P_xyz": [ 1.497, 9.237, 1.027 ], "form": "A", "ssZp": 4.480, "Dp": 4.691, "splay_angle": 26.618, "splay_distance": 4.126, "splay_ratio": 0.231, "d22": 3.920, "d64": 4.058, "eta": 171.980, "theta": -148.124, "eta_prime": -179.840, "theta_prime": -141.317, "eta_base": -133.754, "theta_base": -107.825, "v0": 12.652, "v1": -34.532, "v2": 41.863, "v3": -35.837, "v4": 14.813, "amplitude": 41.878, "phase_angle": 1.541, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.015, "filter_rmsd": 0.070, "frame": { "rmsd": 0.009, "origin": [ 14.448, 65.830, 94.492 ], "x_axis": [ 0.735, 0.058, -0.675 ], "y_axis": [ -0.649, 0.344, -0.678 ], "z_axis": [ 0.193, 0.937, 0.291 ], "quaternion": [ 0.770, -0.524, 0.282, 0.230 ] } }, { "index": 481, "index_chain": 6, "chain_name": "S", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///S/17", "linked_nts": [ "///S/16", "///S/17" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop", "alpha": -88.140, "beta": -171.981, "gamma": 62.549, "delta": 77.395, "epsilon": -136.743, "zeta": -75.265, "epsilon_zeta": -61.478, "bb_type": "BI", "chi": -166.518, "glyco_bond": "anti", "C5prime_xyz": [ -1.429, 8.726, 0.955 ], "P_xyz": [ 1.180, 8.935, 1.293 ], "form": "A", "ssZp": 4.604, "Dp": 4.782, "splay_angle": 25.089, "splay_distance": 3.807, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 168.289, "theta": -139.269, "eta_prime": -178.251, "theta_prime": -135.710, "eta_base": -135.055, "theta_base": -92.390, "v0": 10.945, "v1": -36.013, "v2": 46.204, "v3": -40.626, "v4": 18.998, "amplitude": 46.386, "phase_angle": 5.090, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.464, "filter_rmsd": 0.075, "frame": { "rmsd": 0.016, "origin": [ 17.068, 68.986, 94.934 ], "x_axis": [ 0.139, -0.035, -0.990 ], "y_axis": [ -0.960, 0.242, -0.143 ], "z_axis": [ 0.245, 0.970, 0.000 ], "quaternion": [ 0.588, -0.473, 0.525, 0.394 ] } }, { "index": 482, "index_chain": 7, "chain_name": "S", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///S/17", "linked_nts": [ "///S/17", "///S/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -60.758, "beta": 164.826, "gamma": 54.652, "delta": 81.916, "epsilon": -144.490, "zeta": -68.519, "epsilon_zeta": -75.972, "bb_type": "BI", "chi": -165.380, "glyco_bond": "anti", "C5prime_xyz": [ -1.135, 8.514, 0.874 ], "P_xyz": [ 1.478, 8.600, 0.731 ], "form": "A", "ssZp": 4.579, "Dp": 4.720, "splay_angle": 21.810, "splay_distance": 3.555, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 165.188, "theta": -132.493, "eta_prime": -177.411, "theta_prime": -131.506, "eta_base": -114.709, "theta_base": -102.024, "v0": 12.031, "v1": -35.187, "v2": 43.639, "v3": -37.928, "v4": 16.381, "amplitude": 43.700, "phase_angle": 3.022, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.872, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 18.257, 71.858, 92.737 ], "x_axis": [ -0.592, 0.087, -0.801 ], "y_axis": [ -0.752, 0.297, 0.588 ], "z_axis": [ 0.289, 0.951, -0.111 ], "quaternion": [ 0.385, -0.235, 0.707, 0.544 ] } }, { "index": 483, "index_chain": 8, "chain_name": "S", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///S/17", "linked_nts": [ "///S/17", "///S/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop", "alpha": -56.815, "beta": 176.183, "gamma": 51.319, "delta": 74.949, "epsilon": -145.565, "zeta": -68.390, "epsilon_zeta": -77.175, "bb_type": "BI", "chi": -145.369, "glyco_bond": "anti", "C5prime_xyz": [ -1.704, 8.894, -0.335 ], "P_xyz": [ 0.865, 9.465, -0.475 ], "form": ".", "ssZp": 3.811, "Dp": 4.626, "splay_angle": 57.868, "splay_distance": 9.407, "splay_ratio": 0.485, "d22": 5.882, "d64": 7.111, "eta": 173.666, "theta": -151.699, "eta_prime": -170.155, "theta_prime": -137.419, "eta_base": -123.984, "theta_base": -128.025, "v0": -0.353, "v1": -27.084, "v2": 42.702, "v3": -44.030, "v4": 27.907, "amplitude": 45.157, "phase_angle": 18.982, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.856, "filter_rmsd": 0.107, "frame": { "rmsd": 0.009, "origin": [ 18.694, 73.983, 89.920 ], "x_axis": [ -0.911, 0.262, -0.320 ], "y_axis": [ -0.181, 0.442, 0.879 ], "z_axis": [ 0.371, 0.858, -0.355 ], "quaternion": [ 0.210, 0.024, 0.823, 0.528 ] } }, { "index": 484, "index_chain": 9, "chain_name": "S", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///S/17", "linked_nts": [ "///S/17", "///S/17" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor", "alpha": -65.571, "beta": -127.833, "gamma": 51.554, "delta": 143.321, "epsilon": -82.574, "zeta": 70.139, "epsilon_zeta": 207.286, "bb_type": "--", "chi": -132.330, "glyco_bond": "anti", "C5prime_xyz": [ -2.107, 8.733, -0.758 ], "P_xyz": [ -0.859, 9.956, 1.207 ], "form": ".", "ssZp": 0.408, "Dp": 0.640, "splay_angle": 34.003, "splay_distance": 5.563, "splay_ratio": 0.312, "d22": null, "d64": null, "eta": -133.004, "theta": 95.791, "eta_prime": -126.894, "theta_prime": 78.872, "eta_base": -131.610, "theta_base": 69.474, "v0": -32.232, "v1": 44.439, "v2": -38.819, "v3": 21.798, "v4": 6.139, "amplitude": 43.588, "phase_angle": 152.948, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.796, "filter_rmsd": 0.105, "frame": { "rmsd": 0.009, "origin": [ 20.086, 82.714, 86.708 ], "x_axis": [ -0.815, -0.548, -0.187 ], "y_axis": [ 0.038, -0.374, 0.927 ], "z_axis": [ -0.578, 0.749, 0.326 ], "quaternion": [ -0.185, -0.241, 0.528, 0.793 ] } }, { "index": 485, "index_chain": 10, "chain_name": "S", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///S/17", "linked_nts": [ "///S/17", "///S/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,cap-acceptor", "alpha": -136.347, "beta": 166.170, "gamma": 69.186, "delta": 84.647, "epsilon": -118.785, "zeta": -123.585, "epsilon_zeta": 4.800, "bb_type": "--", "chi": -94.712, "glyco_bond": "anti", "C5prime_xyz": [ -2.155, 7.482, -2.850 ], "P_xyz": [ -0.369, 6.443, -4.577 ], "form": ".", "ssZp": 0.009, "Dp": 4.749, "splay_angle": 80.667, "splay_distance": 10.912, "splay_ratio": 0.670, "d22": null, "d64": null, "eta": 144.338, "theta": -132.369, "eta_prime": 152.558, "theta_prime": -126.935, "eta_base": 144.389, "theta_base": -78.776, "v0": 12.658, "v1": -32.399, "v2": 39.491, "v3": -33.247, "v4": 12.882, "amplitude": 39.492, "phase_angle": 0.505, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6g", "suiteness": 0.447, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 22.838, 78.700, 89.402 ], "x_axis": [ 0.315, 0.617, -0.721 ], "y_axis": [ 0.779, 0.266, 0.568 ], "z_axis": [ 0.543, -0.741, -0.396 ], "quaternion": [ 0.544, 0.601, 0.580, -0.074 ] } }, { "index": 486, "index_chain": 11, "chain_name": "S", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///S/17", "linked_nts": [ "///S/17", "///S/17" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,non-pair-contact,hairpin-loop", "alpha": 69.161, "beta": 150.969, "gamma": 15.219, "delta": 138.613, "epsilon": -142.620, "zeta": 149.439, "epsilon_zeta": 67.941, "bb_type": "--", "chi": 42.128, "glyco_bond": "syn", "C5prime_xyz": [ -5.583, 3.901, 0.334 ], "P_xyz": [ -5.899, 1.754, -1.199 ], "form": ".", "ssZp": -1.953, "Dp": 1.953, "splay_angle": 81.187, "splay_distance": 12.323, "splay_ratio": 0.652, "d22": null, "d64": null, "eta": -119.383, "theta": 133.734, "eta_prime": -106.767, "theta_prime": 120.092, "eta_base": -124.646, "theta_base": 146.516, "v0": -22.001, "v1": 33.666, "v2": -32.451, "v3": 20.639, "v4": 0.706, "amplitude": 34.465, "phase_angle": 160.313, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.010, "origin": [ 31.333, 85.283, 91.291 ], "x_axis": [ 0.475, 0.668, -0.573 ], "y_axis": [ 0.810, -0.586, -0.011 ], "z_axis": [ -0.343, -0.459, -0.820 ], "quaternion": [ 0.132, 0.849, 0.435, -0.270 ] } }, { "index": 487, "index_chain": 12, "chain_name": "S", "nt_resnum": 17, "nt_name": "A", "nt_code": "A", "nt_id": "///S/17", "linked_nts": [ "///S/17", "///S/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate", "alpha": -65.368, "beta": 120.733, "gamma": 63.720, "delta": 76.723, "epsilon": -140.752, "zeta": -74.667, "epsilon_zeta": -66.086, "bb_type": "BI", "chi": -174.842, "glyco_bond": "anti", "C5prime_xyz": [ -1.810, 8.683, 1.262 ], "P_xyz": [ 0.741, 8.847, 0.606 ], "form": "A", "ssZp": 4.625, "Dp": 4.672, "splay_angle": 28.449, "splay_distance": 4.354, "splay_ratio": 0.246, "d22": null, "d64": null, "eta": 175.163, "theta": -134.080, "eta_prime": 176.784, "theta_prime": -135.994, "eta_base": -150.345, "theta_base": -99.922, "v0": -0.557, "v1": -26.405, "v2": 41.480, "v3": -42.624, "v4": 27.547, "amplitude": 43.909, "phase_angle": 19.147, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "0a", "suiteness": 0.212, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 39.990, 77.202, 87.884 ], "x_axis": [ 0.508, 0.814, 0.280 ], "y_axis": [ -0.528, 0.038, 0.848 ], "z_axis": [ 0.680, -0.579, 0.449 ], "quaternion": [ 0.706, 0.505, 0.141, 0.475 ] } }, { "index": 488, "index_chain": 13, "chain_name": "S", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///S/17", "linked_nts": [ "///S/17", "///S/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,BII,non-pair-contact,hairpin-loop", "alpha": -67.371, "beta": -175.496, "gamma": 55.708, "delta": 107.947, "epsilon": -125.208, "zeta": 155.856, "epsilon_zeta": 78.936, "bb_type": "BII", "chi": -154.884, "glyco_bond": "anti", "C5prime_xyz": [ -1.274, 8.692, 0.426 ], "P_xyz": [ 1.215, 8.735, 1.310 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -173.745, "theta": 106.995, "eta_prime": -159.724, "theta_prime": 81.779, "eta_base": -112.407, "theta_base": null, "v0": 0.300, "v1": -6.767, "v2": 10.255, "v3": -10.346, "v4": 6.390, "amplitude": 10.726, "phase_angle": 17.032, "puckering": "C3'-endo", "sugar_class": "--", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ 43.765, 76.774, 90.012 ], "x_axis": [ -0.310, 0.714, 0.628 ], "y_axis": [ -0.726, -0.604, 0.329 ], "z_axis": [ 0.614, -0.354, 0.705 ], "quaternion": [ 0.445, 0.384, -0.008, 0.809 ] } }, { "index": 489, "index_chain": 14, "chain_name": "S", "nt_resnum": 17, "nt_name": "U", "nt_code": "U", "nt_id": "///S/17", "linked_nts": [ "///S/17", "///S/17" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-stack,hairpin-loop", "alpha": 153.485, "beta": 144.366, "gamma": -44.743, "delta": 89.467, "epsilon": -136.509, "zeta": -120.537, "epsilon_zeta": -15.972, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -28.597, "theta": 161.429, "eta_prime": -23.106, "theta_prime": 171.834, "eta_base": null, "theta_base": null, "v0": 12.186, "v1": -29.616, "v2": 34.710, "v3": -28.649, "v4": 10.622, "amplitude": 34.720, "phase_angle": 358.642, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null }, { "index": 490, "index_chain": 15, "chain_name": "S", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///S/17", "linked_nts": [ "///S/17", "///S/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -69.026, "beta": 149.560, "gamma": 57.517, "delta": 78.520, "epsilon": -153.060, "zeta": -61.430, "epsilon_zeta": -91.630, "bb_type": "BI", "chi": -169.553, "glyco_bond": "anti", "C5prime_xyz": [ -1.605, 8.825, 1.061 ], "P_xyz": [ 0.982, 9.328, 0.924 ], "form": ".", "ssZp": 4.572, "Dp": 4.595, "splay_angle": 22.400, "splay_distance": 3.393, "splay_ratio": 0.194, "d22": 4.490, "d64": 3.267, "eta": 165.883, "theta": -125.260, "eta_prime": 164.708, "theta_prime": -127.152, "eta_base": null, "theta_base": -59.363, "v0": 0.252, "v1": -24.688, "v2": 38.257, "v3": -39.157, "v4": 24.584, "amplitude": 40.280, "phase_angle": 18.239, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7a", "suiteness": 0.615, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 32.960, 59.737, 98.615 ], "x_axis": [ 0.674, 0.340, 0.656 ], "y_axis": [ 0.426, 0.547, -0.721 ], "z_axis": [ -0.604, 0.765, 0.224 ], "quaternion": [ 0.782, -0.475, -0.403, -0.027 ] } }, { "index": 491, "index_chain": 16, "chain_name": "S", "nt_resnum": 17, "nt_name": "C", "nt_code": "C", "nt_id": "///S/17", "linked_nts": [ "///S/17", "///S/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -131.699, "beta": -163.495, "gamma": 98.793, "delta": 91.786, "epsilon": -126.450, "zeta": -110.991, "epsilon_zeta": -15.458, "bb_type": "--", "chi": -130.238, "glyco_bond": "anti", "C5prime_xyz": [ -1.114, 8.574, -1.158 ], "P_xyz": [ 1.276, 8.264, -2.246 ], "form": ".", "ssZp": 2.844, "Dp": 4.547, "splay_angle": 156.415, "splay_distance": 19.181, "splay_ratio": 0.979, "d22": null, "d64": null, "eta": 165.528, "theta": -167.645, "eta_prime": -173.442, "theta_prime": 175.733, "eta_base": -91.448, "theta_base": 149.183, "v0": 7.143, "v1": -23.284, "v2": 29.594, "v3": -26.036, "v4": 12.180, "amplitude": 29.702, "phase_angle": 4.888, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.069, "frame": { "rmsd": 0.009, "origin": [ 34.332, 62.586, 99.847 ], "x_axis": [ 0.682, 0.706, -0.191 ], "y_axis": [ -0.629, 0.433, -0.646 ], "z_axis": [ -0.374, 0.560, 0.739 ], "quaternion": [ 0.845, -0.357, -0.054, 0.395 ] } }, { "index": 492, "index_chain": 17, "chain_name": "S", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///S/17", "linked_nts": [ "///S/17", "///S/18" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart", "alpha": -41.011, "beta": -154.696, "gamma": 149.712, "delta": 85.167, "epsilon": -133.147, "zeta": -80.591, "epsilon_zeta": -52.556, "bb_type": "BI", "chi": -171.606, "glyco_bond": "anti", "C5prime_xyz": [ -1.023, 8.380, 1.286 ], "P_xyz": [ 1.098, 9.349, 0.047 ], "form": "A", "ssZp": 4.708, "Dp": 4.789, "splay_angle": 24.309, "splay_distance": 3.926, "splay_ratio": 0.218, "d22": null, "d64": null, "eta": -33.130, "theta": -153.159, "eta_prime": -29.896, "theta_prime": -156.552, "eta_base": -13.212, "theta_base": -147.599, "v0": 17.096, "v1": -36.605, "v2": 41.638, "v3": -32.737, "v4": 9.901, "amplitude": 41.793, "phase_angle": 355.066, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 16.689, 68.718, 95.482 ], "x_axis": [ 0.182, -0.037, -0.983 ], "y_axis": [ 0.966, -0.181, 0.185 ], "z_axis": [ -0.185, -0.983, 0.003 ], "quaternion": [ 0.501, 0.583, 0.398, -0.501 ] } }, { "index": 493, "index_chain": 18, "chain_name": "S", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///S/18", "linked_nts": [ "///S/17", "///S/19" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.017, "beta": 147.890, "gamma": 77.064, "delta": 75.575, "epsilon": -136.445, "zeta": -67.320, "epsilon_zeta": -69.125, "bb_type": "BI", "chi": 179.699, "glyco_bond": "anti", "C5prime_xyz": [ -1.802, 8.471, 1.730 ], "P_xyz": [ 0.631, 9.415, 1.305 ], "form": ".", "ssZp": 4.725, "Dp": 4.716, "splay_angle": 30.214, "splay_distance": 4.663, "splay_ratio": 0.266, "d22": null, "d64": null, "eta": 166.934, "theta": -137.693, "eta_prime": -178.129, "theta_prime": -137.930, "eta_base": -150.799, "theta_base": -95.691, "v0": 4.825, "v1": -29.566, "v2": 42.157, "v3": -40.542, "v4": 22.433, "amplitude": 43.167, "phase_angle": 12.424, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.171, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 13.791, 66.121, 94.957 ], "x_axis": [ 0.526, -0.043, -0.850 ], "y_axis": [ 0.830, -0.193, 0.523 ], "z_axis": [ -0.187, -0.980, -0.066 ], "quaternion": [ 0.563, 0.668, 0.295, -0.388 ] } }, { "index": 494, "index_chain": 19, "chain_name": "S", "nt_resnum": 19, "nt_name": "U", "nt_code": "U", "nt_id": "///S/19", "linked_nts": [ "///S/18", "///S/20" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -57.244, "beta": 177.005, "gamma": 47.623, "delta": 75.394, "epsilon": -161.217, "zeta": -97.101, "epsilon_zeta": -64.116, "bb_type": "BI", "chi": -170.452, "glyco_bond": "anti", "C5prime_xyz": [ -1.331, 8.590, 1.247 ], "P_xyz": [ 1.225, 8.970, 1.883 ], "form": "A", "ssZp": 4.669, "Dp": 4.683, "splay_angle": 17.741, "splay_distance": 2.782, "splay_ratio": 0.158, "d22": null, "d64": null, "eta": 168.706, "theta": -147.611, "eta_prime": -173.168, "theta_prime": -148.082, "eta_base": -108.379, "theta_base": -127.254, "v0": 12.306, "v1": -36.501, "v2": 45.466, "v3": -39.536, "v4": 17.325, "amplitude": 45.541, "phase_angle": 3.294, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.765, "filter_rmsd": 0.111, "frame": { "rmsd": 0.011, "origin": [ 14.086, 62.705, 91.796 ], "x_axis": [ 0.981, -0.136, -0.135 ], "y_axis": [ 0.133, -0.023, 0.991 ], "z_axis": [ -0.138, -0.990, -0.005 ], "quaternion": [ 0.699, 0.709, -0.001, -0.096 ] } }, { "index": 495, "index_chain": 20, "chain_name": "S", "nt_resnum": 20, "nt_name": "G", "nt_code": "G", "nt_id": "///S/20", "linked_nts": [ "///S/19", "///S/21" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 165.917, "beta": -131.676, "gamma": 147.495, "delta": 79.876, "epsilon": -131.599, "zeta": -76.759, "epsilon_zeta": -54.839, "bb_type": "BI", "chi": -178.877, "glyco_bond": "anti", "C5prime_xyz": [ -1.451, 8.427, 1.747 ], "P_xyz": [ 0.940, 9.024, 0.768 ], "form": "A", "ssZp": 4.728, "Dp": 4.737, "splay_angle": 20.927, "splay_distance": 3.301, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 162.920, "theta": -141.045, "eta_prime": 176.677, "theta_prime": -146.578, "eta_base": -148.572, "theta_base": -112.298, "v0": 8.557, "v1": -30.446, "v2": 39.686, "v3": -35.592, "v4": 17.172, "amplitude": 39.937, "phase_angle": 6.428, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 13.848, 60.562, 90.038 ], "x_axis": [ 0.923, -0.082, 0.376 ], "y_axis": [ -0.385, -0.152, 0.910 ], "z_axis": [ -0.017, -0.985, -0.172 ], "quaternion": [ 0.632, 0.749, -0.156, 0.120 ] } }, { "index": 496, "index_chain": 21, "chain_name": "S", "nt_resnum": 21, "nt_name": "C", "nt_code": "C", "nt_id": "///S/21", "linked_nts": [ "///S/20", "///S/22" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -52.395, "beta": 164.650, "gamma": 38.089, "delta": 78.883, "epsilon": -146.949, "zeta": -82.929, "epsilon_zeta": -64.020, "bb_type": "BI", "chi": -162.753, "glyco_bond": "anti", "C5prime_xyz": [ -1.123, 8.707, 0.659 ], "P_xyz": [ 1.495, 9.087, 0.604 ], "form": "A", "ssZp": 4.639, "Dp": 4.821, "splay_angle": 19.441, "splay_distance": 3.026, "splay_ratio": 0.172, "d22": 4.365, "d64": 4.410, "eta": 157.592, "theta": -154.841, "eta_prime": 174.327, "theta_prime": -152.913, "eta_base": -126.297, "theta_base": -133.201, "v0": 13.402, "v1": -38.274, "v2": 46.509, "v3": -40.027, "v4": 17.010, "amplitude": 46.542, "phase_angle": 2.145, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.498, "filter_rmsd": 0.068, "frame": { "rmsd": 0.010, "origin": [ 15.457, 57.850, 89.065 ], "x_axis": [ 0.455, -0.303, 0.837 ], "y_axis": [ -0.890, -0.181, 0.418 ], "z_axis": [ 0.024, -0.936, -0.352 ], "quaternion": [ 0.480, 0.705, -0.423, 0.306 ] } }, { "index": 497, "index_chain": 22, "chain_name": "S", "nt_resnum": 22, "nt_name": "C", "nt_code": "C", "nt_id": "///S/22", "linked_nts": [ "///S/21", "///S/23" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -50.757, "beta": 160.504, "gamma": 49.534, "delta": 76.251, "epsilon": -149.035, "zeta": -67.052, "epsilon_zeta": -81.983, "bb_type": "BI", "chi": -157.661, "glyco_bond": "anti", "C5prime_xyz": [ -1.124, 8.751, 0.418 ], "P_xyz": [ 1.488, 8.964, 0.072 ], "form": "A", "ssZp": 4.399, "Dp": 4.743, "splay_angle": 23.761, "splay_distance": 3.723, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 170.723, "theta": -145.446, "eta_prime": -178.094, "theta_prime": -145.477, "eta_base": -145.462, "theta_base": -124.068, "v0": 10.732, "v1": -34.985, "v2": 44.668, "v3": -39.642, "v4": 18.544, "amplitude": 44.852, "phase_angle": 5.183, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.710, "filter_rmsd": 0.067, "frame": { "rmsd": 0.006, "origin": [ 17.231, 55.638, 88.008 ], "x_axis": [ 0.002, -0.338, 0.941 ], "y_axis": [ -0.966, -0.244, -0.086 ], "z_axis": [ 0.259, -0.909, -0.327 ], "quaternion": [ 0.328, 0.627, -0.520, 0.478 ] } }, { "index": 498, "index_chain": 23, "chain_name": "S", "nt_resnum": 23, "nt_name": "A", "nt_code": "A", "nt_id": "///S/23", "linked_nts": [ "///S/22", "///S/24" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet", "alpha": -63.995, "beta": 169.141, "gamma": 56.950, "delta": 79.177, "epsilon": -146.278, "zeta": -71.182, "epsilon_zeta": -75.096, "bb_type": "BI", "chi": -166.056, "glyco_bond": "anti", "C5prime_xyz": [ -1.323, 8.583, 0.946 ], "P_xyz": [ 1.193, 9.080, 0.950 ], "form": "A", "ssZp": 4.582, "Dp": 4.719, "splay_angle": 23.867, "splay_distance": 3.804, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 171.534, "theta": -146.145, "eta_prime": -175.375, "theta_prime": -143.369, "eta_base": -137.706, "theta_base": -119.114, "v0": 8.133, "v1": -32.477, "v2": 42.871, "v3": -39.303, "v4": 19.869, "amplitude": 43.293, "phase_angle": 8.008, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.900, "filter_rmsd": 0.035, "frame": { "rmsd": 0.005, "origin": [ 19.306, 52.553, 88.199 ], "x_axis": [ -0.513, -0.237, 0.825 ], "y_axis": [ -0.834, -0.091, -0.545 ], "z_axis": [ 0.204, -0.967, -0.151 ], "quaternion": [ -0.247, -0.427, 0.627, -0.603 ] } }, { "index": 499, "index_chain": 24, "chain_name": "S", "nt_resnum": 24, "nt_name": "G", "nt_code": "G", "nt_id": "///S/24", "linked_nts": [ "///S/23", "///S/25" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": -71.547, "beta": 163.463, "gamma": 69.395, "delta": 75.990, "epsilon": -144.169, "zeta": -81.657, "epsilon_zeta": -62.512, "bb_type": "BI", "chi": -173.113, "glyco_bond": "anti", "C5prime_xyz": [ -1.901, 8.667, 1.195 ], "P_xyz": [ 0.604, 9.316, 1.115 ], "form": "A", "ssZp": 4.550, "Dp": 4.634, "splay_angle": 24.204, "splay_distance": 3.743, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 168.773, "theta": -147.749, "eta_prime": -173.210, "theta_prime": -147.095, "eta_base": -131.621, "theta_base": -113.293, "v0": 1.409, "v1": -29.695, "v2": 45.185, "v3": -45.392, "v4": 27.751, "amplitude": 47.205, "phase_angle": 16.820, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.545, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 20.667, 49.329, 89.691 ], "x_axis": [ -0.868, -0.184, 0.462 ], "y_axis": [ -0.470, 0.001, -0.883 ], "z_axis": [ 0.162, -0.983, -0.087 ], "quaternion": [ -0.107, -0.234, 0.699, -0.667 ] } }, { "index": 500, "index_chain": 25, "chain_name": "S", "nt_resnum": 25, "nt_name": "U", "nt_code": "U", "nt_id": "///S/25", "linked_nts": [ "///S/24", "///S/26" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor", "alpha": -54.883, "beta": 174.296, "gamma": 43.870, "delta": 78.783, "epsilon": -158.368, "zeta": -64.515, "epsilon_zeta": -93.853, "bb_type": "BI", "chi": -160.747, "glyco_bond": "anti", "C5prime_xyz": [ -1.392, 8.768, 0.547 ], "P_xyz": [ 1.228, 8.976, 0.955 ], "form": "A", "ssZp": 4.428, "Dp": 4.601, "splay_angle": 21.361, "splay_distance": 3.459, "splay_ratio": 0.190, "d22": 4.314, "d64": 4.572, "eta": 168.229, "theta": -146.644, "eta_prime": 178.758, "theta_prime": -145.485, "eta_base": -133.030, "theta_base": -127.019, "v0": 3.239, "v1": -28.276, "v2": 41.563, "v3": -40.456, "v4": 23.390, "amplitude": 42.870, "phase_angle": 14.185, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.720, "filter_rmsd": 0.110, "frame": { "rmsd": 0.009, "origin": [ 20.506, 45.886, 91.151 ], "x_axis": [ -0.976, -0.039, -0.216 ], "y_axis": [ 0.213, 0.065, -0.975 ], "z_axis": [ 0.052, -0.997, -0.055 ], "quaternion": [ 0.092, 0.060, 0.724, -0.681 ] } }, { "index": 501, "index_chain": 26, "chain_name": "S", "nt_resnum": 26, "nt_name": "U", "nt_code": "U", "nt_id": "///S/26", "linked_nts": [ "///S/25", "///S/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop", "alpha": -77.137, "beta": -179.248, "gamma": 65.683, "delta": 84.868, "epsilon": -126.440, "zeta": -66.661, "epsilon_zeta": -59.779, "bb_type": "--", "chi": -155.594, "glyco_bond": "anti", "C5prime_xyz": [ -1.648, 8.783, 0.298 ], "P_xyz": [ 0.852, 9.451, 0.213 ], "form": ".", "ssZp": 4.140, "Dp": 4.654, "splay_angle": 31.223, "splay_distance": 5.010, "splay_ratio": 0.270, "d22": null, "d64": null, "eta": -178.853, "theta": -122.036, "eta_prime": -169.845, "theta_prime": -116.748, "eta_base": -142.540, "theta_base": -61.307, "v0": 2.598, "v1": -25.419, "v2": 36.746, "v3": -36.546, "v4": 21.599, "amplitude": 38.028, "phase_angle": 14.917, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.644, "filter_rmsd": 0.111, "frame": { "rmsd": 0.012, "origin": [ 19.653, 42.834, 92.537 ], "x_axis": [ -0.784, 0.056, -0.618 ], "y_axis": [ 0.615, -0.067, -0.786 ], "z_axis": [ -0.086, -0.996, 0.019 ], "quaternion": [ -0.204, -0.257, -0.652, 0.684 ] } }, { "index": 502, "index_chain": 27, "chain_name": "S", "nt_resnum": 27, "nt_name": "G", "nt_code": "G", "nt_id": "///S/27", "linked_nts": [ "///S/26", "///S/28" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart", "alpha": -64.129, "beta": 167.361, "gamma": 52.316, "delta": 82.432, "epsilon": -130.541, "zeta": 154.299, "epsilon_zeta": 75.160, "bb_type": "BII", "chi": -138.496, "glyco_bond": "anti", "C5prime_xyz": [ -1.558, 8.625, -0.793 ], "P_xyz": [ 0.862, 8.902, -1.606 ], "form": ".", "ssZp": 3.387, "Dp": 4.784, "splay_angle": 128.666, "splay_distance": 16.169, "splay_ratio": 0.902, "d22": null, "d64": null, "eta": 162.841, "theta": 74.874, "eta_prime": -171.339, "theta_prime": 107.842, "eta_base": -100.229, "theta_base": 140.884, "v0": 5.305, "v1": -30.100, "v2": 41.032, "v3": -39.277, "v4": 21.778, "amplitude": 41.870, "phase_angle": 11.481, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.708, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ 17.805, 40.790, 88.353 ], "x_axis": [ 0.084, 0.067, -0.994 ], "y_axis": [ 0.878, -0.477, 0.042 ], "z_axis": [ -0.471, -0.876, -0.099 ], "quaternion": [ 0.356, 0.644, 0.367, -0.569 ] } }, { "index": 503, "index_chain": 28, "chain_name": "S", "nt_resnum": 28, "nt_name": "A", "nt_code": "A", "nt_id": "///S/28", "linked_nts": [ "///S/27", "///S/29" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,cap-donor,splayed-apart", "alpha": -78.260, "beta": -136.574, "gamma": 56.265, "delta": 151.180, "epsilon": -89.466, "zeta": 124.422, "epsilon_zeta": 146.112, "bb_type": "--", "chi": -81.291, "glyco_bond": "anti", "C5prime_xyz": [ -1.827, 7.020, -2.724 ], "P_xyz": [ 0.476, 8.133, -2.012 ], "form": ".", "ssZp": -0.883, "Dp": 1.364, "splay_angle": 46.144, "splay_distance": 7.613, "splay_ratio": 0.397, "d22": null, "d64": null, "eta": -106.712, "theta": 165.779, "eta_prime": -120.030, "theta_prime": 149.485, "eta_base": 179.783, "theta_base": -175.722, "v0": -1.008, "v1": 21.978, "v2": -33.566, "v3": 33.509, "v4": -20.681, "amplitude": 35.064, "phase_angle": 196.808, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.227, "filter_rmsd": 0.038, "frame": { "rmsd": 0.015, "origin": [ 23.733, 28.019, 96.305 ], "x_axis": [ -0.901, 0.365, 0.236 ], "y_axis": [ -0.049, 0.455, -0.889 ], "z_axis": [ -0.431, -0.812, -0.392 ], "quaternion": [ -0.201, 0.095, 0.829, -0.513 ] } }, { "index": 504, "index_chain": 29, "chain_name": "S", "nt_resnum": 29, "nt_name": "C", "nt_code": "C", "nt_id": "///S/29", "linked_nts": [ "///S/28", "///S/30" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,junction-loop,A-minor,ribose-zipper,phosphate", "alpha": 157.679, "beta": -138.406, "gamma": 74.177, "delta": 80.774, "epsilon": -113.964, "zeta": -99.663, "epsilon_zeta": -14.302, "bb_type": "--", "chi": 179.985, "glyco_bond": "anti", "C5prime_xyz": [ -1.595, 8.573, 1.527 ], "P_xyz": [ 0.820, 8.563, 2.521 ], "form": "A", "ssZp": 4.739, "Dp": 4.801, "splay_angle": 19.092, "splay_distance": 3.080, "splay_ratio": 0.169, "d22": null, "d64": null, "eta": 142.810, "theta": -146.472, "eta_prime": 126.190, "theta_prime": -145.658, "eta_base": 161.559, "theta_base": -138.389, "v0": 3.155, "v1": -29.464, "v2": 42.498, "v3": -40.415, "v4": 24.322, "amplitude": 43.760, "phase_angle": 13.797, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.066, "frame": { "rmsd": 0.006, "origin": [ 29.521, 23.846, 93.653 ], "x_axis": [ -0.917, 0.274, 0.291 ], "y_axis": [ 0.112, 0.875, -0.470 ], "z_axis": [ -0.384, -0.398, -0.833 ], "quaternion": [ -0.177, 0.101, 0.952, -0.228 ] } }, { "index": 505, "index_chain": 30, "chain_name": "S", "nt_resnum": 30, "nt_name": "G", "nt_code": "G", "nt_id": "///S/30", "linked_nts": [ "///S/29", "///S/31" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper,phosphate", "alpha": -67.461, "beta": 107.902, "gamma": 102.036, "delta": 78.839, "epsilon": -149.573, "zeta": -75.564, "epsilon_zeta": -74.010, "bb_type": "BI", "chi": 169.308, "glyco_bond": "anti", "C5prime_xyz": [ -1.901, 8.387, 1.964 ], "P_xyz": [ 0.089, 9.404, 0.482 ], "form": "A", "ssZp": 4.512, "Dp": 4.574, "splay_angle": 24.665, "splay_distance": 3.787, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 160.875, "theta": -147.667, "eta_prime": -176.789, "theta_prime": -157.249, "eta_base": -150.642, "theta_base": -131.098, "v0": -5.642, "v1": -22.469, "v2": 40.324, "v3": -43.910, "v4": 31.390, "amplitude": 44.576, "phase_angle": 25.228, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.017, "frame": { "rmsd": 0.017, "origin": [ 28.904, 21.080, 92.446 ], "x_axis": [ -0.894, 0.443, 0.068 ], "y_axis": [ 0.278, 0.667, -0.692 ], "z_axis": [ -0.352, -0.599, -0.719 ], "quaternion": [ -0.116, 0.199, 0.905, -0.356 ] } }, { "index": 506, "index_chain": 31, "chain_name": "S", "nt_resnum": 31, "nt_name": "A", "nt_code": "A", "nt_id": "///S/31", "linked_nts": [ "///S/30", "///S/32" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,A-minor", "alpha": -102.797, "beta": -156.798, "gamma": 70.541, "delta": 84.288, "epsilon": -148.851, "zeta": -64.712, "epsilon_zeta": -84.139, "bb_type": "BI", "chi": -166.576, "glyco_bond": "anti", "C5prime_xyz": [ -1.555, 8.636, 0.949 ], "P_xyz": [ 1.019, 8.905, 1.417 ], "form": ".", "ssZp": 4.575, "Dp": 4.641, "splay_angle": 28.764, "splay_distance": 4.382, "splay_ratio": 0.249, "d22": null, "d64": null, "eta": 164.273, "theta": -131.121, "eta_prime": 175.138, "theta_prime": -127.006, "eta_base": -141.462, "theta_base": -77.957, "v0": 6.084, "v1": -29.525, "v2": 39.992, "v3": -37.010, "v4": 19.773, "amplitude": 40.579, "phase_angle": 9.761, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.052, "filter_rmsd": 0.037, "frame": { "rmsd": 0.009, "origin": [ 26.500, 18.263, 91.654 ], "x_axis": [ -0.498, 0.781, -0.376 ], "y_axis": [ 0.787, 0.225, -0.575 ], "z_axis": [ -0.365, -0.582, -0.727 ], "quaternion": [ 0.004, 0.501, 0.783, -0.370 ] } }, { "index": 507, "index_chain": 32, "chain_name": "S", "nt_resnum": 32, "nt_name": "G", "nt_code": "G", "nt_id": "///S/32", "linked_nts": [ "///S/31", "///S/33" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -66.246, "beta": -171.608, "gamma": 48.936, "delta": 83.188, "epsilon": -173.381, "zeta": -66.012, "epsilon_zeta": -107.369, "bb_type": "BI", "chi": -148.433, "glyco_bond": "anti", "C5prime_xyz": [ -1.118, 8.706, -0.026 ], "P_xyz": [ 1.492, 8.853, 0.350 ], "form": "A", "ssZp": 4.140, "Dp": 4.505, "splay_angle": 19.859, "splay_distance": 3.121, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 169.455, "theta": -150.847, "eta_prime": -169.663, "theta_prime": -149.255, "eta_base": -102.437, "theta_base": -131.872, "v0": 12.238, "v1": -32.360, "v2": 38.838, "v3": -32.261, "v4": 13.021, "amplitude": 38.839, "phase_angle": 0.328, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.863, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 24.049, 19.075, 88.115 ], "x_axis": [ 0.368, 0.666, -0.649 ], "y_axis": [ 0.802, -0.581, -0.141 ], "z_axis": [ -0.470, -0.468, -0.748 ], "quaternion": [ 0.100, 0.821, 0.447, -0.341 ] } }, { "index": 508, "index_chain": 33, "chain_name": "S", "nt_resnum": 33, "nt_name": "G", "nt_code": "G", "nt_id": "///S/33", "linked_nts": [ "///S/32", "///S/34" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": -90.440, "beta": -179.759, "gamma": 77.088, "delta": 88.116, "epsilon": -141.976, "zeta": -98.739, "epsilon_zeta": -43.238, "bb_type": "BI", "chi": -146.188, "glyco_bond": "anti", "C5prime_xyz": [ -1.515, 8.775, -0.292 ], "P_xyz": [ 1.029, 8.911, -1.052 ], "form": ".", "ssZp": 3.946, "Dp": 4.621, "splay_angle": 54.279, "splay_distance": 8.919, "splay_ratio": 0.456, "d22": null, "d64": null, "eta": 176.014, "theta": -161.556, "eta_prime": -171.019, "theta_prime": -153.114, "eta_base": -143.982, "theta_base": -155.041, "v0": 4.172, "v1": -24.348, "v2": 33.996, "v3": -32.147, "v4": 17.937, "amplitude": 34.711, "phase_angle": 11.645, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.087, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 21.937, 18.256, 85.968 ], "x_axis": [ 0.608, 0.334, -0.720 ], "y_axis": [ 0.449, -0.893, -0.035 ], "z_axis": [ -0.655, -0.302, -0.693 ], "quaternion": [ 0.075, 0.893, 0.219, -0.385 ] } }, { "index": 509, "index_chain": 34, "chain_name": "S", "nt_resnum": 34, "nt_name": "U", "nt_code": "U", "nt_id": "///S/34", "linked_nts": [ "///S/33", "///S/35" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -43.988, "beta": -162.003, "gamma": 52.112, "delta": 147.268, "epsilon": -104.278, "zeta": -147.468, "epsilon_zeta": 43.190, "bb_type": "--", "chi": -103.535, "glyco_bond": "anti", "C5prime_xyz": [ -2.505, 8.258, -1.918 ], "P_xyz": [ -0.484, 9.830, -1.503 ], "form": ".", "ssZp": 0.877, "Dp": 0.918, "splay_angle": 128.044, "splay_distance": 16.806, "splay_ratio": 0.899, "d22": null, "d64": null, "eta": -134.111, "theta": -111.359, "eta_prime": -128.009, "theta_prime": -150.697, "eta_base": -144.743, "theta_base": 160.664, "v0": -27.421, "v1": 42.666, "v2": -41.522, "v3": 27.065, "v4": 0.053, "amplitude": 43.818, "phase_angle": 161.373, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.386, "filter_rmsd": 0.108, "frame": { "rmsd": 0.009, "origin": [ 14.839, 15.309, 81.440 ], "x_axis": [ 0.692, 0.529, -0.492 ], "y_axis": [ 0.677, -0.712, 0.187 ], "z_axis": [ -0.251, -0.462, -0.850 ], "quaternion": [ 0.180, 0.902, 0.334, -0.206 ] } }, { "index": 510, "index_chain": 35, "chain_name": "S", "nt_resnum": 35, "nt_name": "G", "nt_code": "G", "nt_id": "///S/35", "linked_nts": [ "///S/34", "///S/36" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart", "alpha": 61.351, "beta": 162.461, "gamma": 53.929, "delta": 85.553, "epsilon": -152.966, "zeta": -67.852, "epsilon_zeta": -85.114, "bb_type": "BI", "chi": -169.880, "glyco_bond": "anti", "C5prime_xyz": [ -1.366, 8.535, 1.188 ], "P_xyz": [ 1.259, 8.487, 1.366 ], "form": "A", "ssZp": 4.596, "Dp": 4.624, "splay_angle": 25.994, "splay_distance": 4.123, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": -61.788, "theta": -135.329, "eta_prime": -31.332, "theta_prime": -138.867, "eta_base": 24.013, "theta_base": -122.038, "v0": 8.990, "v1": -30.462, "v2": 38.900, "v3": -34.997, "v4": 16.479, "amplitude": 39.096, "phase_angle": 5.735, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "8d", "suiteness": 0.432, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 9.566, 1.161, 88.821 ], "x_axis": [ 0.601, 0.092, 0.794 ], "y_axis": [ 0.699, 0.420, -0.579 ], "z_axis": [ -0.387, 0.903, 0.188 ], "quaternion": [ 0.743, -0.498, -0.397, -0.204 ] } }, { "index": 511, "index_chain": 36, "chain_name": "S", "nt_resnum": 36, "nt_name": "G", "nt_code": "G", "nt_id": "///S/36", "linked_nts": [ "///S/35", "///S/37" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -75.326, "beta": -171.986, "gamma": 48.602, "delta": 76.204, "epsilon": -152.998, "zeta": -70.709, "epsilon_zeta": -82.289, "bb_type": "BI", "chi": -165.121, "glyco_bond": "anti", "C5prime_xyz": [ -1.469, 8.703, 0.854 ], "P_xyz": [ 1.016, 9.236, 1.427 ], "form": "A", "ssZp": 4.578, "Dp": 4.689, "splay_angle": 23.233, "splay_distance": 3.634, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 162.978, "theta": -154.104, "eta_prime": 172.915, "theta_prime": -150.571, "eta_base": -150.679, "theta_base": -124.135, "v0": 7.572, "v1": -33.627, "v2": 45.331, "v3": -42.339, "v4": 21.899, "amplitude": 45.944, "phase_angle": 9.377, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.786, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 7.177, 3.589, 91.144 ], "x_axis": [ 0.930, 0.166, 0.328 ], "y_axis": [ 0.274, 0.283, -0.919 ], "z_axis": [ -0.245, 0.945, 0.218 ], "quaternion": [ 0.779, -0.598, -0.184, -0.035 ] } }, { "index": 512, "index_chain": 37, "chain_name": "S", "nt_resnum": 37, "nt_name": "G", "nt_code": "G", "nt_id": "///S/37", "linked_nts": [ "///S/36", "///S/38" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -69.890, "beta": 176.356, "gamma": 56.310, "delta": 76.041, "epsilon": -141.801, "zeta": -77.590, "epsilon_zeta": -64.211, "bb_type": "BI", "chi": -168.432, "glyco_bond": "anti", "C5prime_xyz": [ -1.345, 8.629, 1.030 ], "P_xyz": [ 1.210, 9.064, 1.117 ], "form": "A", "ssZp": 4.666, "Dp": 4.797, "splay_angle": 26.439, "splay_distance": 3.939, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 169.862, "theta": -146.390, "eta_prime": 178.815, "theta_prime": -141.415, "eta_base": -144.122, "theta_base": -99.066, "v0": 8.412, "v1": -34.485, "v2": 45.987, "v3": -42.594, "v4": 21.681, "amplitude": 46.509, "phase_angle": 8.589, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.860, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 6.822, 6.111, 93.736 ], "x_axis": [ 0.960, 0.183, -0.213 ], "y_axis": [ -0.251, 0.218, -0.943 ], "z_axis": [ -0.126, 0.959, 0.255 ], "quaternion": [ 0.780, -0.609, 0.028, 0.139 ] } }, { "index": 513, "index_chain": 38, "chain_name": "S", "nt_resnum": 38, "nt_name": "G", "nt_code": "G", "nt_id": "///S/38", "linked_nts": [ "///S/37", "///S/39" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -51.024, "beta": 161.237, "gamma": 47.736, "delta": 78.480, "epsilon": -134.459, "zeta": -87.489, "epsilon_zeta": -46.970, "bb_type": "BI", "chi": -168.167, "glyco_bond": "anti", "C5prime_xyz": [ -1.176, 8.524, 1.095 ], "P_xyz": [ 1.441, 8.528, 1.167 ], "form": "A", "ssZp": 4.630, "Dp": 4.806, "splay_angle": 22.121, "splay_distance": 3.355, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 172.833, "theta": -145.755, "eta_prime": -172.924, "theta_prime": -143.283, "eta_base": -116.173, "theta_base": -116.497, "v0": 15.943, "v1": -39.673, "v2": 47.392, "v3": -39.399, "v4": 14.975, "amplitude": 47.393, "phase_angle": 359.512, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.725, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 8.844, 9.398, 94.526 ], "x_axis": [ 0.531, 0.185, -0.827 ], "y_axis": [ -0.847, 0.096, -0.523 ], "z_axis": [ -0.018, 0.978, 0.208 ], "quaternion": [ 0.677, -0.554, 0.299, 0.381 ] } }, { "index": 514, "index_chain": 39, "chain_name": "S", "nt_resnum": 39, "nt_name": "U", "nt_code": "U", "nt_id": "///S/39", "linked_nts": [ "///S/38", "///S/40" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -45.657, "beta": 157.122, "gamma": 44.227, "delta": 79.666, "epsilon": -130.260, "zeta": -92.396, "epsilon_zeta": -37.864, "bb_type": "--", "chi": -163.694, "glyco_bond": "anti", "C5prime_xyz": [ -1.234, 8.612, 0.801 ], "P_xyz": [ 1.415, 8.692, 0.790 ], "form": "A", "ssZp": 4.522, "Dp": 4.805, "splay_angle": 23.835, "splay_distance": 3.625, "splay_ratio": 0.207, "d22": 3.989, "d64": 3.814, "eta": 171.724, "theta": -141.427, "eta_prime": -176.970, "theta_prime": -139.048, "eta_base": -135.784, "theta_base": -104.346, "v0": 14.844, "v1": -38.356, "v2": 46.217, "v3": -38.790, "v4": 15.243, "amplitude": 46.218, "phase_angle": 0.336, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.491, "filter_rmsd": 0.109, "frame": { "rmsd": 0.008, "origin": [ 10.294, 12.398, 94.918 ], "x_axis": [ -0.023, 0.132, -0.991 ], "y_axis": [ -0.995, 0.088, 0.035 ], "z_axis": [ 0.092, 0.987, 0.130 ], "quaternion": [ 0.547, -0.436, 0.495, 0.516 ] } }, { "index": 515, "index_chain": 40, "chain_name": "S", "nt_resnum": 40, "nt_name": "U", "nt_code": "U", "nt_id": "///S/40", "linked_nts": [ "///S/39", "///S/41" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -37.027, "beta": 149.027, "gamma": 41.469, "delta": 83.341, "epsilon": -157.918, "zeta": -76.212, "epsilon_zeta": -81.706, "bb_type": "BI", "chi": -164.101, "glyco_bond": "anti", "C5prime_xyz": [ -1.176, 8.610, 0.779 ], "P_xyz": [ 1.513, 8.649, 0.612 ], "form": ".", "ssZp": 4.572, "Dp": 4.640, "splay_angle": 129.422, "splay_distance": 14.366, "splay_ratio": 0.905, "d22": 11.440, "d64": 13.232, "eta": 163.488, "theta": -146.404, "eta_prime": -178.718, "theta_prime": 168.003, "eta_base": -123.517, "theta_base": 106.392, "v0": 11.870, "v1": -33.613, "v2": 41.373, "v3": -35.663, "v4": 15.047, "amplitude": 41.407, "phase_angle": 2.351, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.204, "filter_rmsd": 0.108, "frame": { "rmsd": 0.008, "origin": [ 11.072, 15.658, 93.538 ], "x_axis": [ -0.655, 0.048, -0.754 ], "y_axis": [ -0.748, 0.098, 0.656 ], "z_axis": [ 0.105, 0.994, -0.028 ], "quaternion": [ 0.322, -0.262, 0.667, 0.618 ] } }, { "index": 516, "index_chain": 41, "chain_name": "S", "nt_resnum": 41, "nt_name": "U", "nt_code": "U", "nt_id": "///S/41", "linked_nts": [ "///S/40", "///S/42" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-stack,hairpin-loop,splayed-apart", "alpha": -173.662, "beta": 141.921, "gamma": 32.898, "delta": 143.496, "epsilon": -69.858, "zeta": -95.371, "epsilon_zeta": 25.513, "bb_type": "--", "chi": 139.672, "glyco_bond": "--", "C5prime_xyz": [ -3.087, 6.943, 3.120 ], "P_xyz": [ -2.618, 5.033, 4.833 ], "form": ".", "ssZp": 0.222, "Dp": 0.153, "splay_angle": 140.621, "splay_distance": 18.550, "splay_ratio": 0.942, "d22": null, "d64": null, "eta": 44.191, "theta": -51.161, "eta_prime": 66.837, "theta_prime": -82.343, "eta_base": 54.602, "theta_base": -50.614, "v0": -22.636, "v1": 39.359, "v2": -40.773, "v3": 27.843, "v4": -3.352, "amplitude": 41.983, "phase_angle": 166.209, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1z", "suiteness": 0.427, "filter_rmsd": 0.112, "frame": { "rmsd": 0.016, "origin": [ 9.839, 20.465, 107.019 ], "x_axis": [ -0.412, 0.782, 0.468 ], "y_axis": [ 0.315, 0.604, -0.732 ], "z_axis": [ -0.855, -0.154, -0.495 ], "quaternion": [ -0.417, 0.346, 0.792, -0.279 ] } }, { "index": 517, "index_chain": 42, "chain_name": "S", "nt_resnum": 42, "nt_name": "A", "nt_code": "A", "nt_id": "///S/42", "linked_nts": [ "///S/41", "///S/43" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -56.303, "beta": -135.176, "gamma": 69.716, "delta": 141.039, "epsilon": -101.898, "zeta": 169.019, "epsilon_zeta": 89.083, "bb_type": "BII", "chi": -142.577, "glyco_bond": "anti", "C5prime_xyz": [ -2.344, 8.748, -0.162 ], "P_xyz": [ -0.691, 9.259, 1.800 ], "form": ".", "ssZp": 0.911, "Dp": 0.982, "splay_angle": 79.756, "splay_distance": 11.945, "splay_ratio": 0.643, "d22": null, "d64": null, "eta": -136.174, "theta": 173.710, "eta_prime": -89.994, "theta_prime": 175.124, "eta_base": -118.302, "theta_base": -149.652, "v0": -28.779, "v1": 39.207, "v2": -34.550, "v3": 19.010, "v4": 6.008, "amplitude": 38.896, "phase_angle": 152.657, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2[", "suiteness": 0.185, "filter_rmsd": 0.036, "frame": { "rmsd": 0.011, "origin": [ 14.911, 16.513, 89.620 ], "x_axis": [ -0.969, 0.160, -0.186 ], "y_axis": [ -0.133, 0.297, 0.946 ], "z_axis": [ 0.206, 0.942, -0.267 ], "quaternion": [ 0.123, 0.008, 0.796, 0.593 ] } }, { "index": 518, "index_chain": 43, "chain_name": "S", "nt_resnum": 43, "nt_name": "U", "nt_code": "U", "nt_id": "///S/43", "linked_nts": [ "///S/42", "///S/44" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,A-minor,phosphate", "alpha": -66.044, "beta": -179.456, "gamma": 35.079, "delta": 86.573, "epsilon": -148.597, "zeta": -61.215, "epsilon_zeta": -87.381, "bb_type": "BI", "chi": -170.929, "glyco_bond": "anti", "C5prime_xyz": [ -1.040, 8.330, 1.203 ], "P_xyz": [ 1.454, 8.356, 1.971 ], "form": "A", "ssZp": 4.702, "Dp": 4.740, "splay_angle": 25.011, "splay_distance": 3.989, "splay_ratio": 0.224, "d22": 4.429, "d64": 4.894, "eta": -148.414, "theta": -134.598, "eta_prime": -162.852, "theta_prime": -131.272, "eta_base": -145.956, "theta_base": -105.680, "v0": 17.451, "v1": -38.579, "v2": 43.275, "v3": -34.611, "v4": 10.958, "amplitude": 43.409, "phase_angle": 355.509, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4a", "suiteness": 0.546, "filter_rmsd": 0.109, "frame": { "rmsd": 0.009, "origin": [ 26.560, 18.285, 91.581 ], "x_axis": [ -0.442, 0.859, -0.257 ], "y_axis": [ -0.777, -0.224, 0.588 ], "z_axis": [ 0.447, 0.459, 0.767 ], "quaternion": [ 0.525, 0.061, 0.336, 0.780 ] } }, { "index": 519, "index_chain": 44, "chain_name": "S", "nt_resnum": 44, "nt_name": "C", "nt_code": "C", "nt_id": "///S/44", "linked_nts": [ "///S/43", "///S/45" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,hairpin-loop,A-minor,ribose-zipper", "alpha": -85.451, "beta": 173.996, "gamma": 68.606, "delta": 77.938, "epsilon": -104.951, "zeta": -98.251, "epsilon_zeta": -6.700, "bb_type": "--", "chi": -167.069, "glyco_bond": "anti", "C5prime_xyz": [ -1.537, 8.735, 0.962 ], "P_xyz": [ 0.960, 9.348, 0.762 ], "form": "A", "ssZp": 4.393, "Dp": 4.785, "splay_angle": 22.013, "splay_distance": 3.474, "splay_ratio": 0.191, "d22": null, "d64": null, "eta": 174.141, "theta": -149.335, "eta_prime": -171.469, "theta_prime": -148.776, "eta_base": -132.338, "theta_base": -127.058, "v0": 8.000, "v1": -33.458, "v2": 44.804, "v3": -41.482, "v4": 21.154, "amplitude": 45.329, "phase_angle": 8.731, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.431, "filter_rmsd": 0.070, "frame": { "rmsd": 0.011, "origin": [ 28.693, 21.525, 92.512 ], "x_axis": [ -0.801, 0.585, 0.125 ], "y_axis": [ -0.353, -0.630, 0.692 ], "z_axis": [ 0.484, 0.510, 0.711 ], "quaternion": [ 0.265, 0.172, 0.339, 0.886 ] } }, { "index": 520, "index_chain": 45, "chain_name": "S", "nt_resnum": 45, "nt_name": "G", "nt_code": "G", "nt_id": "///S/45", "linked_nts": [ "///S/44", "///S/46" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,junction-loop,A-minor,ribose-zipper", "alpha": -79.388, "beta": 109.987, "gamma": 100.974, "delta": 84.432, "epsilon": -135.103, "zeta": -77.964, "epsilon_zeta": -57.139, "bb_type": "BI", "chi": 176.784, "glyco_bond": "anti", "C5prime_xyz": [ -1.577, 8.311, 1.848 ], "P_xyz": [ 0.335, 9.134, 0.168 ], "form": "A", "ssZp": 4.600, "Dp": 4.666, "splay_angle": 26.826, "splay_distance": 4.164, "splay_ratio": 0.237, "d22": null, "d64": null, "eta": 157.008, "theta": -145.723, "eta_prime": 178.409, "theta_prime": -156.649, "eta_base": -143.393, "theta_base": -139.061, "v0": 9.526, "v1": -33.793, "v2": 44.342, "v3": -39.302, "v4": 18.866, "amplitude": 44.603, "phase_angle": 6.210, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 30.026, 24.229, 94.239 ], "x_axis": [ -0.948, 0.194, 0.253 ], "y_axis": [ 0.028, -0.741, 0.671 ], "z_axis": [ 0.318, 0.643, 0.696 ], "quaternion": [ 0.045, 0.155, 0.357, 0.920 ] } }, { "index": 521, "index_chain": 46, "chain_name": "S", "nt_resnum": 46, "nt_name": "A", "nt_code": "A", "nt_id": "///S/46", "linked_nts": [ "///S/45", "///S/47" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,junction-loop", "alpha": -74.848, "beta": -172.560, "gamma": 53.031, "delta": 80.438, "epsilon": -148.026, "zeta": -64.766, "epsilon_zeta": -83.259, "bb_type": "BI", "chi": -169.143, "glyco_bond": "anti", "C5prime_xyz": [ -1.529, 8.538, 1.105 ], "P_xyz": [ 0.894, 8.988, 1.873 ], "form": "A", "ssZp": 4.514, "Dp": 4.600, "splay_angle": 27.438, "splay_distance": 4.159, "splay_ratio": 0.239, "d22": null, "d64": null, "eta": 167.354, "theta": -139.392, "eta_prime": 177.943, "theta_prime": -133.109, "eta_base": -146.275, "theta_base": -85.459, "v0": 8.227, "v1": -32.831, "v2": 44.022, "v3": -40.551, "v4": 20.251, "amplitude": 44.487, "phase_angle": 8.291, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.794, "filter_rmsd": 0.039, "frame": { "rmsd": 0.011, "origin": [ 30.601, 28.230, 95.237 ], "x_axis": [ -0.804, -0.328, 0.496 ], "y_axis": [ 0.536, -0.762, 0.364 ], "z_axis": [ 0.258, 0.558, 0.788 ], "quaternion": [ -0.236, 0.206, 0.252, 0.916 ] } }, { "index": 522, "index_chain": 47, "chain_name": "S", "nt_resnum": 47, "nt_name": "G", "nt_code": "G", "nt_id": "///S/47", "linked_nts": [ "///S/46", "///S/48" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,junction-loop", "alpha": -64.187, "beta": 175.060, "gamma": 60.436, "delta": 86.035, "epsilon": -148.485, "zeta": -66.903, "epsilon_zeta": -81.582, "bb_type": "BI", "chi": -162.233, "glyco_bond": "anti", "C5prime_xyz": [ -1.180, 8.694, 0.719 ], "P_xyz": [ 1.390, 8.775, 1.080 ], "form": ".", "ssZp": 4.286, "Dp": 4.496, "splay_angle": 20.643, "splay_distance": 3.273, "splay_ratio": 0.180, "d22": null, "d64": null, "eta": 177.038, "theta": -132.971, "eta_prime": -163.717, "theta_prime": -123.581, "eta_base": -102.826, "theta_base": -81.981, "v0": 6.149, "v1": -27.507, "v2": 37.157, "v3": -33.631, "v4": 17.954, "amplitude": 37.611, "phase_angle": 8.911, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.858, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ 29.191, 29.398, 98.972 ], "x_axis": [ -0.122, -0.820, 0.560 ], "y_axis": [ 0.967, -0.225, -0.118 ], "z_axis": [ 0.223, 0.527, 0.820 ], "quaternion": [ 0.607, -0.266, -0.139, -0.736 ] } }, { "index": 523, "index_chain": 48, "chain_name": "S", "nt_resnum": 48, "nt_name": "A", "nt_code": "A", "nt_id": "///S/48", "linked_nts": [ "///S/47", "///S/49" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,junction-loop", "alpha": -64.124, "beta": 171.822, "gamma": 68.136, "delta": 152.611, "epsilon": -102.172, "zeta": -152.691, "epsilon_zeta": 50.519, "bb_type": "BII", "chi": -112.345, "glyco_bond": "anti", "C5prime_xyz": [ -2.254, 8.383, -1.305 ], "P_xyz": [ 0.306, 8.857, -1.094 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -171.376, "theta": -142.646, "eta_prime": -127.134, "theta_prime": 177.392, "eta_base": -80.832, "theta_base": null, "v0": -20.004, "v1": 37.603, "v2": -40.167, "v3": 30.303, "v4": -6.526, "amplitude": 40.731, "phase_angle": 170.459, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.716, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 29.940, 29.258, 102.155 ], "x_axis": [ 0.496, -0.814, 0.301 ], "y_axis": [ 0.868, 0.466, -0.171 ], "z_axis": [ -0.001, 0.346, 0.938 ], "quaternion": [ 0.851, -0.152, -0.089, -0.494 ] } }, { "index": 524, "index_chain": 49, "chain_name": "S", "nt_resnum": 49, "nt_name": "U", "nt_code": "U", "nt_id": "///S/49", "linked_nts": [ "///S/48", "///S/50" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,~C2'-endo,non-stack,hairpin-loop,junction-loop", "alpha": -163.084, "beta": 173.415, "gamma": -86.533, "delta": 153.288, "epsilon": -116.358, "zeta": -56.467, "epsilon_zeta": -59.891, "bb_type": "--", "chi": null, "glyco_bond": "--", "C5prime_xyz": [ null, null, null ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": -0.473, "theta": -79.091, "eta_prime": -0.195, "theta_prime": -127.390, "eta_base": null, "theta_base": null, "v0": -0.725, "v1": 22.343, "v2": -33.396, "v3": 34.153, "v4": -21.475, "amplitude": 35.032, "phase_angle": 197.577, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": null }, { "index": 525, "index_chain": 50, "chain_name": "S", "nt_resnum": 50, "nt_name": "U", "nt_code": "U", "nt_id": "///S/50", "linked_nts": [ "///S/49", "///S/51" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,splayed-apart", "alpha": -170.400, "beta": 142.048, "gamma": 42.919, "delta": 135.953, "epsilon": -105.712, "zeta": 110.833, "epsilon_zeta": 143.455, "bb_type": "--", "chi": -161.593, "glyco_bond": "anti", "C5prime_xyz": [ -2.658, 8.850, 0.596 ], "P_xyz": [ -0.740, 9.185, 2.349 ], "form": ".", "ssZp": 0.774, "Dp": 1.434, "splay_angle": 166.578, "splay_distance": 18.715, "splay_ratio": 0.993, "d22": 11.845, "d64": 15.147, "eta": 32.099, "theta": 132.666, "eta_prime": 98.114, "theta_prime": 76.848, "eta_base": null, "theta_base": 49.836, "v0": -35.658, "v1": 43.579, "v2": -35.432, "v3": 15.906, "v4": 12.095, "amplitude": 43.081, "phase_angle": 145.330, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2z", "suiteness": 0.060, "filter_rmsd": 0.107, "frame": { "rmsd": 0.012, "origin": [ 20.951, 43.788, 96.964 ], "x_axis": [ -0.283, 0.412, 0.866 ], "y_axis": [ 0.466, -0.731, 0.499 ], "z_axis": [ 0.838, 0.545, 0.015 ], "quaternion": [ -0.019, 0.598, 0.367, 0.712 ] } }, { "index": 526, "index_chain": 51, "chain_name": "S", "nt_resnum": 51, "nt_name": "U", "nt_code": "U", "nt_id": "///S/51", "linked_nts": [ "///S/50", "///S/52" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,junction-loop,cap-acceptor,splayed-apart", "alpha": 40.715, "beta": -160.549, "gamma": 63.530, "delta": 149.268, "epsilon": -86.355, "zeta": -40.706, "epsilon_zeta": -45.649, "bb_type": "--", "chi": -141.423, "glyco_bond": "anti", "C5prime_xyz": [ -1.743, 8.740, -0.114 ], "P_xyz": [ 0.248, 8.977, 1.586 ], "form": ".", "ssZp": 0.451, "Dp": 0.523, "splay_angle": 126.253, "splay_distance": 17.128, "splay_ratio": 0.892, "d22": 8.880, "d64": 10.769, "eta": 0.251, "theta": 11.005, "eta_prime": 15.635, "theta_prime": -15.703, "eta_base": 26.587, "theta_base": 16.243, "v0": -23.457, "v1": 36.235, "v2": -35.855, "v3": 23.391, "v4": -0.118, "amplitude": 37.733, "phase_angle": 161.846, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "6p", "suiteness": 0.211, "filter_rmsd": 0.109, "frame": { "rmsd": 0.010, "origin": [ 31.352, 28.472, 94.229 ], "x_axis": [ 0.652, 0.445, -0.614 ], "y_axis": [ -0.610, 0.789, -0.075 ], "z_axis": [ 0.451, 0.423, 0.786 ], "quaternion": [ 0.898, -0.139, 0.297, 0.294 ] } }, { "index": 527, "index_chain": 52, "chain_name": "S", "nt_resnum": 52, "nt_name": "C", "nt_code": "C", "nt_id": "///S/52", "linked_nts": [ "///S/51", "///S/53" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,bulge,junction-loop,splayed-apart", "alpha": -102.789, "beta": -143.477, "gamma": 60.302, "delta": 74.649, "epsilon": -168.121, "zeta": -49.919, "epsilon_zeta": -118.202, "bb_type": "BI", "chi": -163.225, "glyco_bond": "anti", "C5prime_xyz": [ -1.450, 8.850, 0.673 ], "P_xyz": [ 1.082, 9.088, 1.463 ], "form": ".", "ssZp": 4.526, "Dp": 4.613, "splay_angle": 32.039, "splay_distance": 4.856, "splay_ratio": 0.277, "d22": null, "d64": null, "eta": 140.147, "theta": -132.351, "eta_prime": 179.386, "theta_prime": -126.693, "eta_base": -173.437, "theta_base": -79.918, "v0": -0.200, "v1": -27.107, "v2": 42.260, "v3": -43.610, "v4": 27.635, "amplitude": 44.648, "phase_angle": 18.824, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.094, "filter_rmsd": 0.067, "frame": { "rmsd": 0.010, "origin": [ 18.992, 40.284, 95.266 ], "x_axis": [ 0.142, -0.345, -0.928 ], "y_axis": [ 0.539, -0.759, 0.365 ], "z_axis": [ -0.830, -0.552, 0.078 ], "quaternion": [ 0.339, 0.675, 0.072, -0.651 ] } }, { "index": 528, "index_chain": 53, "chain_name": "S", "nt_resnum": 53, "nt_name": "G", "nt_code": "G", "nt_id": "///S/53", "linked_nts": [ "///S/52", "///S/54" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,bulge", "alpha": -111.989, "beta": -151.104, "gamma": 67.599, "delta": 81.652, "epsilon": -148.697, "zeta": -67.684, "epsilon_zeta": -81.013, "bb_type": "BI", "chi": -165.536, "glyco_bond": "anti", "C5prime_xyz": [ -1.345, 8.705, 0.859 ], "P_xyz": [ 1.286, 8.760, 1.296 ], "form": "A", "ssZp": 4.558, "Dp": 4.669, "splay_angle": 24.455, "splay_distance": 3.972, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 163.198, "theta": -140.045, "eta_prime": -179.043, "theta_prime": -138.466, "eta_base": -115.711, "theta_base": -117.470, "v0": 6.165, "v1": -30.003, "v2": 41.612, "v3": -38.594, "v4": 20.489, "amplitude": 42.273, "phase_angle": 10.144, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.010, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 16.887, 36.933, 92.451 ], "x_axis": [ 0.739, -0.623, -0.256 ], "y_axis": [ 0.177, -0.188, 0.966 ], "z_axis": [ -0.650, -0.759, -0.029 ], "quaternion": [ 0.617, 0.699, -0.159, -0.324 ] } }, { "index": 529, "index_chain": 54, "chain_name": "S", "nt_resnum": 54, "nt_name": "G", "nt_code": "G", "nt_id": "///S/54", "linked_nts": [ "///S/53", "///S/55" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -72.765, "beta": 179.381, "gamma": 59.955, "delta": 73.708, "epsilon": -154.386, "zeta": -63.934, "epsilon_zeta": -90.452, "bb_type": "BI", "chi": -162.251, "glyco_bond": "anti", "C5prime_xyz": [ -1.571, 8.793, 0.651 ], "P_xyz": [ 0.865, 9.533, 0.588 ], "form": "A", "ssZp": 4.483, "Dp": 4.703, "splay_angle": 22.328, "splay_distance": 3.611, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 171.258, "theta": -150.427, "eta_prime": -176.614, "theta_prime": -148.224, "eta_base": -140.485, "theta_base": -116.070, "v0": 5.862, "v1": -33.393, "v2": 47.068, "v3": -44.222, "v4": 24.653, "amplitude": 48.042, "phase_angle": 11.556, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.787, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 15.408, 34.003, 90.213 ], "x_axis": [ 0.772, -0.585, 0.248 ], "y_axis": [ -0.254, 0.073, 0.964 ], "z_axis": [ -0.582, -0.808, -0.092 ], "quaternion": [ 0.662, 0.669, -0.314, -0.125 ] } }, { "index": 530, "index_chain": 55, "chain_name": "S", "nt_resnum": 55, "nt_name": "C", "nt_code": "C", "nt_id": "///S/55", "linked_nts": [ "///S/54", "///S/56" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -64.052, "beta": 175.874, "gamma": 47.731, "delta": 77.577, "epsilon": -158.991, "zeta": -65.022, "epsilon_zeta": -93.968, "bb_type": "BI", "chi": -157.964, "glyco_bond": "anti", "C5prime_xyz": [ -1.413, 8.872, 0.417 ], "P_xyz": [ 1.142, 9.428, 0.335 ], "form": "A", "ssZp": 4.407, "Dp": 4.644, "splay_angle": 23.649, "splay_distance": 3.775, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 165.472, "theta": -150.089, "eta_prime": 179.294, "theta_prime": -147.333, "eta_base": -132.853, "theta_base": -121.293, "v0": 8.212, "v1": -32.988, "v2": 44.442, "v3": -39.986, "v4": 20.287, "amplitude": 44.872, "phase_angle": 7.938, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.773, "filter_rmsd": 0.072, "frame": { "rmsd": 0.014, "origin": [ 15.436, 30.564, 89.111 ], "x_axis": [ 0.543, -0.383, 0.748 ], "y_axis": [ -0.713, 0.259, 0.651 ], "z_axis": [ -0.443, -0.887, -0.132 ], "quaternion": [ 0.646, 0.595, -0.461, 0.128 ] } }, { "index": 531, "index_chain": 56, "chain_name": "S", "nt_resnum": 56, "nt_name": "G", "nt_code": "G", "nt_id": "///S/56", "linked_nts": [ "///S/55", "///S/57" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor", "alpha": -63.696, "beta": 178.390, "gamma": 57.335, "delta": 79.553, "epsilon": -164.190, "zeta": -67.347, "epsilon_zeta": -96.843, "bb_type": "BI", "chi": -155.682, "glyco_bond": "anti", "C5prime_xyz": [ -1.556, 8.796, 0.378 ], "P_xyz": [ 1.021, 9.347, 0.350 ], "form": ".", "ssZp": 4.382, "Dp": 4.594, "splay_angle": 22.543, "splay_distance": 3.944, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 174.924, "theta": -128.169, "eta_prime": -170.113, "theta_prime": -138.884, "eta_base": -130.168, "theta_base": -116.836, "v0": 10.723, "v1": -35.482, "v2": 45.116, "v3": -39.748, "v4": 18.497, "amplitude": 45.285, "phase_angle": 4.956, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.874, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 15.999, 26.837, 88.910 ], "x_axis": [ 0.144, -0.138, 0.980 ], "y_axis": [ -0.933, 0.312, 0.181 ], "z_axis": [ -0.331, -0.940, -0.084 ], "quaternion": [ 0.586, 0.479, -0.559, 0.339 ] } }, { "index": 532, "index_chain": 57, "chain_name": "S", "nt_resnum": 57, "nt_name": "G", "nt_code": "G", "nt_id": "///S/57", "linked_nts": [ "///S/56", "///S/58" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": 152.073, "beta": -175.900, "gamma": -175.696, "delta": 94.153, "epsilon": -128.240, "zeta": -63.662, "epsilon_zeta": -64.578, "bb_type": "--", "chi": -175.721, "glyco_bond": "anti", "C5prime_xyz": [ -1.036, 8.119, 1.541 ], "P_xyz": [ 0.396, 10.114, 0.653 ], "form": ".", "ssZp": 4.611, "Dp": 4.663, "splay_angle": 28.917, "splay_distance": 4.500, "splay_ratio": 0.252, "d22": null, "d64": null, "eta": 175.213, "theta": -148.103, "eta_prime": -174.637, "theta_prime": -139.139, "eta_base": -132.015, "theta_base": -85.548, "v0": 18.830, "v1": -35.901, "v2": 38.489, "v3": -28.443, "v4": 6.137, "amplitude": 39.042, "phase_angle": 350.346, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.669, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 17.095, 23.245, 90.113 ], "x_axis": [ -0.312, 0.117, 0.943 ], "y_axis": [ -0.907, 0.259, -0.332 ], "z_axis": [ -0.283, -0.959, 0.025 ], "quaternion": [ -0.493, -0.318, 0.622, -0.519 ] } }, { "index": 533, "index_chain": 58, "chain_name": "S", "nt_resnum": 58, "nt_name": "A", "nt_code": "A", "nt_id": "///S/58", "linked_nts": [ "///S/57", "///S/59" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -58.236, "beta": 166.614, "gamma": 43.886, "delta": 78.158, "epsilon": -130.416, "zeta": -142.755, "epsilon_zeta": 12.340, "bb_type": "--", "chi": -157.691, "glyco_bond": "anti", "C5prime_xyz": [ -1.240, 8.760, 0.365 ], "P_xyz": [ 1.373, 9.118, 0.308 ], "form": ".", "ssZp": 4.305, "Dp": 4.797, "splay_angle": 101.211, "splay_distance": 14.074, "splay_ratio": 0.773, "d22": null, "d64": null, "eta": 156.722, "theta": 179.875, "eta_prime": -176.682, "theta_prime": 153.126, "eta_base": -104.943, "theta_base": 106.030, "v0": 6.225, "v1": -32.858, "v2": 45.625, "v3": -42.655, "v4": 23.040, "amplitude": 46.438, "phase_angle": 10.731, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.442, "filter_rmsd": 0.038, "frame": { "rmsd": 0.010, "origin": [ 14.883, 20.875, 93.235 ], "x_axis": [ -0.936, 0.224, 0.272 ], "y_axis": [ -0.296, -0.081, -0.952 ], "z_axis": [ -0.191, -0.971, 0.142 ], "quaternion": [ 0.177, 0.027, -0.654, 0.735 ] } }, { "index": 534, "index_chain": 59, "chain_name": "S", "nt_resnum": 59, "nt_name": "U", "nt_code": "U", "nt_id": "///S/59", "linked_nts": [ "///S/58", "///S/60" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": 66.310, "beta": -171.859, "gamma": 175.727, "delta": 156.126, "epsilon": -100.670, "zeta": -54.081, "epsilon_zeta": -46.589, "bb_type": "--", "chi": -141.748, "glyco_bond": "anti", "C5prime_xyz": [ -1.330, 8.460, 0.325 ], "P_xyz": [ 1.032, 9.313, -0.226 ], "form": ".", "ssZp": 0.302, "Dp": 0.526, "splay_angle": 118.949, "splay_distance": 16.652, "splay_ratio": 0.862, "d22": null, "d64": null, "eta": 128.919, "theta": -83.166, "eta_prime": 117.424, "theta_prime": -78.296, "eta_base": 87.126, "theta_base": -45.921, "v0": -8.683, "v1": 30.886, "v2": -40.607, "v3": 36.531, "v4": -17.758, "amplitude": 40.888, "phase_angle": 186.717, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.010, "origin": [ 21.881, 16.061, 82.013 ], "x_axis": [ -0.389, 0.799, -0.458 ], "y_axis": [ -0.847, -0.114, 0.520 ], "z_axis": [ 0.363, 0.590, 0.721 ], "quaternion": [ 0.552, -0.032, 0.372, 0.746 ] } }, { "index": 535, "index_chain": 60, "chain_name": "S", "nt_resnum": 60, "nt_name": "G", "nt_code": "G", "nt_id": "///S/60", "linked_nts": [ "///S/59", "///S/61" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -73.280, "beta": -176.987, "gamma": 68.096, "delta": 80.213, "epsilon": -153.808, "zeta": -57.918, "epsilon_zeta": -95.890, "bb_type": "BI", "chi": -173.746, "glyco_bond": "anti", "C5prime_xyz": [ -1.691, 8.567, 1.369 ], "P_xyz": [ 0.829, 8.840, 1.956 ], "form": ".", "ssZp": 4.485, "Dp": 4.520, "splay_angle": 23.009, "splay_distance": 3.547, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 164.571, "theta": -130.893, "eta_prime": -148.120, "theta_prime": -129.316, "eta_base": -126.131, "theta_base": -78.624, "v0": 2.773, "v1": -26.835, "v2": 39.458, "v3": -39.173, "v4": 22.984, "amplitude": 40.851, "phase_angle": 15.004, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.415, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 12.411, 14.938, 95.664 ], "x_axis": [ -0.758, -0.069, -0.649 ], "y_axis": [ 0.640, -0.273, -0.718 ], "z_axis": [ -0.127, -0.959, 0.252 ], "quaternion": [ -0.235, -0.257, -0.555, 0.755 ] } }, { "index": 536, "index_chain": 61, "chain_name": "S", "nt_resnum": 61, "nt_name": "A", "nt_code": "A", "nt_id": "///S/61", "linked_nts": [ "///S/60", "///S/62" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -91.202, "beta": -174.099, "gamma": 63.293, "delta": 80.169, "epsilon": -140.550, "zeta": -76.592, "epsilon_zeta": -63.957, "bb_type": "BI", "chi": -155.333, "glyco_bond": "anti", "C5prime_xyz": [ -1.363, 8.709, 0.244 ], "P_xyz": [ 1.233, 8.903, 0.295 ], "form": "A", "ssZp": 4.249, "Dp": 4.735, "splay_angle": 18.993, "splay_distance": 3.090, "splay_ratio": 0.165, "d22": null, "d64": null, "eta": 164.813, "theta": -141.760, "eta_prime": -177.496, "theta_prime": -143.902, "eta_base": -110.041, "theta_base": -122.247, "v0": 6.311, "v1": -30.597, "v2": 41.791, "v3": -39.022, "v4": 21.080, "amplitude": 42.465, "phase_angle": 10.222, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.391, "filter_rmsd": 0.036, "frame": { "rmsd": 0.009, "origin": [ 10.380, 12.126, 94.928 ], "x_axis": [ 0.007, -0.269, -0.963 ], "y_axis": [ 0.959, -0.270, 0.082 ], "z_axis": [ -0.282, -0.925, 0.256 ], "quaternion": [ -0.498, -0.505, -0.342, 0.616 ] } }, { "index": 537, "index_chain": 62, "chain_name": "S", "nt_resnum": 62, "nt_name": "C", "nt_code": "C", "nt_id": "///S/62", "linked_nts": [ "///S/61", "///S/63" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.547, "beta": 159.409, "gamma": 49.589, "delta": 74.205, "epsilon": -144.238, "zeta": -77.709, "epsilon_zeta": -66.529, "bb_type": "BI", "chi": -153.133, "glyco_bond": "anti", "C5prime_xyz": [ -1.342, 8.874, 0.122 ], "P_xyz": [ 1.178, 9.341, -0.345 ], "form": "A", "ssZp": 4.193, "Dp": 4.751, "splay_angle": 25.644, "splay_distance": 3.977, "splay_ratio": 0.222, "d22": 3.715, "d64": 3.682, "eta": 158.686, "theta": -150.303, "eta_prime": 170.871, "theta_prime": -146.464, "eta_base": -150.596, "theta_base": -113.127, "v0": 4.695, "v1": -30.396, "v2": 42.938, "v3": -41.298, "v4": 23.331, "amplitude": 43.997, "phase_angle": 12.600, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.790, "filter_rmsd": 0.069, "frame": { "rmsd": 0.008, "origin": [ 8.764, 9.494, 94.837 ], "x_axis": [ 0.518, -0.218, -0.827 ], "y_axis": [ 0.771, -0.300, 0.562 ], "z_axis": [ -0.370, -0.929, 0.012 ], "quaternion": [ 0.555, 0.672, 0.206, -0.446 ] } }, { "index": 538, "index_chain": 63, "chain_name": "S", "nt_resnum": 63, "nt_name": "U", "nt_code": "U", "nt_id": "///S/63", "linked_nts": [ "///S/62", "///S/64" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.512, "beta": 169.097, "gamma": 48.745, "delta": 79.662, "epsilon": -174.621, "zeta": -76.899, "epsilon_zeta": -97.722, "bb_type": "BI", "chi": -160.845, "glyco_bond": "anti", "C5prime_xyz": [ -1.341, 8.642, 0.588 ], "P_xyz": [ 1.272, 8.829, 0.582 ], "form": "A", "ssZp": 4.492, "Dp": 4.573, "splay_angle": 19.399, "splay_distance": 2.991, "splay_ratio": 0.170, "d22": 4.373, "d64": 4.139, "eta": 166.046, "theta": -143.072, "eta_prime": -176.721, "theta_prime": -147.732, "eta_base": -127.751, "theta_base": -125.515, "v0": 10.334, "v1": -33.485, "v2": 42.374, "v3": -37.811, "v4": 17.537, "amplitude": 42.539, "phase_angle": 5.052, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.791, "filter_rmsd": 0.110, "frame": { "rmsd": 0.009, "origin": [ 8.372, 5.984, 93.007 ], "x_axis": [ 0.943, -0.062, -0.326 ], "y_axis": [ 0.310, -0.188, 0.932 ], "z_axis": [ -0.119, -0.980, -0.158 ], "quaternion": [ 0.632, 0.757, 0.082, -0.147 ] } }, { "index": 539, "index_chain": 64, "chain_name": "S", "nt_resnum": 64, "nt_name": "C", "nt_code": "C", "nt_id": "///S/64", "linked_nts": [ "///S/63", "///S/65" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -165.423, "beta": -149.945, "gamma": 127.875, "delta": 84.156, "epsilon": -111.771, "zeta": -51.127, "epsilon_zeta": -60.645, "bb_type": "--", "chi": -169.365, "glyco_bond": "anti", "C5prime_xyz": [ -1.204, 8.569, 1.159 ], "P_xyz": [ 1.239, 8.915, 0.253 ], "form": "A", "ssZp": 4.546, "Dp": 4.765, "splay_angle": 23.771, "splay_distance": 3.930, "splay_ratio": 0.209, "d22": 4.064, "d64": 4.752, "eta": 168.129, "theta": -126.329, "eta_prime": 178.365, "theta_prime": -144.632, "eta_base": -144.388, "theta_base": -135.923, "v0": 9.960, "v1": -29.876, "v2": 37.442, "v3": -32.957, "v4": 14.472, "amplitude": 37.523, "phase_angle": 3.770, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.070, "frame": { "rmsd": 0.009, "origin": [ 8.259, 3.675, 91.110 ], "x_axis": [ 0.966, -0.087, 0.244 ], "y_axis": [ -0.259, -0.316, 0.913 ], "z_axis": [ -0.003, -0.945, -0.328 ], "quaternion": [ 0.575, 0.808, -0.107, 0.075 ] } }, { "index": 540, "index_chain": 65, "chain_name": "S", "nt_resnum": 65, "nt_name": "C", "nt_code": "C", "nt_id": "///S/65", "linked_nts": [ "///S/64", "///S/66" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -111.522, "beta": 78.603, "gamma": 151.887, "delta": 90.316, "epsilon": -106.466, "zeta": -78.433, "epsilon_zeta": -28.033, "bb_type": "--", "chi": 170.545, "glyco_bond": "anti", "C5prime_xyz": [ -0.799, 7.450, 2.271 ], "P_xyz": [ -0.046, 9.681, 1.087 ], "form": ".", "ssZp": 4.864, "Dp": 4.876, "splay_angle": 27.224, "splay_distance": 4.110, "splay_ratio": 0.238, "d22": 3.921, "d64": 3.829, "eta": 167.733, "theta": -161.033, "eta_prime": 172.067, "theta_prime": -148.214, "eta_base": -158.119, "theta_base": -98.205, "v0": 29.444, "v1": -42.688, "v2": 39.655, "v3": -23.670, "v4": -3.547, "amplitude": 43.106, "phase_angle": 336.919, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.022, "filter_rmsd": 0.070, "frame": { "rmsd": 0.010, "origin": [ 9.064, 0.946, 88.399 ], "x_axis": [ 0.811, -0.006, 0.585 ], "y_axis": [ -0.565, -0.270, 0.780 ], "z_axis": [ 0.154, -0.963, -0.222 ], "quaternion": [ 0.574, 0.759, -0.188, 0.243 ] } }, { "index": 541, "index_chain": 66, "chain_name": "S", "nt_resnum": 66, "nt_name": "C", "nt_code": "C", "nt_id": "///S/66", "linked_nts": [ "///S/65", "///S/67" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -42.117, "beta": 161.980, "gamma": 35.485, "delta": 78.968, "epsilon": -139.243, "zeta": -75.794, "epsilon_zeta": -63.449, "bb_type": "BI", "chi": -164.770, "glyco_bond": "anti", "C5prime_xyz": [ -1.168, 8.635, 0.867 ], "P_xyz": [ 1.426, 8.739, 1.283 ], "form": "A", "ssZp": 4.549, "Dp": 4.756, "splay_angle": 21.983, "splay_distance": 3.489, "splay_ratio": 0.193, "d22": null, "d64": null, "eta": 158.416, "theta": -144.355, "eta_prime": -177.283, "theta_prime": -142.850, "eta_base": -110.638, "theta_base": -124.926, "v0": 10.068, "v1": -33.622, "v2": 43.159, "v3": -38.871, "v4": 18.163, "amplitude": 43.376, "phase_angle": 5.737, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.060, "filter_rmsd": 0.066, "frame": { "rmsd": 0.005, "origin": [ 12.045, -1.793, 89.107 ], "x_axis": [ 0.029, -0.174, 0.984 ], "y_axis": [ -0.971, -0.237, -0.013 ], "z_axis": [ 0.236, -0.956, -0.176 ], "quaternion": [ 0.393, 0.600, -0.477, 0.508 ] } }, { "index": 542, "index_chain": 67, "chain_name": "S", "nt_resnum": 67, "nt_name": "G", "nt_code": "G", "nt_id": "///S/67", "linked_nts": [ "///S/66", "///S/68" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor", "alpha": -64.618, "beta": 173.176, "gamma": 45.973, "delta": 80.882, "epsilon": -176.279, "zeta": -78.839, "epsilon_zeta": -97.440, "bb_type": "BI", "chi": -165.165, "glyco_bond": "anti", "C5prime_xyz": [ -1.431, 8.629, 0.804 ], "P_xyz": [ 1.118, 9.206, 0.902 ], "form": "A", "ssZp": 4.545, "Dp": 4.554, "splay_angle": 25.396, "splay_distance": 3.955, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": 157.937, "theta": -139.132, "eta_prime": 172.503, "theta_prime": -141.303, "eta_base": -150.635, "theta_base": -108.127, "v0": 6.877, "v1": -31.353, "v2": 41.941, "v3": -39.787, "v4": 20.774, "amplitude": 42.564, "phase_angle": 9.815, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.861, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 14.360, -4.402, 89.190 ], "x_axis": [ -0.472, -0.060, 0.880 ], "y_axis": [ -0.853, -0.223, -0.473 ], "z_axis": [ 0.225, -0.973, 0.055 ], "quaternion": [ 0.300, 0.417, -0.546, 0.661 ] } }, { "index": 543, "index_chain": 68, "chain_name": "S", "nt_resnum": 68, "nt_name": "G", "nt_code": "G", "nt_id": "///S/68", "linked_nts": [ "///S/67", "///S/69" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor", "alpha": 175.181, "beta": -143.485, "gamma": 147.253, "delta": 77.621, "epsilon": -143.966, "zeta": -92.982, "epsilon_zeta": -50.984, "bb_type": "BI", "chi": -179.134, "glyco_bond": "anti", "C5prime_xyz": [ -1.214, 8.293, 1.703 ], "P_xyz": [ 0.935, 9.150, 0.518 ], "form": ".", "ssZp": 4.732, "Dp": 4.736, "splay_angle": 32.656, "splay_distance": 4.906, "splay_ratio": 0.289, "d22": null, "d64": null, "eta": 158.875, "theta": -165.417, "eta_prime": -179.044, "theta_prime": -168.030, "eta_base": -120.471, "theta_base": -164.069, "v0": 18.442, "v1": -42.195, "v2": 49.396, "v3": -39.759, "v4": 13.529, "amplitude": 49.454, "phase_angle": 357.232, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 15.312, -7.108, 91.913 ], "x_axis": [ -0.855, -0.307, 0.418 ], "y_axis": [ -0.357, -0.236, -0.904 ], "z_axis": [ 0.376, -0.922, 0.093 ], "quaternion": [ 0.017, 0.269, -0.618, 0.739 ] } }, { "index": 544, "index_chain": 69, "chain_name": "S", "nt_resnum": 69, "nt_name": "U", "nt_code": "U", "nt_id": "///S/69", "linked_nts": [ "///S/68", "///S/70" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor", "alpha": -53.524, "beta": 169.125, "gamma": 56.726, "delta": 75.457, "epsilon": -155.160, "zeta": -65.924, "epsilon_zeta": -89.236, "bb_type": "BI", "chi": -176.373, "glyco_bond": "anti", "C5prime_xyz": [ -1.594, 8.544, 1.495 ], "P_xyz": [ 0.969, 8.833, 1.877 ], "form": "A", "ssZp": 4.631, "Dp": 4.618, "splay_angle": 21.761, "splay_distance": 3.379, "splay_ratio": 0.195, "d22": 4.231, "d64": 4.195, "eta": 179.948, "theta": -143.518, "eta_prime": -176.458, "theta_prime": -142.032, "eta_base": -165.163, "theta_base": -109.005, "v0": 6.013, "v1": -32.652, "v2": 45.879, "v3": -43.356, "v4": 23.482, "amplitude": 46.783, "phase_angle": 11.284, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.590, "filter_rmsd": 0.109, "frame": { "rmsd": 0.009, "origin": [ 18.915, -9.131, 94.559 ], "x_axis": [ -0.967, -0.216, 0.134 ], "y_axis": [ -0.117, -0.093, -0.989 ], "z_axis": [ 0.226, -0.972, 0.065 ], "quaternion": [ -0.034, 0.124, -0.673, 0.729 ] } }, { "index": 545, "index_chain": 70, "chain_name": "S", "nt_resnum": 70, "nt_name": "U", "nt_code": "U", "nt_id": "///S/70", "linked_nts": [ "///S/69", "///S/71" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -87.216, "beta": -171.444, "gamma": 67.675, "delta": 77.882, "epsilon": -143.423, "zeta": -68.145, "epsilon_zeta": -75.278, "bb_type": "BI", "chi": -165.742, "glyco_bond": "anti", "C5prime_xyz": [ -1.421, 8.694, 0.876 ], "P_xyz": [ 1.204, 8.950, 1.070 ], "form": "A", "ssZp": 4.555, "Dp": 4.713, "splay_angle": 20.797, "splay_distance": 3.308, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": 168.467, "theta": -137.913, "eta_prime": -179.720, "theta_prime": -136.838, "eta_base": -131.092, "theta_base": -101.937, "v0": 8.905, "v1": -34.326, "v2": 45.669, "v3": -41.334, "v4": 20.623, "amplitude": 46.073, "phase_angle": 7.589, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.405, "filter_rmsd": 0.111, "frame": { "rmsd": 0.012, "origin": [ 18.337, -11.836, 96.501 ], "x_axis": [ -0.826, -0.210, -0.523 ], "y_axis": [ 0.542, -0.041, -0.839 ], "z_axis": [ 0.155, -0.977, 0.147 ], "quaternion": [ -0.265, -0.130, -0.640, 0.710 ] } }, { "index": 546, "index_chain": 71, "chain_name": "S", "nt_resnum": 71, "nt_name": "G", "nt_code": "G", "nt_id": "///S/71", "linked_nts": [ "///S/70", "///S/72" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -72.807, "beta": 175.718, "gamma": 58.491, "delta": 82.527, "epsilon": -157.851, "zeta": 101.710, "epsilon_zeta": 100.439, "bb_type": "--", "chi": -161.993, "glyco_bond": "anti", "C5prime_xyz": [ -1.499, 8.757, 0.660 ], "P_xyz": [ 1.095, 9.215, 0.822 ], "form": ".", "ssZp": 4.414, "Dp": 4.520, "splay_angle": 153.614, "splay_distance": 15.916, "splay_ratio": 0.974, "d22": null, "d64": null, "eta": 162.774, "theta": 17.905, "eta_prime": -179.834, "theta_prime": 17.344, "eta_base": -125.691, "theta_base": 62.642, "v0": 3.855, "v1": -27.270, "v2": 39.223, "v3": -38.074, "v4": 21.450, "amplitude": 40.293, "phase_angle": 13.239, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.894, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 16.650, -14.671, 96.747 ], "x_axis": [ -0.314, -0.000, -0.950 ], "y_axis": [ 0.948, -0.054, -0.313 ], "z_axis": [ -0.052, -0.999, 0.017 ], "quaternion": [ -0.403, -0.425, -0.557, 0.588 ] } }, { "index": 547, "index_chain": 72, "chain_name": "S", "nt_resnum": 72, "nt_name": "U", "nt_code": "U", "nt_id": "///S/72", "linked_nts": [ "///S/71", "///S/73" ], "nt_type": "RNA", "dbn": ".", "summary": "BII,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -30.387, "beta": -152.340, "gamma": -12.337, "delta": 172.508, "epsilon": -44.327, "zeta": -166.659, "epsilon_zeta": 122.332, "bb_type": "BII", "chi": 162.568, "glyco_bond": "--", "C5prime_xyz": [ -1.661, 6.334, 2.795 ], "P_xyz": [ -1.906, 5.227, 5.166 ], "form": ".", "ssZp": 0.788, "Dp": 1.632, "splay_angle": 123.618, "splay_distance": 16.145, "splay_ratio": 0.883, "d22": 9.972, "d64": 12.437, "eta": -125.693, "theta": -147.594, "eta_prime": -86.100, "theta_prime": -140.871, "eta_base": -114.774, "theta_base": -84.565, "v0": 16.740, "v1": 15.988, "v2": -40.584, "v3": 50.873, "v4": -42.693, "amplitude": 50.855, "phase_angle": 217.057, "puckering": "C4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.112, "frame": { "rmsd": 0.017, "origin": [ 31.369, -20.359, 98.827 ], "x_axis": [ 0.345, 0.927, 0.144 ], "y_axis": [ -0.536, 0.321, -0.781 ], "z_axis": [ -0.771, 0.193, 0.607 ], "quaternion": [ 0.754, -0.323, -0.303, 0.485 ] } }, { "index": 548, "index_chain": 73, "chain_name": "S", "nt_resnum": 73, "nt_name": "U", "nt_code": "U", "nt_id": "///S/73", "linked_nts": [ "///S/72", "///S/74" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart", "alpha": -70.520, "beta": -161.124, "gamma": 22.088, "delta": 89.684, "epsilon": -121.166, "zeta": -80.536, "epsilon_zeta": -40.629, "bb_type": "--", "chi": 178.793, "glyco_bond": "--", "C5prime_xyz": [ -0.879, 7.857, 1.785 ], "P_xyz": [ 1.133, 7.423, 3.375 ], "form": "A", "ssZp": 4.890, "Dp": 4.898, "splay_angle": 16.288, "splay_distance": 2.712, "splay_ratio": 0.152, "d22": 4.240, "d64": 4.437, "eta": -138.521, "theta": -132.502, "eta_prime": -142.023, "theta_prime": -125.362, "eta_base": -162.932, "theta_base": -99.576, "v0": 26.822, "v1": -43.414, "v2": 42.409, "v3": -27.755, "v4": 0.682, "amplitude": 44.530, "phase_angle": 342.243, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.012, "origin": [ 19.661, -28.256, 91.002 ], "x_axis": [ -0.049, 0.105, 0.993 ], "y_axis": [ 0.870, 0.493, -0.009 ], "z_axis": [ -0.491, 0.863, -0.115 ], "quaternion": [ 0.576, -0.378, -0.644, -0.332 ] } }, { "index": 549, "index_chain": 74, "chain_name": "S", "nt_resnum": 74, "nt_name": "C", "nt_code": "C", "nt_id": "///S/74", "linked_nts": [ "///S/73", "///S/75" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -56.927, "beta": 148.616, "gamma": 55.831, "delta": 71.791, "epsilon": -114.646, "zeta": -57.596, "epsilon_zeta": -57.050, "bb_type": "--", "chi": -165.942, "glyco_bond": "anti", "C5prime_xyz": [ -1.660, 8.845, 0.873 ], "P_xyz": [ 0.863, 9.372, 0.376 ], "form": "A", "ssZp": 4.372, "Dp": 4.785, "splay_angle": 25.928, "splay_distance": 4.173, "splay_ratio": 0.227, "d22": null, "d64": null, "eta": 162.243, "theta": -140.824, "eta_prime": -179.926, "theta_prime": -156.058, "eta_base": -138.494, "theta_base": -148.313, "v0": 3.068, "v1": -31.418, "v2": 46.508, "v3": -45.963, "v4": 26.924, "amplitude": 48.153, "phase_angle": 15.017, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.361, "filter_rmsd": 0.066, "frame": { "rmsd": 0.009, "origin": [ 17.171, -27.492, 91.757 ], "x_axis": [ 0.309, 0.446, 0.840 ], "y_axis": [ 0.601, 0.594, -0.536 ], "z_axis": [ -0.738, 0.670, -0.084 ], "quaternion": [ 0.674, -0.447, -0.585, -0.057 ] } }, { "index": 550, "index_chain": 75, "chain_name": "S", "nt_resnum": 75, "nt_name": "A", "nt_code": "A", "nt_id": "///S/75", "linked_nts": [ "///S/74", "///S/76" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -110.777, "beta": 72.639, "gamma": 154.174, "delta": 95.241, "epsilon": -127.888, "zeta": -68.663, "epsilon_zeta": -59.226, "bb_type": "BI", "chi": 165.931, "glyco_bond": "anti", "C5prime_xyz": [ -0.684, 7.128, 2.388 ], "P_xyz": [ -0.010, 9.427, 1.279 ], "form": ".", "ssZp": 4.787, "Dp": 4.844, "splay_angle": 29.810, "splay_distance": 4.325, "splay_ratio": 0.260, "d22": null, "d64": null, "eta": 176.119, "theta": -146.619, "eta_prime": 170.216, "theta_prime": -139.411, "eta_base": -168.156, "theta_base": -87.756, "v0": 31.143, "v1": -42.318, "v2": 37.266, "v3": -20.150, "v4": -6.793, "amplitude": 42.073, "phase_angle": 332.343, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.054, "filter_rmsd": 0.040, "frame": { "rmsd": 0.010, "origin": [ 13.289, -26.083, 92.359 ], "x_axis": [ 0.694, 0.259, 0.671 ], "y_axis": [ 0.545, 0.420, -0.726 ], "z_axis": [ -0.470, 0.870, 0.150 ], "quaternion": [ 0.752, -0.530, -0.379, -0.095 ] } }, { "index": 551, "index_chain": 76, "chain_name": "S", "nt_resnum": 76, "nt_name": "U", "nt_code": "U", "nt_id": "///S/76", "linked_nts": [ "///S/75", "///S/77" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -150.922, "beta": -141.215, "gamma": 97.666, "delta": 77.159, "epsilon": -135.649, "zeta": -101.300, "epsilon_zeta": -34.349, "bb_type": "BI", "chi": -167.101, "glyco_bond": "anti", "C5prime_xyz": [ -1.214, 8.598, 0.999 ], "P_xyz": [ 1.392, 8.508, 0.685 ], "form": "A", "ssZp": 4.682, "Dp": 4.857, "splay_angle": 20.017, "splay_distance": 3.054, "splay_ratio": 0.175, "d22": 4.491, "d64": 4.454, "eta": 138.110, "theta": -153.208, "eta_prime": 168.820, "theta_prime": -152.880, "eta_base": -118.758, "theta_base": -140.202, "v0": 11.836, "v1": -36.535, "v2": 45.917, "v3": -40.138, "v4": 18.100, "amplitude": 46.029, "phase_angle": 3.994, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.109, "frame": { "rmsd": 0.009, "origin": [ 14.037, -22.621, 94.842 ], "x_axis": [ 0.844, 0.408, -0.347 ], "y_axis": [ -0.417, 0.094, -0.904 ], "z_axis": [ -0.336, 0.908, 0.250 ], "quaternion": [ 0.740, -0.612, 0.004, 0.279 ] } }, { "index": 552, "index_chain": 77, "chain_name": "S", "nt_resnum": 77, "nt_name": "C", "nt_code": "C", "nt_id": "///S/77", "linked_nts": [ "///S/76", "///S/78" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,hairpin-loop", "alpha": -43.339, "beta": 143.086, "gamma": 50.591, "delta": 79.177, "epsilon": -117.753, "zeta": -137.752, "epsilon_zeta": 19.999, "bb_type": "--", "chi": -161.763, "glyco_bond": "anti", "C5prime_xyz": [ -1.308, 8.813, 0.639 ], "P_xyz": [ 1.312, 8.793, 0.154 ], "form": "A", "ssZp": 4.407, "Dp": 4.847, "splay_angle": 16.663, "splay_distance": 2.714, "splay_ratio": 0.146, "d22": null, "d64": null, "eta": 175.844, "theta": -133.938, "eta_prime": -176.439, "theta_prime": -140.024, "eta_base": -152.509, "theta_base": -137.843, "v0": 8.166, "v1": -32.771, "v2": 43.570, "v3": -39.576, "v4": 20.012, "amplitude": 43.989, "phase_angle": 7.919, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.204, "filter_rmsd": 0.069, "frame": { "rmsd": 0.008, "origin": [ 13.799, -20.327, 96.844 ], "x_axis": [ 0.605, 0.392, -0.693 ], "y_axis": [ -0.780, 0.117, -0.614 ], "z_axis": [ -0.160, 0.912, 0.377 ], "quaternion": [ 0.724, -0.527, 0.184, 0.405 ] } }, { "index": 553, "index_chain": 78, "chain_name": "S", "nt_resnum": 78, "nt_name": "A", "nt_code": "A", "nt_id": "///S/78", "linked_nts": [ "///S/77", "///S/79" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": 113.920, "beta": -93.052, "gamma": 171.666, "delta": 72.742, "epsilon": -127.158, "zeta": -78.075, "epsilon_zeta": -49.082, "bb_type": "--", "chi": -177.060, "glyco_bond": "anti", "C5prime_xyz": [ -2.006, 8.633, 1.455 ], "P_xyz": [ -0.456, 9.429, -0.527 ], "form": "A", "ssZp": 4.618, "Dp": 4.680, "splay_angle": 26.219, "splay_distance": 4.126, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": 159.329, "theta": -147.812, "eta_prime": 177.083, "theta_prime": -155.344, "eta_base": -162.044, "theta_base": -110.883, "v0": -3.029, "v1": -24.605, "v2": 41.434, "v3": -44.295, "v4": 29.834, "amplitude": 44.814, "phase_angle": 22.398, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.005, "origin": [ 14.471, -18.149, 98.316 ], "x_axis": [ 0.411, 0.210, -0.887 ], "y_axis": [ -0.897, 0.265, -0.353 ], "z_axis": [ 0.161, 0.941, 0.298 ], "quaternion": [ 0.702, -0.461, 0.373, 0.394 ] } }, { "index": 554, "index_chain": 79, "chain_name": "S", "nt_resnum": 79, "nt_name": "C", "nt_code": "C", "nt_id": "///S/79", "linked_nts": [ "///S/78", "///S/80" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -57.795, "beta": 160.785, "gamma": 47.770, "delta": 73.989, "epsilon": -152.353, "zeta": -74.452, "epsilon_zeta": -77.901, "bb_type": "BI", "chi": -168.128, "glyco_bond": "anti", "C5prime_xyz": [ -1.329, 8.716, 1.025 ], "P_xyz": [ 1.258, 9.115, 1.059 ], "form": "A", "ssZp": 4.674, "Dp": 4.748, "splay_angle": 23.612, "splay_distance": 3.566, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 156.887, "theta": -156.462, "eta_prime": 174.117, "theta_prime": -153.495, "eta_base": -117.832, "theta_base": -134.928, "v0": 8.701, "v1": -35.165, "v2": 46.608, "v3": -42.778, "v4": 21.729, "amplitude": 47.088, "phase_angle": 8.189, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.549, "filter_rmsd": 0.066, "frame": { "rmsd": 0.006, "origin": [ 16.270, -14.635, 97.115 ], "x_axis": [ -0.416, 0.249, -0.874 ], "y_axis": [ -0.894, 0.064, 0.444 ], "z_axis": [ 0.167, 0.966, 0.196 ], "quaternion": [ 0.459, -0.284, 0.567, 0.622 ] } }, { "index": 555, "index_chain": 80, "chain_name": "S", "nt_resnum": 80, "nt_name": "A", "nt_code": "A", "nt_id": "///S/80", "linked_nts": [ "///S/79", "///S/81" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet", "alpha": -66.167, "beta": -163.131, "gamma": 35.597, "delta": 80.746, "epsilon": -158.591, "zeta": -91.842, "epsilon_zeta": -66.749, "bb_type": "BI", "chi": -162.693, "glyco_bond": "anti", "C5prime_xyz": [ -0.987, 8.478, 0.741 ], "P_xyz": [ 1.434, 8.574, 1.750 ], "form": "A", "ssZp": 4.570, "Dp": 4.695, "splay_angle": 20.185, "splay_distance": 3.019, "splay_ratio": 0.176, "d22": null, "d64": null, "eta": 168.023, "theta": -145.041, "eta_prime": 171.034, "theta_prime": -145.317, "eta_base": -162.338, "theta_base": -118.237, "v0": 14.874, "v1": -37.591, "v2": 44.575, "v3": -37.377, "v4": 14.284, "amplitude": 44.576, "phase_angle": 359.664, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.384, "filter_rmsd": 0.035, "frame": { "rmsd": 0.007, "origin": [ 18.210, -11.666, 96.745 ], "x_axis": [ -0.836, -0.164, -0.523 ], "y_axis": [ -0.528, -0.018, 0.849 ], "z_axis": [ -0.149, 0.986, -0.072 ], "quaternion": [ 0.136, -0.252, 0.687, 0.667 ] } }, { "index": 556, "index_chain": 81, "chain_name": "S", "nt_resnum": 81, "nt_name": "A", "nt_code": "A", "nt_id": "///S/81", "linked_nts": [ "///S/80", "///S/82" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,ribose-zipper", "alpha": 172.155, "beta": -150.558, "gamma": 144.982, "delta": 83.778, "epsilon": -121.504, "zeta": -78.892, "epsilon_zeta": -42.612, "bb_type": "--", "chi": -175.668, "glyco_bond": "anti", "C5prime_xyz": [ -0.708, 8.045, 1.433 ], "P_xyz": [ 1.395, 8.600, -0.059 ], "form": ".", "ssZp": 4.832, "Dp": 4.908, "splay_angle": 29.084, "splay_distance": 4.521, "splay_ratio": 0.259, "d22": null, "d64": null, "eta": 154.888, "theta": -137.654, "eta_prime": 169.209, "theta_prime": -140.068, "eta_base": -147.655, "theta_base": -124.146, "v0": 24.576, "v1": -43.764, "v2": 45.257, "v3": -32.138, "v4": 5.004, "amplitude": 46.378, "phase_angle": 347.375, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 17.943, -9.112, 95.158 ], "x_axis": [ -0.987, -0.158, -0.016 ], "y_axis": [ -0.062, 0.292, 0.954 ], "z_axis": [ -0.146, 0.943, -0.298 ], "quaternion": [ -0.040, -0.069, 0.803, 0.591 ] } }, { "index": 557, "index_chain": 82, "chain_name": "S", "nt_resnum": 82, "nt_name": "C", "nt_code": "C", "nt_id": "///S/82", "linked_nts": [ "///S/81", "///S/83" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper", "alpha": -67.078, "beta": 146.972, "gamma": 87.756, "delta": 79.813, "epsilon": -120.683, "zeta": -90.591, "epsilon_zeta": -30.092, "bb_type": "--", "chi": 176.759, "glyco_bond": "anti", "C5prime_xyz": [ -1.554, 8.441, 1.872 ], "P_xyz": [ 0.921, 9.159, 1.321 ], "form": "A", "ssZp": 4.756, "Dp": 4.770, "splay_angle": 26.894, "splay_distance": 4.225, "splay_ratio": 0.235, "d22": 4.367, "d64": 4.592, "eta": -179.603, "theta": -146.160, "eta_prime": -160.047, "theta_prime": -146.365, "eta_base": -120.439, "theta_base": -122.481, "v0": 8.245, "v1": -32.765, "v2": 43.532, "v3": -39.279, "v4": 19.727, "amplitude": 43.923, "phase_angle": 7.650, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.072, "frame": { "rmsd": 0.012, "origin": [ 15.692, -6.651, 92.106 ], "x_axis": [ -0.879, 0.029, 0.476 ], "y_axis": [ 0.459, 0.325, 0.827 ], "z_axis": [ -0.131, 0.945, -0.299 ], "quaternion": [ -0.192, 0.154, 0.791, 0.560 ] } }, { "index": 558, "index_chain": 83, "chain_name": "S", "nt_resnum": 83, "nt_name": "C", "nt_code": "C", "nt_id": "///S/83", "linked_nts": [ "///S/82", "///S/84" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor,ribose-zipper", "alpha": -65.229, "beta": 151.566, "gamma": 67.719, "delta": 78.292, "epsilon": -139.938, "zeta": -88.645, "epsilon_zeta": -51.293, "bb_type": "BI", "chi": 176.179, "glyco_bond": "anti", "C5prime_xyz": [ -1.904, 8.561, 1.825 ], "P_xyz": [ 0.642, 9.007, 2.183 ], "form": "A", "ssZp": 4.450, "Dp": 4.514, "splay_angle": 19.112, "splay_distance": 2.997, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": 168.716, "theta": -153.196, "eta_prime": -176.730, "theta_prime": -146.394, "eta_base": -136.638, "theta_base": -130.990, "v0": -0.137, "v1": -25.209, "v2": 39.916, "v3": -40.715, "v4": 25.696, "amplitude": 42.116, "phase_angle": 18.598, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.319, "filter_rmsd": 0.072, "frame": { "rmsd": 0.012, "origin": [ 13.701, -3.651, 89.897 ], "x_axis": [ -0.443, -0.017, 0.896 ], "y_axis": [ 0.886, 0.148, 0.440 ], "z_axis": [ -0.140, 0.989, -0.050 ], "quaternion": [ -0.405, 0.339, 0.641, 0.558 ] } }, { "index": 559, "index_chain": 84, "chain_name": "S", "nt_resnum": 84, "nt_name": "G", "nt_code": "G", "nt_id": "///S/84", "linked_nts": [ "///S/83", "///S/85" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -52.242, "beta": 167.553, "gamma": 68.540, "delta": 132.845, "epsilon": -90.807, "zeta": 59.413, "epsilon_zeta": 209.779, "bb_type": "--", "chi": -128.384, "glyco_bond": "anti", "C5prime_xyz": [ -1.672, 8.700, -0.921 ], "P_xyz": [ 0.932, 9.069, -0.683 ], "form": ".", "ssZp": 0.995, "Dp": 1.406, "splay_angle": 71.491, "splay_distance": 11.462, "splay_ratio": 0.588, "d22": null, "d64": null, "eta": -145.957, "theta": 101.553, "eta_prime": -131.166, "theta_prime": 105.972, "eta_base": -118.675, "theta_base": 131.908, "v0": -18.678, "v1": 27.793, "v2": -26.055, "v3": 15.999, "v4": 1.524, "amplitude": 28.052, "phase_angle": 158.247, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.449, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 11.981, -1.479, 88.752 ], "x_axis": [ 0.042, 0.192, 0.981 ], "y_axis": [ 0.907, 0.405, -0.118 ], "z_axis": [ -0.419, 0.894, -0.157 ], "quaternion": [ 0.568, -0.446, -0.616, -0.315 ] } }, { "index": 560, "index_chain": 85, "chain_name": "S", "nt_resnum": 85, "nt_name": "C", "nt_code": "C", "nt_id": "///S/85", "linked_nts": [ "///S/84", "///S/86" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,ss-non-loop", "alpha": 152.871, "beta": -112.869, "gamma": 163.563, "delta": 123.113, "epsilon": -78.707, "zeta": 121.596, "epsilon_zeta": 159.697, "bb_type": "--", "chi": -126.372, "glyco_bond": "anti", "C5prime_xyz": [ -2.282, 8.837, -1.364 ], "P_xyz": [ -0.055, 8.528, -2.775 ], "form": ".", "ssZp": 0.545, "Dp": 0.693, "splay_angle": 28.863, "splay_distance": 5.295, "splay_ratio": 0.291, "d22": null, "d64": null, "eta": -101.320, "theta": 76.999, "eta_prime": -115.006, "theta_prime": 70.570, "eta_base": -126.315, "theta_base": 79.153, "v0": -34.827, "v1": 37.739, "v2": -27.235, "v3": 7.741, "v4": 16.970, "amplitude": 38.053, "phase_angle": 135.701, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.009, "origin": [ 16.162, -5.750, 78.971 ], "x_axis": [ -0.768, 0.489, -0.415 ], "y_axis": [ 0.506, 0.859, 0.075 ], "z_axis": [ 0.393, -0.152, -0.907 ], "quaternion": [ 0.215, 0.265, 0.940, -0.020 ] } }, { "index": 561, "index_chain": 86, "chain_name": "S", "nt_resnum": 86, "nt_name": "A", "nt_code": "A", "nt_id": "///S/86", "linked_nts": [ "///S/85", "///S/87" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,A-minor,ribose-zipper", "alpha": -170.686, "beta": 128.968, "gamma": 96.050, "delta": 94.354, "epsilon": -155.285, "zeta": -66.597, "epsilon_zeta": -88.688, "bb_type": "BI", "chi": -124.072, "glyco_bond": "anti", "C5prime_xyz": [ -0.782, 8.014, -1.477 ], "P_xyz": [ 0.378, 6.802, -3.571 ], "form": ".", "ssZp": 2.938, "Dp": 4.612, "splay_angle": 18.976, "splay_distance": 3.152, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 133.096, "theta": -136.173, "eta_prime": 146.678, "theta_prime": -151.237, "eta_base": 157.965, "theta_base": -140.623, "v0": 24.479, "v1": -36.344, "v2": 34.371, "v3": -20.894, "v4": -2.037, "amplitude": 36.977, "phase_angle": 338.361, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 18.755, -4.795, 83.488 ], "x_axis": [ 0.253, -0.708, -0.659 ], "y_axis": [ 0.967, 0.214, 0.141 ], "z_axis": [ 0.041, -0.673, 0.739 ], "quaternion": [ 0.743, 0.274, 0.236, -0.564 ] } }, { "index": 562, "index_chain": 87, "chain_name": "S", "nt_resnum": 87, "nt_name": "A", "nt_code": "A", "nt_id": "///S/87", "linked_nts": [ "///S/86", "///S/88" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,ribose-zipper,cap-acceptor,splayed-apart", "alpha": -75.483, "beta": 170.620, "gamma": 68.780, "delta": 90.144, "epsilon": -160.607, "zeta": -130.884, "epsilon_zeta": -29.723, "bb_type": "--", "chi": -119.244, "glyco_bond": "anti", "C5prime_xyz": [ -1.658, 8.375, -1.702 ], "P_xyz": [ 0.715, 8.276, -2.803 ], "form": ".", "ssZp": 2.677, "Dp": 4.290, "splay_angle": 151.392, "splay_distance": 18.738, "splay_ratio": 0.969, "d22": null, "d64": null, "eta": 170.540, "theta": 153.749, "eta_prime": -168.027, "theta_prime": 164.645, "eta_base": -138.622, "theta_base": -136.405, "v0": 1.361, "v1": -19.418, "v2": 29.127, "v3": -28.987, "v4": 17.567, "amplitude": 30.307, "phase_angle": 16.042, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.333, "filter_rmsd": 0.036, "frame": { "rmsd": 0.006, "origin": [ 19.789, -7.346, 85.025 ], "x_axis": [ 0.582, -0.465, -0.666 ], "y_axis": [ 0.800, 0.181, 0.572 ], "z_axis": [ -0.146, -0.866, 0.478 ], "quaternion": [ 0.749, 0.480, 0.174, -0.423 ] } }, { "index": 563, "index_chain": 88, "chain_name": "S", "nt_resnum": 88, "nt_name": "G", "nt_code": "G", "nt_id": "///S/88", "linked_nts": [ "///S/87", "///S/89" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,ribose-zipper,splayed-apart", "alpha": -72.651, "beta": -167.753, "gamma": 156.029, "delta": 90.739, "epsilon": -108.652, "zeta": -70.714, "epsilon_zeta": -37.937, "bb_type": "--", "chi": 179.332, "glyco_bond": "anti", "C5prime_xyz": [ -1.112, 8.048, 1.862 ], "P_xyz": [ 1.109, 9.275, 1.110 ], "form": "A", "ssZp": 4.656, "Dp": 4.714, "splay_angle": 21.536, "splay_distance": 3.495, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": -55.987, "theta": -131.949, "eta_prime": -82.905, "theta_prime": -133.513, "eta_base": -135.894, "theta_base": -89.537, "v0": 18.161, "v1": -32.314, "v2": 34.258, "v3": -24.773, "v4": 4.228, "amplitude": 34.961, "phase_angle": 348.488, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 29.784, -11.022, 100.443 ], "x_axis": [ 0.729, -0.159, -0.666 ], "y_axis": [ -0.589, 0.350, -0.728 ], "z_axis": [ 0.348, 0.923, 0.162 ], "quaternion": [ 0.748, -0.552, 0.339, 0.144 ] } }, { "index": 564, "index_chain": 89, "chain_name": "S", "nt_resnum": 89, "nt_name": "C", "nt_code": "C", "nt_id": "///S/89", "linked_nts": [ "///S/88", "///S/90" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -82.885, "beta": 151.022, "gamma": 75.636, "delta": 75.706, "epsilon": -144.471, "zeta": -119.189, "epsilon_zeta": -25.282, "bb_type": "--", "chi": -168.593, "glyco_bond": "anti", "C5prime_xyz": [ -1.452, 8.792, 1.000 ], "P_xyz": [ 0.931, 9.476, 0.046 ], "form": "A", "ssZp": 4.688, "Dp": 4.769, "splay_angle": 22.187, "splay_distance": 3.431, "splay_ratio": 0.196, "d22": 4.656, "d64": 4.371, "eta": 141.681, "theta": -158.262, "eta_prime": 170.460, "theta_prime": -158.810, "eta_base": -119.040, "theta_base": -143.475, "v0": 7.190, "v1": -33.929, "v2": 46.344, "v3": -42.913, "v4": 22.703, "amplitude": 47.023, "phase_angle": 9.746, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.043, "filter_rmsd": 0.066, "frame": { "rmsd": 0.007, "origin": [ 32.730, -9.302, 99.683 ], "x_axis": [ 0.129, 0.136, -0.982 ], "y_axis": [ -0.828, 0.559, -0.031 ], "z_axis": [ 0.545, 0.818, 0.184 ], "quaternion": [ 0.684, -0.310, 0.558, 0.352 ] } }, { "index": 565, "index_chain": 90, "chain_name": "S", "nt_resnum": 90, "nt_name": "U", "nt_code": "U", "nt_id": "///S/90", "linked_nts": [ "///S/89", "///S/91" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 21.752, "beta": 132.417, "gamma": 2.122, "delta": 79.996, "epsilon": -153.930, "zeta": -77.452, "epsilon_zeta": -76.478, "bb_type": "BI", "chi": -150.690, "glyco_bond": "anti", "C5prime_xyz": [ -1.184, 8.777, -0.091 ], "P_xyz": [ 1.436, 8.961, 0.428 ], "form": "A", "ssZp": 4.271, "Dp": 4.747, "splay_angle": 25.325, "splay_distance": 3.928, "splay_ratio": 0.219, "d22": 4.034, "d64": 4.175, "eta": 172.558, "theta": -151.172, "eta_prime": 175.641, "theta_prime": -146.798, "eta_base": -160.898, "theta_base": -120.300, "v0": 10.678, "v1": -35.030, "v2": 44.360, "v3": -38.804, "v4": 18.115, "amplitude": 44.509, "phase_angle": 4.694, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.111, "frame": { "rmsd": 0.012, "origin": [ 35.877, -7.953, 99.905 ], "x_axis": [ -0.429, 0.207, -0.879 ], "y_axis": [ -0.670, 0.580, 0.464 ], "z_axis": [ 0.606, 0.788, -0.110 ], "quaternion": [ 0.510, -0.159, 0.728, 0.430 ] } }, { "index": 566, "index_chain": 91, "chain_name": "S", "nt_resnum": 91, "nt_name": "U", "nt_code": "U", "nt_id": "///S/91", "linked_nts": [ "///S/90", "///S/92" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -53.625, "beta": 159.234, "gamma": 56.969, "delta": 85.210, "epsilon": -143.853, "zeta": -13.906, "epsilon_zeta": -129.948, "bb_type": "--", "chi": -163.283, "glyco_bond": "anti", "C5prime_xyz": [ -1.265, 8.678, 0.801 ], "P_xyz": [ 1.389, 8.851, 0.643 ], "form": ".", "ssZp": 4.538, "Dp": 4.693, "splay_angle": 19.988, "splay_distance": 3.648, "splay_ratio": 0.187, "d22": 4.401, "d64": 5.224, "eta": 177.639, "theta": -104.661, "eta_prime": -167.715, "theta_prime": -127.653, "eta_base": -130.334, "theta_base": -125.998, "v0": 11.097, "v1": -31.158, "v2": 38.316, "v3": -32.453, "v4": 13.743, "amplitude": 38.337, "phase_angle": 1.914, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.788, "filter_rmsd": 0.109, "frame": { "rmsd": 0.009, "origin": [ 38.101, -5.281, 98.078 ], "x_axis": [ -0.791, 0.346, -0.504 ], "y_axis": [ -0.352, 0.416, 0.838 ], "z_axis": [ 0.500, 0.841, -0.207 ], "quaternion": [ 0.323, -0.002, 0.777, 0.541 ] } }, { "index": 567, "index_chain": 92, "chain_name": "S", "nt_resnum": 92, "nt_name": "U", "nt_code": "U", "nt_id": "///S/92", "linked_nts": [ "///S/91", "///S/93" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -142.579, "beta": 86.033, "gamma": 157.492, "delta": 83.945, "epsilon": -124.639, "zeta": -65.955, "epsilon_zeta": -58.684, "bb_type": "--", "chi": -171.716, "glyco_bond": "anti", "C5prime_xyz": [ -1.036, 8.353, 1.269 ], "P_xyz": [ -1.279, 10.358, -0.456 ], "form": ".", "ssZp": 4.731, "Dp": 4.852, "splay_angle": 40.013, "splay_distance": 5.931, "splay_ratio": 0.342, "d22": 3.536, "d64": 4.040, "eta": 161.510, "theta": -175.703, "eta_prime": 170.763, "theta_prime": -158.696, "eta_base": -164.838, "theta_base": -111.843, "v0": 19.033, "v1": -39.338, "v2": 43.861, "v3": -33.680, "v4": 9.473, "amplitude": 44.138, "phase_angle": 353.568, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.010, "origin": [ 39.575, -3.643, 95.170 ], "x_axis": [ -0.884, 0.398, -0.245 ], "y_axis": [ -0.025, 0.483, 0.876 ], "z_axis": [ 0.467, 0.780, -0.416 ], "quaternion": [ 0.213, 0.112, 0.834, 0.496 ] } }, { "index": 568, "index_chain": 93, "chain_name": "S", "nt_resnum": 93, "nt_name": "U", "nt_code": "U", "nt_id": "///S/93", "linked_nts": [ "///S/92", "///S/94" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -65.216, "beta": 174.523, "gamma": 54.419, "delta": 83.571, "epsilon": -117.054, "zeta": -102.098, "epsilon_zeta": -14.957, "bb_type": "--", "chi": 178.547, "glyco_bond": "anti", "C5prime_xyz": [ -1.401, 8.247, 1.797 ], "P_xyz": [ 1.184, 8.359, 2.337 ], "form": ".", "ssZp": 4.851, "Dp": 4.854, "splay_angle": 19.344, "splay_distance": 3.025, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 170.004, "theta": -153.488, "eta_prime": -168.403, "theta_prime": -152.039, "eta_base": -108.260, "theta_base": -169.772, "v0": 14.338, "v1": -35.928, "v2": 42.768, "v3": -35.506, "v4": 13.396, "amplitude": 42.770, "phase_angle": 359.406, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.669, "filter_rmsd": 0.107, "frame": { "rmsd": 0.009, "origin": [ 37.989, 1.704, 93.153 ], "x_axis": [ -0.621, 0.343, 0.705 ], "y_axis": [ 0.671, -0.233, 0.704 ], "z_axis": [ 0.406, 0.910, -0.086 ], "quaternion": [ -0.123, 0.418, 0.607, 0.665 ] } }, { "index": 569, "index_chain": 94, "chain_name": "S", "nt_resnum": 94, "nt_name": "A", "nt_code": "A", "nt_id": "///S/94", "linked_nts": [ "///S/93", "///S/95" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -90.119, "beta": 142.646, "gamma": 82.951, "delta": 85.774, "epsilon": -156.865, "zeta": -60.111, "epsilon_zeta": -96.754, "bb_type": "BI", "chi": -163.242, "glyco_bond": "anti", "C5prime_xyz": [ -1.567, 8.709, 0.731 ], "P_xyz": [ 0.816, 9.079, -0.408 ], "form": "A", "ssZp": 4.441, "Dp": 4.505, "splay_angle": 20.152, "splay_distance": 3.338, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 155.120, "theta": -133.025, "eta_prime": 168.884, "theta_prime": -143.404, "eta_base": 163.487, "theta_base": -110.253, "v0": 2.687, "v1": -23.302, "v2": 33.718, "v3": -32.912, "v4": 19.299, "amplitude": 34.778, "phase_angle": 14.181, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.079, "filter_rmsd": 0.035, "frame": { "rmsd": 0.007, "origin": [ 38.226, 2.750, 90.324 ], "x_axis": [ -0.433, 0.153, 0.888 ], "y_axis": [ 0.900, 0.124, 0.418 ], "z_axis": [ -0.046, 0.980, -0.192 ], "quaternion": [ -0.353, 0.398, 0.661, 0.529 ] } }, { "index": 570, "index_chain": 95, "chain_name": "S", "nt_resnum": 95, "nt_name": "C", "nt_code": "C", "nt_id": "///S/95", "linked_nts": [ "///S/94", "///S/96" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -81.781, "beta": 179.994, "gamma": 59.224, "delta": 75.492, "epsilon": -154.552, "zeta": -68.475, "epsilon_zeta": -86.077, "bb_type": "BI", "chi": -144.330, "glyco_bond": "anti", "C5prime_xyz": [ -1.590, 8.959, -0.392 ], "P_xyz": [ 0.948, 9.604, -0.798 ], "form": "A", "ssZp": 3.907, "Dp": 4.610, "splay_angle": 26.675, "splay_distance": 4.277, "splay_ratio": 0.231, "d22": 3.670, "d64": 3.876, "eta": 161.109, "theta": -150.448, "eta_prime": 178.743, "theta_prime": -148.322, "eta_base": -125.919, "theta_base": -116.991, "v0": 2.088, "v1": -28.352, "v2": 42.355, "v3": -42.105, "v4": 25.315, "amplitude": 44.026, "phase_angle": 15.838, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.650, "filter_rmsd": 0.070, "frame": { "rmsd": 0.010, "origin": [ 36.477, 5.507, 91.020 ], "x_axis": [ 0.218, 0.288, 0.933 ], "y_axis": [ 0.923, 0.249, -0.292 ], "z_axis": [ -0.316, 0.925, -0.211 ], "quaternion": [ 0.560, -0.543, -0.557, -0.284 ] } }, { "index": 571, "index_chain": 96, "chain_name": "S", "nt_resnum": 96, "nt_name": "U", "nt_code": "U", "nt_id": "///S/96", "linked_nts": [ "///S/95", "///S/97" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop,splayed-apart", "alpha": -63.064, "beta": 171.428, "gamma": 54.721, "delta": 78.756, "epsilon": -141.938, "zeta": 127.847, "epsilon_zeta": 90.216, "bb_type": "--", "chi": -160.551, "glyco_bond": "anti", "C5prime_xyz": [ -1.450, 8.753, 0.629 ], "P_xyz": [ 1.136, 9.200, 0.615 ], "form": ".", "ssZp": 4.444, "Dp": 4.711, "splay_angle": 176.044, "splay_distance": 19.177, "splay_ratio": 0.999, "d22": 11.434, "d64": 14.810, "eta": 171.167, "theta": 36.808, "eta_prime": -175.216, "theta_prime": 31.696, "eta_base": -130.966, "theta_base": -77.182, "v0": 9.422, "v1": -33.953, "v2": 44.568, "v3": -40.251, "v4": 19.351, "amplitude": 44.878, "phase_angle": 6.747, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.875, "filter_rmsd": 0.111, "frame": { "rmsd": 0.011, "origin": [ 35.538, 9.513, 92.190 ], "x_axis": [ 0.752, 0.111, 0.649 ], "y_axis": [ 0.650, 0.033, -0.759 ], "z_axis": [ -0.106, 0.993, -0.047 ], "quaternion": [ 0.659, -0.664, -0.286, -0.204 ] } }, { "index": 572, "index_chain": 97, "chain_name": "S", "nt_resnum": 97, "nt_name": "U", "nt_code": "U", "nt_id": "///S/97", "linked_nts": [ "///S/96", "///S/98" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,internal-loop,splayed-apart", "alpha": -71.813, "beta": -128.476, "gamma": 34.026, "delta": 145.413, "epsilon": -107.374, "zeta": -61.136, "epsilon_zeta": -46.238, "bb_type": "--", "chi": -115.950, "glyco_bond": "anti", "C5prime_xyz": [ -2.136, 8.555, -1.355 ], "P_xyz": [ -0.932, 10.340, 0.193 ], "form": ".", "ssZp": 1.219, "Dp": 1.194, "splay_angle": 118.536, "splay_distance": 17.950, "splay_ratio": 0.860, "d22": null, "d64": null, "eta": -122.115, "theta": -58.338, "eta_prime": -97.348, "theta_prime": -73.570, "eta_base": 8.099, "theta_base": -86.951, "v0": -25.653, "v1": 40.511, "v2": -38.732, "v3": 25.358, "v4": 0.006, "amplitude": 40.940, "phase_angle": 161.100, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.010, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ 41.077, 19.470, 76.765 ], "x_axis": [ -0.767, -0.255, -0.589 ], "y_axis": [ -0.368, -0.577, 0.729 ], "z_axis": [ -0.526, 0.776, 0.348 ], "quaternion": [ 0.034, -0.340, 0.459, 0.820 ] } }, { "index": 573, "index_chain": 98, "chain_name": "S", "nt_resnum": 98, "nt_name": "A", "nt_code": "A", "nt_id": "///S/98", "linked_nts": [ "///S/97", "///S/99" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,ribose-zipper,splayed-apart", "alpha": -93.383, "beta": 139.977, "gamma": -166.356, "delta": 95.857, "epsilon": -130.631, "zeta": -84.265, "epsilon_zeta": -46.365, "bb_type": "BI", "chi": -146.295, "glyco_bond": "anti", "C5prime_xyz": [ -0.943, 8.399, -0.167 ], "P_xyz": [ -0.580, 10.638, -1.510 ], "form": ".", "ssZp": 3.818, "Dp": 4.644, "splay_angle": 18.024, "splay_distance": 2.936, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": -93.886, "theta": 170.463, "eta_prime": -63.276, "theta_prime": -177.031, "eta_base": -28.633, "theta_base": -139.095, "v0": 18.977, "v1": -34.778, "v2": 36.369, "v3": -26.026, "v4": 4.647, "amplitude": 37.134, "phase_angle": 348.348, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "2h", "suiteness": 0.083, "filter_rmsd": 0.036, "frame": { "rmsd": 0.011, "origin": [ 35.813, 22.502, 93.655 ], "x_axis": [ 0.735, 0.074, 0.674 ], "y_axis": [ 0.650, -0.356, -0.671 ], "z_axis": [ 0.190, 0.932, -0.310 ], "quaternion": [ 0.517, -0.775, -0.234, -0.279 ] } }, { "index": 574, "index_chain": 99, "chain_name": "S", "nt_resnum": 99, "nt_name": "A", "nt_code": "A", "nt_id": "///S/99", "linked_nts": [ "///S/98", "///S/100" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,A-minor,ribose-zipper", "alpha": -71.295, "beta": 145.470, "gamma": 62.996, "delta": 77.156, "epsilon": -141.467, "zeta": -70.098, "epsilon_zeta": -71.369, "bb_type": "BI", "chi": -147.728, "glyco_bond": "anti", "C5prime_xyz": [ -1.206, 8.712, -0.149 ], "P_xyz": [ 1.077, 8.708, -1.366 ], "form": "A", "ssZp": 3.994, "Dp": 4.765, "splay_angle": 20.099, "splay_distance": 3.295, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 153.765, "theta": -141.355, "eta_prime": 172.343, "theta_prime": -147.211, "eta_base": -142.282, "theta_base": -136.841, "v0": 8.082, "v1": -32.128, "v2": 42.877, "v3": -39.507, "v4": 19.842, "amplitude": 43.326, "phase_angle": 8.252, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.285, "filter_rmsd": 0.043, "frame": { "rmsd": 0.010, "origin": [ 37.025, 25.145, 93.242 ], "x_axis": [ 0.949, -0.148, 0.278 ], "y_axis": [ 0.268, -0.083, -0.960 ], "z_axis": [ 0.165, 0.986, -0.040 ], "quaternion": [ 0.676, -0.720, -0.042, -0.154 ] } }, { "index": 575, "index_chain": 100, "chain_name": "S", "nt_resnum": 100, "nt_name": "A", "nt_code": "A", "nt_id": "///S/100", "linked_nts": [ "///S/99", "///S/101" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -85.124, "beta": 160.822, "gamma": 81.175, "delta": 78.959, "epsilon": -148.458, "zeta": -58.458, "epsilon_zeta": -90.000, "bb_type": "BI", "chi": -157.597, "glyco_bond": "anti", "C5prime_xyz": [ -1.643, 8.808, 0.300 ], "P_xyz": [ 0.532, 9.528, -0.933 ], "form": ".", "ssZp": 4.406, "Dp": 4.710, "splay_angle": 34.611, "splay_distance": 5.434, "splay_ratio": 0.299, "d22": null, "d64": null, "eta": 162.265, "theta": -132.400, "eta_prime": 179.243, "theta_prime": -133.795, "eta_base": -149.857, "theta_base": -97.290, "v0": 4.808, "v1": -32.195, "v2": 45.391, "v3": -43.177, "v4": 24.550, "amplitude": 46.476, "phase_angle": 12.404, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.071, "filter_rmsd": 0.041, "frame": { "rmsd": 0.010, "origin": [ 38.169, 27.928, 94.584 ], "x_axis": [ 0.941, -0.333, -0.067 ], "y_axis": [ -0.004, 0.185, -0.983 ], "z_axis": [ 0.340, 0.925, 0.173 ], "quaternion": [ 0.758, -0.629, 0.134, -0.108 ] } }, { "index": 576, "index_chain": 101, "chain_name": "S", "nt_resnum": 101, "nt_name": "U", "nt_code": "U", "nt_id": "///S/101", "linked_nts": [ "///S/100", "///S/102" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -69.264, "beta": 168.830, "gamma": 62.792, "delta": 75.266, "epsilon": -129.392, "zeta": -48.302, "epsilon_zeta": -81.090, "bb_type": "--", "chi": -174.965, "glyco_bond": "anti", "C5prime_xyz": [ -1.702, 8.635, 1.336 ], "P_xyz": [ 0.856, 9.240, 1.433 ], "form": ".", "ssZp": 4.713, "Dp": 4.779, "splay_angle": 49.275, "splay_distance": 7.317, "splay_ratio": 0.417, "d22": 3.087, "d64": 3.902, "eta": 170.863, "theta": -108.278, "eta_prime": -167.344, "theta_prime": -103.075, "eta_base": -107.302, "theta_base": -51.175, "v0": -0.717, "v1": -27.054, "v2": 43.192, "v3": -44.298, "v4": 28.435, "amplitude": 45.747, "phase_angle": 19.240, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.733, "filter_rmsd": 0.105, "frame": { "rmsd": 0.008, "origin": [ 43.241, 29.874, 94.467 ], "x_axis": [ 0.523, -0.249, -0.815 ], "y_axis": [ -0.740, 0.341, -0.579 ], "z_axis": [ 0.422, 0.907, -0.006 ], "quaternion": [ 0.682, -0.545, 0.454, 0.180 ] } }, { "index": 577, "index_chain": 102, "chain_name": "S", "nt_resnum": 102, "nt_name": "C", "nt_code": "C", "nt_id": "///S/102", "linked_nts": [ "///S/101", "///S/103" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -71.494, "beta": -177.214, "gamma": 49.686, "delta": 87.139, "epsilon": -127.976, "zeta": -76.218, "epsilon_zeta": -51.758, "bb_type": "--", "chi": -167.256, "glyco_bond": "anti", "C5prime_xyz": [ -1.126, 8.603, 1.030 ], "P_xyz": [ 1.428, 8.677, 1.691 ], "form": "A", "ssZp": 4.573, "Dp": 4.743, "splay_angle": 23.227, "splay_distance": 3.769, "splay_ratio": 0.203, "d22": null, "d64": null, "eta": 164.430, "theta": -128.790, "eta_prime": -166.124, "theta_prime": -126.907, "eta_base": -89.711, "theta_base": -99.715, "v0": 12.510, "v1": -32.492, "v2": 38.950, "v3": -32.489, "v4": 12.798, "amplitude": 38.950, "phase_angle": 0.136, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.495, "filter_rmsd": 0.072, "frame": { "rmsd": 0.011, "origin": [ 44.522, 32.369, 87.709 ], "x_axis": [ -0.782, 0.045, -0.622 ], "y_axis": [ -0.570, 0.354, 0.742 ], "z_axis": [ 0.254, 0.934, -0.251 ], "quaternion": [ 0.283, -0.170, 0.772, 0.542 ] } }, { "index": 578, "index_chain": 103, "chain_name": "S", "nt_resnum": 103, "nt_name": "A", "nt_code": "A", "nt_id": "///S/103", "linked_nts": [ "///S/102", "///S/104" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -72.006, "beta": 158.336, "gamma": 58.421, "delta": 76.309, "epsilon": -173.663, "zeta": -63.731, "epsilon_zeta": -109.932, "bb_type": "BI", "chi": -169.526, "glyco_bond": "anti", "C5prime_xyz": [ -1.952, 8.735, 1.033 ], "P_xyz": [ 0.557, 9.454, 0.952 ], "form": ".", "ssZp": 4.512, "Dp": 4.510, "splay_angle": 27.153, "splay_distance": 4.169, "splay_ratio": 0.238, "d22": null, "d64": null, "eta": 150.747, "theta": -131.989, "eta_prime": 174.640, "theta_prime": -134.437, "eta_base": -135.798, "theta_base": -85.259, "v0": -0.908, "v1": -26.522, "v2": 42.119, "v3": -43.478, "v4": 28.273, "amplitude": 44.708, "phase_angle": 19.592, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.648, "filter_rmsd": 0.036, "frame": { "rmsd": 0.006, "origin": [ 44.665, 35.144, 85.163 ], "x_axis": [ -1.000, -0.013, -0.027 ], "y_axis": [ -0.030, 0.323, 0.946 ], "z_axis": [ -0.003, 0.946, -0.323 ], "quaternion": [ 0.007, -0.013, 0.813, 0.582 ] } }, { "index": 579, "index_chain": 104, "chain_name": "S", "nt_resnum": 104, "nt_name": "U", "nt_code": "U", "nt_id": "///S/104", "linked_nts": [ "///S/103", "///S/105" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -152.888, "beta": -144.337, "gamma": 112.210, "delta": 79.363, "epsilon": -136.458, "zeta": -134.470, "epsilon_zeta": -1.988, "bb_type": "--", "chi": -166.716, "glyco_bond": "anti", "C5prime_xyz": [ -1.784, 8.726, 0.929 ], "P_xyz": [ 0.716, 9.079, 0.342 ], "form": ".", "ssZp": 4.528, "Dp": 4.693, "splay_angle": 24.197, "splay_distance": 3.924, "splay_ratio": 0.212, "d22": 4.728, "d64": 5.007, "eta": 164.077, "theta": -161.266, "eta_prime": -176.172, "theta_prime": -153.443, "eta_base": -106.836, "theta_base": -170.182, "v0": 2.668, "v1": -28.486, "v2": 41.975, "v3": -41.559, "v4": 24.692, "amplitude": 43.497, "phase_angle": 15.199, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ 41.643, 37.821, 84.124 ], "x_axis": [ -0.656, 0.264, 0.707 ], "y_axis": [ 0.749, 0.344, 0.566 ], "z_axis": [ -0.094, 0.901, -0.424 ], "quaternion": [ -0.257, 0.325, 0.779, 0.471 ] } }, { "index": 580, "index_chain": 105, "chain_name": "S", "nt_resnum": 105, "nt_name": "U", "nt_code": "U", "nt_id": "///S/105", "linked_nts": [ "///S/104", "///S/106" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": 11.969, "beta": 116.791, "gamma": 30.380, "delta": 136.319, "epsilon": -162.325, "zeta": -76.699, "epsilon_zeta": -85.626, "bb_type": "BI", "chi": -116.348, "glyco_bond": "anti", "C5prime_xyz": [ -2.874, 8.666, -1.397 ], "P_xyz": [ -0.443, 9.522, -0.614 ], "form": "B", "ssZp": 2.440, "Dp": 2.455, "splay_angle": 22.489, "splay_distance": 3.765, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 173.053, "theta": -117.038, "eta_prime": -162.834, "theta_prime": -160.330, "eta_base": -173.883, "theta_base": -126.287, "v0": -36.863, "v1": 48.066, "v2": -40.587, "v3": 19.975, "v4": 10.683, "amplitude": 47.448, "phase_angle": 148.805, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.110, "frame": { "rmsd": 0.010, "origin": [ 40.887, 39.144, 80.508 ], "x_axis": [ -0.450, -0.051, 0.892 ], "y_axis": [ 0.752, 0.517, 0.409 ], "z_axis": [ -0.482, 0.854, -0.194 ], "quaternion": [ -0.467, 0.238, 0.735, 0.430 ] } }, { "index": 581, "index_chain": 106, "chain_name": "S", "nt_resnum": 106, "nt_name": "A", "nt_code": "A", "nt_id": "///S/106", "linked_nts": [ "///S/105", "///S/107" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -144.732, "beta": 86.510, "gamma": 143.579, "delta": 88.915, "epsilon": -129.040, "zeta": -71.654, "epsilon_zeta": -57.386, "bb_type": "BI", "chi": -173.662, "glyco_bond": "anti", "C5prime_xyz": [ -0.767, 8.103, 1.552 ], "P_xyz": [ -0.058, 9.815, -0.311 ], "form": "A", "ssZp": 4.612, "Dp": 4.690, "splay_angle": 23.094, "splay_distance": 3.607, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 152.240, "theta": -176.105, "eta_prime": 148.858, "theta_prime": -166.862, "eta_base": -158.745, "theta_base": -140.981, "v0": 19.218, "v1": -34.017, "v2": 35.908, "v3": -25.921, "v4": 4.309, "amplitude": 36.678, "phase_angle": 348.241, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.012, "origin": [ 38.429, 41.720, 79.284 ], "x_axis": [ 0.042, 0.251, 0.967 ], "y_axis": [ 0.914, 0.380, -0.139 ], "z_axis": [ -0.403, 0.890, -0.213 ], "quaternion": [ 0.550, -0.468, -0.623, -0.302 ] } }, { "index": 582, "index_chain": 107, "chain_name": "S", "nt_resnum": 107, "nt_name": "A", "nt_code": "A", "nt_id": "///S/107", "linked_nts": [ "///S/106", "///S/108" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -61.689, "beta": 179.884, "gamma": 39.868, "delta": 81.589, "epsilon": -151.661, "zeta": -65.891, "epsilon_zeta": -85.771, "bb_type": "BI", "chi": -153.798, "glyco_bond": "anti", "C5prime_xyz": [ -1.183, 8.556, 0.142 ], "P_xyz": [ 1.343, 9.063, 0.183 ], "form": "A", "ssZp": 4.306, "Dp": 4.736, "splay_angle": 24.393, "splay_distance": 3.985, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 160.856, "theta": -147.657, "eta_prime": 177.183, "theta_prime": -146.042, "eta_base": -144.864, "theta_base": -129.215, "v0": 13.132, "v1": -36.008, "v2": 43.612, "v3": -37.464, "v4": 15.603, "amplitude": 43.630, "phase_angle": 1.676, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.534, "filter_rmsd": 0.031, "frame": { "rmsd": 0.011, "origin": [ 35.809, 44.189, 79.501 ], "x_axis": [ 0.533, 0.416, 0.737 ], "y_axis": [ 0.683, 0.302, -0.665 ], "z_axis": [ -0.499, 0.858, -0.124 ], "quaternion": [ 0.654, -0.582, -0.472, -0.102 ] } }, { "index": 583, "index_chain": 108, "chain_name": "S", "nt_resnum": 108, "nt_name": "G", "nt_code": "G", "nt_id": "///S/108", "linked_nts": [ "///S/107", "///S/109" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop", "alpha": -67.392, "beta": 170.586, "gamma": 59.859, "delta": 77.562, "epsilon": -139.039, "zeta": -66.168, "epsilon_zeta": -72.871, "bb_type": "BI", "chi": -165.689, "glyco_bond": "anti", "C5prime_xyz": [ -1.647, 8.773, 0.911 ], "P_xyz": [ 0.838, 9.566, 0.920 ], "form": "A", "ssZp": 4.571, "Dp": 4.715, "splay_angle": 23.918, "splay_distance": 3.958, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 172.229, "theta": -138.467, "eta_prime": -175.263, "theta_prime": -137.731, "eta_base": -145.485, "theta_base": -103.489, "v0": 3.553, "v1": -28.964, "v2": 41.756, "v3": -41.168, "v4": 23.683, "amplitude": 43.057, "phase_angle": 14.123, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.896, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 33.475, 47.000, 81.092 ], "x_axis": [ 0.865, 0.295, 0.406 ], "y_axis": [ 0.388, 0.121, -0.914 ], "z_axis": [ -0.319, 0.948, -0.010 ], "quaternion": [ 0.703, -0.662, -0.258, -0.033 ] } }, { "index": 584, "index_chain": 109, "chain_name": "S", "nt_resnum": 109, "nt_name": "G", "nt_code": "G", "nt_id": "///S/109", "linked_nts": [ "///S/108", "///S/110" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor", "alpha": -85.483, "beta": 175.044, "gamma": 67.069, "delta": 74.236, "epsilon": -122.721, "zeta": -63.401, "epsilon_zeta": -59.321, "bb_type": "--", "chi": -166.058, "glyco_bond": "anti", "C5prime_xyz": [ -1.769, 8.848, 0.797 ], "P_xyz": [ 0.656, 9.720, 0.543 ], "form": ".", "ssZp": 4.529, "Dp": 4.840, "splay_angle": 78.614, "splay_distance": 11.322, "splay_ratio": 0.633, "d22": null, "d64": null, "eta": 163.051, "theta": -110.454, "eta_prime": 176.903, "theta_prime": -154.857, "eta_base": -134.560, "theta_base": 151.866, "v0": -0.057, "v1": -28.479, "v2": 44.276, "v3": -45.550, "v4": 28.971, "amplitude": 46.741, "phase_angle": 18.691, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.457, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 34.178, 50.352, 83.076 ], "x_axis": [ 0.965, 0.111, -0.238 ], "y_axis": [ -0.244, 0.043, -0.969 ], "z_axis": [ -0.097, 0.993, 0.068 ], "quaternion": [ 0.720, -0.681, 0.049, 0.123 ] } }, { "index": 585, "index_chain": 110, "chain_name": "S", "nt_resnum": 110, "nt_name": "U", "nt_code": "U", "nt_id": "///S/110", "linked_nts": [ "///S/109", "///S/111" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop", "alpha": 178.654, "beta": 142.655, "gamma": 40.326, "delta": 86.381, "epsilon": -140.404, "zeta": -67.222, "epsilon_zeta": -73.182, "bb_type": "BI", "chi": -166.479, "glyco_bond": "anti", "C5prime_xyz": [ -1.531, 8.685, 0.912 ], "P_xyz": [ 1.093, 8.722, 1.196 ], "form": ".", "ssZp": 4.455, "Dp": 4.573, "splay_angle": 25.393, "splay_distance": 3.976, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 12.234, "theta": -123.869, "eta_prime": 44.165, "theta_prime": -123.841, "eta_base": 26.429, "theta_base": -66.863, "v0": 4.123, "v1": -25.153, "v2": 35.054, "v3": -33.593, "v4": 18.797, "amplitude": 35.850, "phase_angle": 12.092, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.554, "filter_rmsd": 0.105, "frame": { "rmsd": 0.006, "origin": [ 24.274, 55.806, 83.660 ], "x_axis": [ -0.623, -0.526, -0.579 ], "y_axis": [ 0.642, 0.080, -0.763 ], "z_axis": [ 0.447, -0.847, 0.288 ], "quaternion": [ -0.431, -0.049, -0.595, 0.677 ] } }, { "index": 586, "index_chain": 111, "chain_name": "S", "nt_resnum": 111, "nt_name": "G", "nt_code": "G", "nt_id": "///S/111", "linked_nts": [ "///S/110", "///S/112" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,ribose-zipper,cap-donor,phosphate", "alpha": -65.686, "beta": 166.909, "gamma": 54.173, "delta": 84.399, "epsilon": -166.600, "zeta": -63.303, "epsilon_zeta": -103.297, "bb_type": "BI", "chi": -138.281, "glyco_bond": "anti", "C5prime_xyz": [ -0.954, 8.689, -0.781 ], "P_xyz": [ 1.640, 8.667, -1.262 ], "form": ".", "ssZp": 3.625, "Dp": 4.434, "splay_angle": 17.426, "splay_distance": 2.857, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 162.234, "theta": -144.537, "eta_prime": -171.072, "theta_prime": -147.422, "eta_base": -92.483, "theta_base": -139.611, "v0": 8.044, "v1": -30.556, "v2": 40.195, "v3": -35.695, "v4": 17.891, "amplitude": 40.489, "phase_angle": 6.908, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.888, "filter_rmsd": 0.016, "frame": { "rmsd": 0.016, "origin": [ 24.465, 52.205, 81.986 ], "x_axis": [ 0.237, -0.353, -0.905 ], "y_axis": [ 0.965, 0.195, 0.177 ], "z_axis": [ 0.114, -0.915, 0.386 ], "quaternion": [ 0.674, 0.405, 0.378, -0.488 ] } }, { "index": 587, "index_chain": 112, "chain_name": "S", "nt_resnum": 112, "nt_name": "A", "nt_code": "A", "nt_id": "///S/112", "linked_nts": [ "///S/111", "///S/113" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-donor,cap-acceptor,phosphate", "alpha": -91.836, "beta": -176.503, "gamma": 70.145, "delta": 83.504, "epsilon": -133.818, "zeta": -68.195, "epsilon_zeta": -65.623, "bb_type": "BI", "chi": -125.117, "glyco_bond": "anti", "C5prime_xyz": [ -1.690, 8.534, -1.524 ], "P_xyz": [ 0.753, 8.770, -2.522 ], "form": ".", "ssZp": 2.495, "Dp": 4.534, "splay_angle": 62.348, "splay_distance": 10.050, "splay_ratio": 0.518, "d22": null, "d64": null, "eta": 171.322, "theta": -88.163, "eta_prime": -177.146, "theta_prime": -80.399, "eta_base": -159.368, "theta_base": -55.338, "v0": -1.780, "v1": -21.976, "v2": 36.166, "v3": -37.569, "v4": 24.989, "amplitude": 38.696, "phase_angle": 20.836, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.247, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 24.479, 49.551, 83.044 ], "x_axis": [ 0.538, -0.225, -0.812 ], "y_axis": [ 0.825, -0.055, 0.562 ], "z_axis": [ -0.171, -0.973, 0.156 ], "quaternion": [ 0.640, 0.599, 0.251, -0.410 ] } }, { "index": 588, "index_chain": 113, "chain_name": "S", "nt_resnum": 113, "nt_name": "C", "nt_code": "C", "nt_id": "///S/113", "linked_nts": [ "///S/112", "///S/114" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,cap-acceptor", "alpha": 145.326, "beta": -127.692, "gamma": 178.332, "delta": 86.056, "epsilon": -146.269, "zeta": -73.697, "epsilon_zeta": -72.572, "bb_type": "BI", "chi": -175.140, "glyco_bond": "anti", "C5prime_xyz": [ -1.054, 8.293, 1.491 ], "P_xyz": [ 0.451, 9.445, -0.335 ], "form": "A", "ssZp": 4.760, "Dp": 4.740, "splay_angle": 26.377, "splay_distance": 3.979, "splay_ratio": 0.230, "d22": 4.617, "d64": 4.671, "eta": 168.503, "theta": -157.520, "eta_prime": -141.925, "theta_prime": -162.639, "eta_base": -86.003, "theta_base": -139.793, "v0": 17.917, "v1": -37.432, "v2": 41.909, "v3": -32.314, "v4": 9.244, "amplitude": 42.148, "phase_angle": 353.898, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.262, "filter_rmsd": 0.070, "frame": { "rmsd": 0.012, "origin": [ 34.100, 47.275, 81.241 ], "x_axis": [ 0.896, 0.234, 0.376 ], "y_axis": [ -0.369, -0.075, 0.926 ], "z_axis": [ 0.245, -0.969, 0.019 ], "quaternion": [ 0.678, 0.699, -0.048, 0.222 ] } }, { "index": 589, "index_chain": 114, "chain_name": "S", "nt_resnum": 114, "nt_name": "U", "nt_code": "U", "nt_id": "///S/114", "linked_nts": [ "///S/113", "///S/115" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -46.749, "beta": 173.741, "gamma": 40.514, "delta": 83.247, "epsilon": -153.549, "zeta": -68.047, "epsilon_zeta": -85.501, "bb_type": "BI", "chi": -163.649, "glyco_bond": "anti", "C5prime_xyz": [ -0.962, 8.482, 0.881 ], "P_xyz": [ 1.592, 8.633, 1.414 ], "form": "A", "ssZp": 4.477, "Dp": 4.625, "splay_angle": 19.709, "splay_distance": 3.147, "splay_ratio": 0.174, "d22": 4.450, "d64": 4.480, "eta": 177.712, "theta": -147.316, "eta_prime": -169.757, "theta_prime": -144.101, "eta_base": -132.573, "theta_base": -131.713, "v0": 17.252, "v1": -37.266, "v2": 42.436, "v3": -33.434, "v4": 10.369, "amplitude": 42.578, "phase_angle": 355.310, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.543, "filter_rmsd": 0.114, "frame": { "rmsd": 0.012, "origin": [ 36.200, 44.141, 79.975 ], "x_axis": [ 0.514, 0.161, 0.842 ], "y_axis": [ -0.824, -0.179, 0.537 ], "z_axis": [ 0.237, -0.971, 0.040 ], "quaternion": [ 0.586, 0.643, -0.258, 0.420 ] } }, { "index": 590, "index_chain": 115, "chain_name": "S", "nt_resnum": 115, "nt_name": "U", "nt_code": "U", "nt_id": "///S/115", "linked_nts": [ "///S/114", "///S/116" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.501, "beta": 174.935, "gamma": 56.379, "delta": 82.929, "epsilon": -151.733, "zeta": -66.719, "epsilon_zeta": -85.014, "bb_type": "BI", "chi": -154.155, "glyco_bond": "anti", "C5prime_xyz": [ -1.523, 8.784, 0.208 ], "P_xyz": [ 1.046, 9.269, 0.220 ], "form": "A", "ssZp": 4.228, "Dp": 4.549, "splay_angle": 22.341, "splay_distance": 3.661, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 167.000, "theta": -139.869, "eta_prime": -178.304, "theta_prime": -141.918, "eta_base": -152.862, "theta_base": -117.695, "v0": 4.948, "v1": -28.590, "v2": 39.726, "v3": -37.920, "v4": 20.844, "amplitude": 40.563, "phase_angle": 11.658, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.944, "filter_rmsd": 0.109, "frame": { "rmsd": 0.009, "origin": [ 38.231, 41.905, 79.096 ], "x_axis": [ 0.118, 0.108, 0.987 ], "y_axis": [ -0.903, -0.401, 0.152 ], "z_axis": [ 0.412, -0.910, 0.050 ], "quaternion": [ 0.438, 0.606, -0.328, 0.577 ] } }, { "index": 591, "index_chain": 116, "chain_name": "S", "nt_resnum": 116, "nt_name": "A", "nt_code": "A", "nt_id": "///S/116", "linked_nts": [ "///S/115", "///S/117" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -80.305, "beta": 173.082, "gamma": 67.741, "delta": 80.737, "epsilon": -161.597, "zeta": -65.998, "epsilon_zeta": -95.600, "bb_type": "BI", "chi": -162.221, "glyco_bond": "anti", "C5prime_xyz": [ -1.746, 8.784, 0.604 ], "P_xyz": [ 0.726, 9.595, 0.297 ], "form": "A", "ssZp": 4.514, "Dp": 4.577, "splay_angle": 25.177, "splay_distance": 4.161, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 161.344, "theta": -151.692, "eta_prime": 178.388, "theta_prime": -156.836, "eta_base": -138.655, "theta_base": -142.919, "v0": -2.272, "v1": -22.961, "v2": 37.384, "v3": -39.954, "v4": 26.727, "amplitude": 40.261, "phase_angle": 21.788, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.566, "filter_rmsd": 0.035, "frame": { "rmsd": 0.010, "origin": [ 40.783, 39.634, 80.412 ], "x_axis": [ -0.423, 0.022, 0.906 ], "y_axis": [ -0.799, -0.481, -0.362 ], "z_axis": [ 0.427, -0.877, 0.221 ], "quaternion": [ 0.282, 0.457, -0.425, 0.729 ] } }, { "index": 592, "index_chain": 117, "chain_name": "S", "nt_resnum": 117, "nt_name": "G", "nt_code": "G", "nt_id": "///S/117", "linked_nts": [ "///S/116", "///S/118" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -88.594, "beta": 163.187, "gamma": 86.265, "delta": 70.171, "epsilon": -130.702, "zeta": -84.815, "epsilon_zeta": -45.887, "bb_type": "BI", "chi": -174.561, "glyco_bond": "anti", "C5prime_xyz": [ -1.631, 8.595, 1.384 ], "P_xyz": [ 0.635, 9.703, 0.929 ], "form": "A", "ssZp": 4.716, "Dp": 4.813, "splay_angle": 25.651, "splay_distance": 4.026, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 174.172, "theta": -150.987, "eta_prime": -177.326, "theta_prime": -146.704, "eta_base": -149.005, "theta_base": -107.425, "v0": 0.717, "v1": -28.952, "v2": 43.979, "v3": -46.004, "v4": 28.340, "amplitude": 46.312, "phase_angle": 18.266, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 44.037, 37.834, 82.279 ], "x_axis": [ -0.681, -0.201, 0.704 ], "y_axis": [ -0.565, -0.468, -0.680 ], "z_axis": [ 0.466, -0.861, 0.205 ], "quaternion": [ 0.118, 0.381, -0.502, 0.767 ] } }, { "index": 593, "index_chain": 118, "chain_name": "S", "nt_resnum": 118, "nt_name": "U", "nt_code": "U", "nt_id": "///S/118", "linked_nts": [ "///S/117", "///S/119" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -38.588, "beta": 158.505, "gamma": 37.822, "delta": 74.541, "epsilon": -148.325, "zeta": -73.184, "epsilon_zeta": -75.141, "bb_type": "BI", "chi": -162.561, "glyco_bond": "anti", "C5prime_xyz": [ -1.449, 8.780, 0.617 ], "P_xyz": [ 1.170, 9.184, 0.748 ], "form": "A", "ssZp": 4.547, "Dp": 4.755, "splay_angle": 23.771, "splay_distance": 3.779, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 166.864, "theta": -149.980, "eta_prime": -178.053, "theta_prime": -147.139, "eta_base": -123.872, "theta_base": -126.260, "v0": 4.235, "v1": -31.600, "v2": 45.220, "v3": -44.035, "v4": 25.178, "amplitude": 46.502, "phase_angle": 13.486, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.187, "filter_rmsd": 0.109, "frame": { "rmsd": 0.007, "origin": [ 44.464, 35.158, 85.256 ], "x_axis": [ -0.912, -0.404, 0.069 ], "y_axis": [ 0.065, -0.309, -0.949 ], "z_axis": [ 0.405, -0.861, 0.308 ], "quaternion": [ -0.147, 0.149, -0.569, 0.795 ] } }, { "index": 594, "index_chain": 119, "chain_name": "S", "nt_resnum": 119, "nt_name": "G", "nt_code": "G", "nt_id": "///S/119", "linked_nts": [ "///S/118", "///S/120" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -58.623, "beta": -171.572, "gamma": 34.855, "delta": 78.252, "epsilon": -150.505, "zeta": -81.310, "epsilon_zeta": -69.195, "bb_type": "BI", "chi": -153.715, "glyco_bond": "anti", "C5prime_xyz": [ -1.223, 8.749, 0.197 ], "P_xyz": [ 1.253, 9.255, 0.816 ], "form": "A", "ssZp": 4.310, "Dp": 4.741, "splay_angle": 21.849, "splay_distance": 3.391, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 168.398, "theta": -158.298, "eta_prime": 174.118, "theta_prime": -152.659, "eta_base": -156.072, "theta_base": -127.242, "v0": 9.125, "v1": -34.318, "v2": 44.994, "v3": -40.952, "v4": 20.213, "amplitude": 45.361, "phase_angle": 7.293, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.400, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 44.701, 32.481, 87.913 ], "x_axis": [ -0.830, -0.171, -0.531 ], "y_axis": [ 0.555, -0.158, -0.817 ], "z_axis": [ 0.056, -0.973, 0.226 ], "quaternion": [ -0.244, -0.160, -0.601, 0.744 ] } }, { "index": 595, "index_chain": 120, "chain_name": "S", "nt_resnum": 120, "nt_name": "G", "nt_code": "G", "nt_id": "///S/120", "linked_nts": [ "///S/119", "///S/121" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -50.346, "beta": 162.995, "gamma": 46.006, "delta": 82.040, "epsilon": -150.545, "zeta": -65.809, "epsilon_zeta": -84.736, "bb_type": "BI", "chi": -159.363, "glyco_bond": "anti", "C5prime_xyz": [ -1.287, 8.683, 0.500 ], "P_xyz": [ 1.349, 8.889, 0.444 ], "form": ".", "ssZp": 4.473, "Dp": 4.703, "splay_angle": 22.425, "splay_distance": 3.925, "splay_ratio": 0.207, "d22": null, "d64": null, "eta": 169.635, "theta": -144.231, "eta_prime": -179.134, "theta_prime": -149.712, "eta_base": -144.857, "theta_base": -156.644, "v0": 9.692, "v1": -31.889, "v2": 40.651, "v3": -36.550, "v4": 16.914, "amplitude": 40.834, "phase_angle": 5.426, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.711, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 43.756, 29.449, 89.103 ], "x_axis": [ -0.480, -0.050, -0.876 ], "y_axis": [ 0.869, -0.168, -0.466 ], "z_axis": [ -0.124, -0.984, 0.124 ], "quaternion": [ -0.345, -0.376, -0.545, 0.666 ] } }, { "index": 596, "index_chain": 121, "chain_name": "S", "nt_resnum": 121, "nt_name": "A", "nt_code": "A", "nt_id": "///S/121", "linked_nts": [ "///S/120", "///S/122" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -85.588, "beta": 153.522, "gamma": 94.586, "delta": 70.799, "epsilon": -133.485, "zeta": -97.074, "epsilon_zeta": -36.411, "bb_type": "--", "chi": -166.180, "glyco_bond": "anti", "C5prime_xyz": [ -1.915, 8.835, 0.857 ], "P_xyz": [ 0.055, 10.164, -0.154 ], "form": "A", "ssZp": 4.473, "Dp": 4.721, "splay_angle": 22.984, "splay_distance": 3.685, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 178.694, "theta": -165.647, "eta_prime": -172.840, "theta_prime": -161.835, "eta_base": -165.709, "theta_base": -128.580, "v0": -2.682, "v1": -26.198, "v2": 43.332, "v3": -46.163, "v4": 31.000, "amplitude": 46.707, "phase_angle": 21.914, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.035, "frame": { "rmsd": 0.009, "origin": [ 41.448, 27.284, 91.424 ], "x_axis": [ -0.343, -0.144, -0.928 ], "y_axis": [ 0.898, -0.340, -0.279 ], "z_axis": [ -0.275, -0.929, 0.245 ], "quaternion": [ -0.375, -0.433, -0.435, 0.694 ] } }, { "index": 597, "index_chain": 122, "chain_name": "S", "nt_resnum": 122, "nt_name": "C", "nt_code": "C", "nt_id": "///S/122", "linked_nts": [ "///S/121", "///S/123" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop", "alpha": -33.346, "beta": 147.982, "gamma": 34.783, "delta": 79.251, "epsilon": -165.020, "zeta": -62.773, "epsilon_zeta": -102.247, "bb_type": "BI", "chi": -153.349, "glyco_bond": "anti", "C5prime_xyz": [ -1.495, 8.907, 0.197 ], "P_xyz": [ 1.136, 9.274, 0.195 ], "form": ".", "ssZp": 4.287, "Dp": 4.543, "splay_angle": 44.286, "splay_distance": 7.787, "splay_ratio": 0.388, "d22": null, "d64": null, "eta": 167.167, "theta": -135.280, "eta_prime": -179.514, "theta_prime": -143.615, "eta_base": -135.708, "theta_base": -144.906, "v0": 2.585, "v1": -27.194, "v2": 39.330, "v3": -39.329, "v4": 23.208, "amplitude": 40.745, "phase_angle": 15.143, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.048, "filter_rmsd": 0.066, "frame": { "rmsd": 0.008, "origin": [ 39.283, 24.304, 91.324 ], "x_axis": [ 0.258, -0.191, -0.947 ], "y_axis": [ 0.899, -0.311, 0.307 ], "z_axis": [ -0.353, -0.931, 0.091 ], "quaternion": [ 0.509, 0.608, 0.292, -0.535 ] } }, { "index": 598, "index_chain": 123, "chain_name": "S", "nt_resnum": 123, "nt_name": "A", "nt_code": "A", "nt_id": "///S/123", "linked_nts": [ "///S/122", "///S/124" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper", "alpha": -178.000, "beta": 161.106, "gamma": -167.821, "delta": 82.894, "epsilon": -131.521, "zeta": -85.787, "epsilon_zeta": -45.733, "bb_type": "BI", "chi": -162.688, "glyco_bond": "anti", "C5prime_xyz": [ -1.392, 8.678, 0.714 ], "P_xyz": [ -0.802, 11.007, -0.274 ], "form": ".", "ssZp": 4.306, "Dp": 4.627, "splay_angle": 19.080, "splay_distance": 3.053, "splay_ratio": 0.167, "d22": null, "d64": null, "eta": -159.392, "theta": 172.039, "eta_prime": -160.228, "theta_prime": -176.162, "eta_base": -156.096, "theta_base": -131.041, "v0": 4.708, "v1": -28.508, "v2": 39.923, "v3": -37.920, "v4": 21.309, "amplitude": 40.808, "phase_angle": 11.954, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1f", "suiteness": 0.449, "filter_rmsd": 0.040, "frame": { "rmsd": 0.007, "origin": [ 33.864, 18.725, 91.719 ], "x_axis": [ 0.337, -0.338, -0.879 ], "y_axis": [ 0.923, -0.069, 0.380 ], "z_axis": [ -0.189, -0.939, 0.289 ], "quaternion": [ 0.624, 0.528, 0.277, -0.505 ] } }, { "index": 599, "index_chain": 124, "chain_name": "S", "nt_resnum": 124, "nt_name": "A", "nt_code": "A", "nt_id": "///S/124", "linked_nts": [ "///S/123", "///S/125" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,A-minor,ribose-zipper", "alpha": -62.035, "beta": 147.637, "gamma": 55.171, "delta": 77.599, "epsilon": -141.349, "zeta": -91.200, "epsilon_zeta": -50.149, "bb_type": "BI", "chi": -156.993, "glyco_bond": "anti", "C5prime_xyz": [ -1.300, 8.746, 0.323 ], "P_xyz": [ 1.228, 8.869, -0.410 ], "form": "A", "ssZp": 4.354, "Dp": 4.772, "splay_angle": 18.380, "splay_distance": 2.820, "splay_ratio": 0.160, "d22": null, "d64": null, "eta": 155.893, "theta": -154.402, "eta_prime": 172.618, "theta_prime": -156.720, "eta_base": -134.524, "theta_base": -140.464, "v0": 7.218, "v1": -33.483, "v2": 45.336, "v3": -41.767, "v4": 22.105, "amplitude": 45.957, "phase_angle": 9.429, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.570, "filter_rmsd": 0.037, "frame": { "rmsd": 0.010, "origin": [ 33.430, 15.703, 91.667 ], "x_axis": [ 0.803, -0.323, -0.501 ], "y_axis": [ 0.512, -0.055, 0.857 ], "z_axis": [ -0.304, -0.945, 0.121 ], "quaternion": [ 0.684, 0.659, 0.072, -0.305 ] } }, { "index": 600, "index_chain": 125, "chain_name": "S", "nt_resnum": 125, "nt_name": "A", "nt_code": "A", "nt_id": "///S/125", "linked_nts": [ "///S/124", "///S/126" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,internal-loop,A-minor", "alpha": -61.158, "beta": 154.006, "gamma": 57.950, "delta": 82.530, "epsilon": -128.881, "zeta": -83.602, "epsilon_zeta": -45.279, "bb_type": "BI", "chi": -153.443, "glyco_bond": "anti", "C5prime_xyz": [ -1.099, 8.664, 0.115 ], "P_xyz": [ 1.428, 8.657, -0.693 ], "form": "A", "ssZp": 4.097, "Dp": 4.771, "splay_angle": 26.075, "splay_distance": 4.048, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 169.330, "theta": -136.534, "eta_prime": 178.428, "theta_prime": -136.901, "eta_base": -152.322, "theta_base": -99.763, "v0": 8.971, "v1": -31.598, "v2": 41.632, "v3": -37.308, "v4": 17.860, "amplitude": 41.901, "phase_angle": 6.501, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.613, "filter_rmsd": 0.037, "frame": { "rmsd": 0.008, "origin": [ 32.397, 13.144, 91.086 ], "x_axis": [ 0.962, -0.259, -0.085 ], "y_axis": [ 0.037, -0.184, 0.982 ], "z_axis": [ -0.270, -0.948, -0.168 ], "quaternion": [ 0.634, 0.761, -0.073, -0.117 ] } }, { "index": 601, "index_chain": 126, "chain_name": "S", "nt_resnum": 126, "nt_name": "G", "nt_code": "G", "nt_id": "///S/126", "linked_nts": [ "///S/125", "///S/127" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop", "alpha": -50.395, "beta": 151.497, "gamma": 49.972, "delta": 78.725, "epsilon": -176.748, "zeta": -57.257, "epsilon_zeta": -119.492, "bb_type": "BI", "chi": -164.878, "glyco_bond": "anti", "C5prime_xyz": [ -1.009, 8.627, 0.855 ], "P_xyz": [ 1.601, 8.721, 0.502 ], "form": "A", "ssZp": 4.511, "Dp": 4.560, "splay_angle": 26.863, "splay_distance": 4.053, "splay_ratio": 0.234, "d22": null, "d64": null, "eta": 159.053, "theta": -133.306, "eta_prime": -177.557, "theta_prime": -134.931, "eta_base": -114.973, "theta_base": -103.887, "v0": 13.789, "v1": -37.046, "v2": 45.127, "v3": -37.701, "v4": 15.453, "amplitude": 45.133, "phase_angle": 0.957, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.550, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 34.147, 9.527, 90.596 ], "x_axis": [ 0.775, -0.059, 0.629 ], "y_axis": [ -0.632, -0.076, 0.772 ], "z_axis": [ 0.003, -0.995, -0.096 ], "quaternion": [ 0.633, 0.698, -0.247, 0.226 ] } }, { "index": 602, "index_chain": 127, "chain_name": "S", "nt_resnum": 127, "nt_name": "G", "nt_code": "G", "nt_id": "///S/127", "linked_nts": [ "///S/126", "///S/128" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -139.525, "beta": -147.742, "gamma": 102.172, "delta": 76.875, "epsilon": -136.330, "zeta": -88.031, "epsilon_zeta": -48.299, "bb_type": "BI", "chi": -170.370, "glyco_bond": "anti", "C5prime_xyz": [ -1.643, 8.610, 1.211 ], "P_xyz": [ 1.005, 8.799, 1.050 ], "form": "A", "ssZp": 4.562, "Dp": 4.689, "splay_angle": 22.825, "splay_distance": 3.505, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 169.267, "theta": -147.569, "eta_prime": -172.054, "theta_prime": -148.242, "eta_base": -120.461, "theta_base": -123.304, "v0": 6.521, "v1": -30.803, "v2": 42.690, "v3": -40.006, "v4": 21.091, "amplitude": 43.384, "phase_angle": 10.257, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 36.297, 6.099, 90.827 ], "x_axis": [ 0.183, -0.033, 0.983 ], "y_axis": [ -0.983, -0.035, 0.182 ], "z_axis": [ 0.029, -0.999, -0.039 ], "quaternion": [ 0.527, 0.561, -0.453, 0.451 ] } }, { "index": 603, "index_chain": 128, "chain_name": "S", "nt_resnum": 128, "nt_name": "U", "nt_code": "U", "nt_id": "///S/128", "linked_nts": [ "///S/127", "///S/129" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -55.626, "beta": 158.811, "gamma": 53.957, "delta": 77.020, "epsilon": -136.318, "zeta": -94.659, "epsilon_zeta": -41.659, "bb_type": "BI", "chi": -161.101, "glyco_bond": "anti", "C5prime_xyz": [ -1.270, 8.681, 0.611 ], "P_xyz": [ 1.313, 8.863, 0.229 ], "form": "A", "ssZp": 4.475, "Dp": 4.817, "splay_angle": 20.677, "splay_distance": 3.156, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 170.238, "theta": -151.865, "eta_prime": 179.657, "theta_prime": -151.809, "eta_base": -140.740, "theta_base": -131.262, "v0": 10.125, "v1": -35.569, "v2": 45.932, "v3": -41.301, "v4": 19.887, "amplitude": 46.207, "phase_angle": 6.255, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.667, "filter_rmsd": 0.109, "frame": { "rmsd": 0.008, "origin": [ 37.776, 2.934, 91.110 ], "x_axis": [ -0.374, -0.105, 0.922 ], "y_axis": [ -0.913, -0.132, -0.385 ], "z_axis": [ 0.162, -0.986, -0.046 ], "quaternion": [ 0.335, 0.448, -0.567, 0.604 ] } }, { "index": 604, "index_chain": 129, "chain_name": "S", "nt_resnum": 129, "nt_name": "G", "nt_code": "G", "nt_id": "///S/129", "linked_nts": [ "///S/128", "///S/130" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -34.434, "beta": 161.780, "gamma": 24.746, "delta": 83.646, "epsilon": -158.529, "zeta": -47.643, "epsilon_zeta": -110.886, "bb_type": "BI", "chi": -159.872, "glyco_bond": "anti", "C5prime_xyz": [ -0.921, 8.525, 0.536 ], "P_xyz": [ 1.702, 8.590, 0.924 ], "form": "A", "ssZp": 4.520, "Dp": 4.696, "splay_angle": 24.354, "splay_distance": 3.934, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 164.530, "theta": -137.561, "eta_prime": 172.686, "theta_prime": -148.485, "eta_base": -152.457, "theta_base": -144.626, "v0": 15.737, "v1": -36.565, "v2": 41.875, "v3": -34.131, "v4": 11.860, "amplitude": 41.925, "phase_angle": 357.196, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.010, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 38.925, 0.104, 91.907 ], "x_axis": [ -0.825, 0.180, 0.535 ], "y_axis": [ -0.564, -0.202, -0.801 ], "z_axis": [ -0.036, -0.963, 0.269 ], "quaternion": [ 0.246, 0.165, -0.582, 0.758 ] } }, { "index": 605, "index_chain": 130, "chain_name": "S", "nt_resnum": 130, "nt_name": "A", "nt_code": "A", "nt_id": "///S/130", "linked_nts": [ "///S/129", "///S/131" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -150.896, "beta": 127.763, "gamma": 146.842, "delta": 94.161, "epsilon": -114.851, "zeta": -69.614, "epsilon_zeta": -45.237, "bb_type": "--", "chi": 171.145, "glyco_bond": "anti", "C5prime_xyz": [ -0.754, 7.421, 2.136 ], "P_xyz": [ 0.730, 9.430, 1.223 ], "form": ".", "ssZp": 4.880, "Dp": 4.869, "splay_angle": 32.539, "splay_distance": 4.734, "splay_ratio": 0.282, "d22": null, "d64": null, "eta": 169.792, "theta": -146.936, "eta_prime": 175.405, "theta_prime": -140.251, "eta_base": -161.749, "theta_base": -97.904, "v0": 29.226, "v1": -42.016, "v2": 38.373, "v3": -22.653, "v4": -4.055, "amplitude": 42.013, "phase_angle": 335.975, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.036, "frame": { "rmsd": 0.007, "origin": [ 40.570, -2.517, 94.335 ], "x_axis": [ -0.944, 0.214, 0.253 ], "y_axis": [ -0.306, -0.272, -0.912 ], "z_axis": [ -0.127, -0.938, 0.322 ], "quaternion": [ 0.163, 0.040, -0.581, 0.797 ] } }, { "index": 606, "index_chain": 131, "chain_name": "S", "nt_resnum": 131, "nt_name": "A", "nt_code": "A", "nt_id": "///S/131", "linked_nts": [ "///S/130", "///S/132" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.777, "beta": -171.695, "gamma": 40.695, "delta": 86.554, "epsilon": -156.971, "zeta": -82.095, "epsilon_zeta": -74.877, "bb_type": "BI", "chi": -173.278, "glyco_bond": "anti", "C5prime_xyz": [ -1.041, 8.305, 1.356 ], "P_xyz": [ 1.411, 8.243, 2.320 ], "form": ".", "ssZp": 4.694, "Dp": 4.694, "splay_angle": 31.720, "splay_distance": 4.932, "splay_ratio": 0.278, "d22": null, "d64": null, "eta": 157.638, "theta": -161.105, "eta_prime": -179.628, "theta_prime": -160.039, "eta_base": -119.079, "theta_base": -163.098, "v0": 16.958, "v1": -36.304, "v2": 40.741, "v3": -31.951, "v4": 9.611, "amplitude": 40.918, "phase_angle": 354.669, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.224, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 37.595, -5.281, 96.766 ], "x_axis": [ -0.713, 0.170, -0.680 ], "y_axis": [ 0.636, -0.249, -0.730 ], "z_axis": [ -0.294, -0.953, 0.069 ], "quaternion": [ -0.164, -0.342, -0.591, 0.713 ] } }, { "index": 607, "index_chain": 132, "chain_name": "S", "nt_resnum": 132, "nt_name": "A", "nt_code": "A", "nt_id": "///S/132", "linked_nts": [ "///S/131", "///S/133" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -66.779, "beta": -178.699, "gamma": 44.092, "delta": 72.675, "epsilon": -150.438, "zeta": -51.169, "epsilon_zeta": -99.269, "bb_type": "BI", "chi": -164.975, "glyco_bond": "anti", "C5prime_xyz": [ -1.179, 8.675, 0.821 ], "P_xyz": [ 1.398, 9.169, 1.134 ], "form": ".", "ssZp": 4.539, "Dp": 4.695, "splay_angle": 28.038, "splay_distance": 4.618, "splay_ratio": 0.259, "d22": null, "d64": null, "eta": 164.395, "theta": -136.785, "eta_prime": 166.184, "theta_prime": -138.215, "eta_base": 171.908, "theta_base": -112.698, "v0": 12.458, "v1": -39.341, "v2": 50.303, "v3": -43.900, "v4": 20.000, "amplitude": 50.456, "phase_angle": 4.469, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.652, "filter_rmsd": 0.040, "frame": { "rmsd": 0.008, "origin": [ 36.994, -7.543, 101.107 ], "x_axis": [ -0.575, 0.123, -0.809 ], "y_axis": [ 0.728, -0.373, -0.575 ], "z_axis": [ -0.373, -0.919, 0.125 ], "quaternion": [ -0.210, -0.410, -0.519, 0.720 ] } }, { "index": 608, "index_chain": 133, "chain_name": "S", "nt_resnum": 133, "nt_name": "G", "nt_code": "G", "nt_id": "///S/133", "linked_nts": [ "///S/132", "///S/134" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem", "alpha": -145.899, "beta": 151.455, "gamma": 148.794, "delta": 89.529, "epsilon": -117.118, "zeta": -72.526, "epsilon_zeta": -44.592, "bb_type": "--", "chi": 173.091, "glyco_bond": "anti", "C5prime_xyz": [ -0.932, 7.749, 2.113 ], "P_xyz": [ 0.813, 9.625, 1.405 ], "form": ".", "ssZp": 4.855, "Dp": 4.848, "splay_angle": 31.584, "splay_distance": 4.656, "splay_ratio": 0.274, "d22": null, "d64": null, "eta": -179.621, "theta": -149.326, "eta_prime": -168.076, "theta_prime": -147.570, "eta_base": -124.869, "theta_base": -110.222, "v0": 24.617, "v1": -40.973, "v2": 41.249, "v3": -27.992, "v4": 2.212, "amplitude": 42.821, "phase_angle": 344.425, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 32.764, -9.378, 100.849 ], "x_axis": [ -0.078, -0.013, -0.997 ], "y_axis": [ 0.922, -0.380, -0.067 ], "z_axis": [ -0.378, -0.925, 0.042 ], "quaternion": [ -0.382, -0.561, -0.405, 0.612 ] } }, { "index": 609, "index_chain": 134, "chain_name": "S", "nt_resnum": 134, "nt_name": "U", "nt_code": "U", "nt_id": "///S/134", "linked_nts": [ "///S/133", "///S/135" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet", "alpha": -95.674, "beta": 161.243, "gamma": 77.533, "delta": 73.652, "epsilon": -156.842, "zeta": -64.930, "epsilon_zeta": -91.913, "bb_type": "BI", "chi": 161.378, "glyco_bond": "anti", "C5prime_xyz": [ -1.504, 7.701, 2.603 ], "P_xyz": [ 1.045, 8.339, 2.551 ], "form": ".", "ssZp": 4.282, "Dp": 4.565, "splay_angle": 26.118, "splay_distance": 4.986, "splay_ratio": 0.299, "d22": null, "d64": null, "eta": 139.222, "theta": -150.560, "eta_prime": 165.830, "theta_prime": -152.200, "eta_base": -124.582, "theta_base": -166.300, "v0": 19.618, "v1": -46.421, "v2": 54.950, "v3": -44.085, "v4": 15.544, "amplitude": 54.989, "phase_angle": 357.830, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.024, "filter_rmsd": 0.108, "frame": { "rmsd": 0.010, "origin": [ 29.928, -12.630, 99.103 ], "x_axis": [ 0.625, -0.141, -0.768 ], "y_axis": [ 0.764, -0.090, 0.639 ], "z_axis": [ -0.159, -0.986, 0.051 ], "quaternion": [ 0.630, 0.645, 0.242, -0.359 ] } }, { "index": 610, "index_chain": 135, "chain_name": "S", "nt_resnum": 135, "nt_name": "G", "nt_code": "G", "nt_id": "///S/135", "linked_nts": [ "///S/134", "///S/136" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop", "alpha": -72.917, "beta": -146.262, "gamma": 55.326, "delta": 76.787, "epsilon": -167.966, "zeta": -64.472, "epsilon_zeta": -103.494, "bb_type": "BI", "chi": -158.544, "glyco_bond": "anti", "C5prime_xyz": [ -1.874, 9.005, 0.339 ], "P_xyz": [ 0.401, 9.911, 1.323 ], "form": ".", "ssZp": 4.324, "Dp": 4.435, "splay_angle": 74.226, "splay_distance": 12.421, "splay_ratio": 0.611, "d22": null, "d64": null, "eta": -172.622, "theta": -170.826, "eta_prime": -172.019, "theta_prime": 177.757, "eta_base": 177.102, "theta_base": 177.493, "v0": -6.313, "v1": -20.426, "v2": 37.759, "v3": -42.302, "v4": 30.799, "amplitude": 42.345, "phase_angle": 26.912, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.557, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 25.578, -12.239, 96.697 ], "x_axis": [ 0.829, -0.144, -0.541 ], "y_axis": [ 0.477, -0.325, 0.817 ], "z_axis": [ -0.293, -0.935, -0.201 ], "quaternion": [ 0.571, 0.767, 0.108, -0.272 ] } }, { "index": 611, "index_chain": 136, "chain_name": "S", "nt_resnum": 136, "nt_name": "U", "nt_code": "U", "nt_id": "///S/136", "linked_nts": [ "///S/135", "///S/137" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack", "alpha": -167.347, "beta": 98.655, "gamma": -168.076, "delta": 64.715, "epsilon": 77.155, "zeta": 60.303, "epsilon_zeta": 16.853, "bb_type": "--", "chi": -164.403, "glyco_bond": "anti", "C5prime_xyz": [ -1.478, 8.747, 0.793 ], "P_xyz": [ -2.783, 11.003, 0.468 ], "form": ".", "ssZp": 4.066, "Dp": 4.089, "splay_angle": 22.449, "splay_distance": 4.009, "splay_ratio": 0.204, "d22": null, "d64": null, "eta": -149.633, "theta": 165.493, "eta_prime": -177.637, "theta_prime": 178.706, "eta_base": 159.078, "theta_base": -145.263, "v0": 8.921, "v1": -37.761, "v2": 51.042, "v3": -47.233, "v4": 24.311, "amplitude": 51.677, "phase_angle": 8.993, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1f", "suiteness": 0.027, "filter_rmsd": 0.109, "frame": { "rmsd": 0.010, "origin": [ 14.800, -18.041, 98.809 ], "x_axis": [ 0.170, -0.011, -0.985 ], "y_axis": [ 0.985, 0.027, 0.170 ], "z_axis": [ 0.025, -1.000, 0.015 ], "quaternion": [ 0.550, 0.531, 0.459, -0.452 ] } }, { "index": 612, "index_chain": 137, "chain_name": "S", "nt_resnum": 137, "nt_name": "G", "nt_code": "G", "nt_id": "///S/137", "linked_nts": [ "///S/136", "///S/138" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 64.292, "beta": -171.730, "gamma": -162.298, "delta": 91.063, "epsilon": -148.672, "zeta": -62.138, "epsilon_zeta": -86.534, "bb_type": "BI", "chi": -175.026, "glyco_bond": "anti", "C5prime_xyz": [ -1.158, 8.258, 1.512 ], "P_xyz": [ 0.176, 10.391, 0.879 ], "form": "A", "ssZp": 4.601, "Dp": 4.613, "splay_angle": 19.932, "splay_distance": 3.232, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 157.264, "theta": -163.554, "eta_prime": 176.099, "theta_prime": -156.577, "eta_base": -138.148, "theta_base": -121.700, "v0": 15.620, "v1": -32.048, "v2": 35.725, "v3": -27.653, "v4": 7.747, "amplitude": 35.947, "phase_angle": 353.634, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 13.383, -21.449, 97.242 ], "x_axis": [ 0.639, 0.106, -0.762 ], "y_axis": [ 0.762, 0.042, 0.646 ], "z_axis": [ 0.100, -0.994, -0.054 ], "quaternion": [ 0.638, 0.642, 0.338, -0.257 ] } }, { "index": 613, "index_chain": 138, "chain_name": "S", "nt_resnum": 138, "nt_name": "A", "nt_code": "A", "nt_id": "///S/138", "linked_nts": [ "///S/137", "///S/139" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -99.084, "beta": -174.227, "gamma": 71.757, "delta": 77.647, "epsilon": -171.625, "zeta": -79.875, "epsilon_zeta": -91.750, "bb_type": "BI", "chi": -154.283, "glyco_bond": "anti", "C5prime_xyz": [ -1.554, 8.831, 0.189 ], "P_xyz": [ 1.028, 9.386, -0.117 ], "form": "A", "ssZp": 4.312, "Dp": 4.528, "splay_angle": 24.421, "splay_distance": 3.990, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 156.104, "theta": -132.580, "eta_prime": 177.570, "theta_prime": -136.930, "eta_base": -134.113, "theta_base": -110.930, "v0": 3.260, "v1": -29.184, "v2": 42.435, "v3": -41.303, "v4": 24.264, "amplitude": 43.778, "phase_angle": 14.231, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.098, "filter_rmsd": 0.036, "frame": { "rmsd": 0.008, "origin": [ 13.253, -23.915, 95.157 ], "x_axis": [ 0.975, 0.046, -0.217 ], "y_axis": [ 0.221, -0.254, 0.942 ], "z_axis": [ -0.011, -0.966, -0.258 ], "quaternion": [ 0.605, 0.788, 0.085, -0.072 ] } }, { "index": 614, "index_chain": 139, "chain_name": "S", "nt_resnum": 139, "nt_name": "U", "nt_code": "U", "nt_id": "///S/139", "linked_nts": [ "///S/138", "///S/140" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -175.770, "beta": -129.732, "gamma": 129.986, "delta": 72.507, "epsilon": -173.658, "zeta": -74.033, "epsilon_zeta": -99.625, "bb_type": "BI", "chi": -171.323, "glyco_bond": "anti", "C5prime_xyz": [ -2.176, 8.876, 1.042 ], "P_xyz": [ 0.250, 9.640, 0.340 ], "form": "A", "ssZp": 4.450, "Dp": 4.440, "splay_angle": 20.886, "splay_distance": 3.183, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 150.645, "theta": -140.365, "eta_prime": 174.476, "theta_prime": -148.196, "eta_base": -138.459, "theta_base": -101.132, "v0": -7.754, "v1": -20.827, "v2": 39.750, "v3": -45.011, "v4": 33.335, "amplitude": 45.054, "phase_angle": 28.082, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.107, "frame": { "rmsd": 0.008, "origin": [ 15.018, -26.671, 92.874 ], "x_axis": [ 0.871, 0.248, 0.425 ], "y_axis": [ -0.339, -0.324, 0.884 ], "z_axis": [ 0.356, -0.913, -0.198 ], "quaternion": [ 0.581, 0.773, -0.029, 0.252 ] } }, { "index": 615, "index_chain": 140, "chain_name": "S", "nt_resnum": 140, "nt_name": "G", "nt_code": "G", "nt_id": "///S/140", "linked_nts": [ "///S/139", "///S/141" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -150.116, "beta": -142.690, "gamma": 105.092, "delta": 78.778, "epsilon": -160.286, "zeta": -109.864, "epsilon_zeta": -50.422, "bb_type": "BI", "chi": -158.012, "glyco_bond": "anti", "C5prime_xyz": [ -1.370, 8.754, 0.428 ], "P_xyz": [ 1.177, 8.831, -0.255 ], "form": ".", "ssZp": 4.485, "Dp": 4.693, "splay_angle": 20.965, "splay_distance": 3.212, "splay_ratio": 0.182, "d22": null, "d64": null, "eta": 154.383, "theta": -153.810, "eta_prime": 170.554, "theta_prime": -158.898, "eta_base": -121.940, "theta_base": -169.349, "v0": 7.346, "v1": -31.504, "v2": 42.007, "v3": -38.970, "v4": 20.195, "amplitude": 42.522, "phase_angle": 8.930, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 17.712, -28.365, 92.806 ], "x_axis": [ 0.336, -0.086, 0.938 ], "y_axis": [ -0.761, -0.612, 0.216 ], "z_axis": [ 0.555, -0.786, -0.271 ], "quaternion": [ 0.337, 0.745, -0.284, 0.501 ] } }, { "index": 616, "index_chain": 141, "chain_name": "S", "nt_resnum": 141, "nt_name": "A", "nt_code": "A", "nt_id": "///S/141", "linked_nts": [ "///S/140", null ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": 170.490, "beta": -148.827, "gamma": 158.704, "delta": 101.503, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -148.438, "glyco_bond": "anti", "C5prime_xyz": [ -0.980, 8.478, 0.009 ], "P_xyz": [ 0.981, 8.623, -1.784 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 9.583, "v1": -18.567, "v2": 20.138, "v3": -15.239, "v4": 3.718, "amplitude": 20.359, "phase_angle": 351.562, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.035, "frame": { "rmsd": 0.008, "origin": [ 19.776, -29.375, 90.562 ], "x_axis": [ 0.048, -0.162, 0.986 ], "y_axis": [ -0.505, -0.855, -0.116 ], "z_axis": [ 0.862, -0.492, -0.123 ], "quaternion": [ 0.132, 0.712, -0.234, 0.649 ] } } ], "num_hbonds": 1448, "hbonds": [ { "index": 1, "atom1_serNum": 6, "atom2_serNum": 3281, "donAcc_type": "acceptable", "distance": 3.501, "atom1_id": "///E/-1/O2'", "atom2_id": "///F/0/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 13, "atom2_serNum": 3324, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///E/-1/N6", "atom2_id": "///F/2/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 13, "atom2_serNum": 4719, "donAcc_type": "questionable", "distance": 3.097, "atom1_id": "///E/-1/N6", "atom2_id": "///Q/56/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 14, "atom2_serNum": 3320, "donAcc_type": "acceptable", "distance": 2.669, "atom1_id": "///E/-1/N1", "atom2_id": "///F/2/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 23, "atom2_serNum": 69, "donAcc_type": "questionable", "distance": 3.065, "atom1_id": "///E/0/O4'", "atom2_id": "///E/2/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 27, "atom2_serNum": 958, "donAcc_type": "acceptable", "distance": 3.283, "atom1_id": "///E/0/O2'", "atom2_id": "///P/33/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 36, "atom2_serNum": 1466, "donAcc_type": "acceptable", "distance": 2.960, "atom1_id": "///E/0/N1", "atom2_id": "///P/57/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 38, "atom2_serNum": 1476, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///E/0/N3", "atom2_id": "///P/57/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 40, "atom2_serNum": 957, "donAcc_type": "questionable", "distance": 2.955, "atom1_id": "///E/0/OP2", "atom2_id": "///P/33/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 42, "atom2_serNum": 935, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///E/1/OP1", "atom2_id": "///P/32/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 42, "atom2_serNum": 958, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///E/1/OP1", "atom2_id": "///P/33/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 42, "atom2_serNum": 960, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///E/1/OP1", "atom2_id": "///P/33/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 43, "atom2_serNum": 1476, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///E/1/OP2", "atom2_id": "///P/57/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 43, "atom2_serNum": 16007, "donAcc_type": "acceptable", "distance": 2.436, "atom1_id": "///E/1/OP2", "atom2_id": "///P/5001/O1", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 15, "atom1_serNum": 44, "atom2_serNum": 16008, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///E/1/O5'", "atom2_id": "///P/5001/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 16, "atom1_serNum": 51, "atom2_serNum": 886, "donAcc_type": "acceptable", "distance": 2.717, "atom1_id": "///E/1/O2'", "atom2_id": "///P/30/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 59, "atom2_serNum": 16015, "donAcc_type": "acceptable", "distance": 2.982, "atom1_id": "///E/1/N1", "atom2_id": "///P/5001/OP2", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 18, "atom1_serNum": 61, "atom2_serNum": 16016, "donAcc_type": "acceptable", "distance": 3.386, "atom1_id": "///E/1/N2", "atom2_id": "///P/5001/OP3", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 19, "atom1_serNum": 65, "atom2_serNum": 874, "donAcc_type": "questionable", "distance": 2.999, "atom1_id": "///E/2/OP2", "atom2_id": "///P/30/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 73, "atom2_serNum": 3260, "donAcc_type": "acceptable", "distance": 2.765, "atom1_id": "///E/2/O2'", "atom2_id": "///F/-1/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 77, "atom2_serNum": 1453, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///E/2/O2", "atom2_id": "///P/56/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 77, "atom2_serNum": 3259, "donAcc_type": "standard", "distance": 3.116, "atom1_id": "///E/2/O2", "atom2_id": "///F/-1/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 78, "atom2_serNum": 1451, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///E/2/N3", "atom2_id": "///P/56/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 99, "atom2_serNum": 1430, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///E/3/O6", "atom2_id": "///P/55/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 100, "atom2_serNum": 1428, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///E/3/N1", "atom2_id": "///P/55/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 102, "atom2_serNum": 1427, "donAcc_type": "standard", "distance": 2.603, "atom1_id": "///E/3/N2", "atom2_id": "///P/55/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 119, "atom2_serNum": 1410, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///E/4/O2", "atom2_id": "///P/54/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 120, "atom2_serNum": 1408, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///E/4/N3", "atom2_id": "///P/54/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 122, "atom2_serNum": 1407, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///E/4/N4", "atom2_id": "///P/54/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 135, "atom2_serNum": 147, "donAcc_type": "acceptable", "distance": 3.148, "atom1_id": "///E/5/O2'", "atom2_id": "///E/6/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 135, "atom2_serNum": 825, "donAcc_type": "acceptable", "distance": 2.999, "atom1_id": "///E/5/O2'", "atom2_id": "///P/27/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 139, "atom2_serNum": 1387, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///E/5/O2", "atom2_id": "///P/53/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 140, "atom2_serNum": 1385, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///E/5/N3", "atom2_id": "///P/53/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 142, "atom2_serNum": 1384, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///E/5/N4", "atom2_id": "///P/53/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 174, "atom2_serNum": 827, "donAcc_type": "standard", "distance": 2.729, "atom1_id": "///E/7/O6", "atom2_id": "///P/27/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 174, "atom2_serNum": 1364, "donAcc_type": "standard", "distance": 3.303, "atom1_id": "///E/7/O6", "atom2_id": "///P/52/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 175, "atom2_serNum": 1362, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///E/7/N1", "atom2_id": "///P/52/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 177, "atom2_serNum": 1361, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///E/7/N2", "atom2_id": "///P/52/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 190, "atom2_serNum": 1324, "donAcc_type": "acceptable", "distance": 2.332, "atom1_id": "///E/8/O2'", "atom2_id": "///P/50/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 197, "atom2_serNum": 804, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///E/8/N6", "atom2_id": "///P/26/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 198, "atom2_serNum": 802, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///E/8/N1", "atom2_id": "///P/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 200, "atom2_serNum": 1322, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///E/8/N3", "atom2_id": "///P/50/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 219, "atom2_serNum": 784, "donAcc_type": "standard", "distance": 3.508, "atom1_id": "///E/9/N6", "atom2_id": "///P/25/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 220, "atom2_serNum": 782, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///E/9/N1", "atom2_id": "///P/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 234, "atom2_serNum": 2610, "donAcc_type": "acceptable", "distance": 2.660, "atom1_id": "///E/10/O2'", "atom2_id": "///P/112/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 238, "atom2_serNum": 764, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///E/10/O2", "atom2_id": "///P/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 238, "atom2_serNum": 2610, "donAcc_type": "acceptable", "distance": 3.358, "atom1_id": "///E/10/O2", "atom2_id": "///P/112/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 239, "atom2_serNum": 762, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///E/10/N3", "atom2_id": "///P/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 241, "atom2_serNum": 761, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///E/10/N4", "atom2_id": "///P/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 250, "atom2_serNum": 2606, "donAcc_type": "questionable", "distance": 3.159, "atom1_id": "///E/11/O4'", "atom2_id": "///P/112/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 252, "atom2_serNum": 275, "donAcc_type": "acceptable", "distance": 3.018, "atom1_id": "///E/11/O3'", "atom2_id": "///P/12/O1A", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 252, "atom2_serNum": 2587, "donAcc_type": "acceptable", "distance": 3.096, "atom1_id": "///E/11/O3'", "atom2_id": "///P/111/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 254, "atom2_serNum": 2587, "donAcc_type": "acceptable", "distance": 3.023, "atom1_id": "///E/11/O2'", "atom2_id": "///P/111/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 254, "atom2_serNum": 2598, "donAcc_type": "acceptable", "distance": 2.982, "atom1_id": "///E/11/O2'", "atom2_id": "///P/111/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 258, "atom2_serNum": 2597, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///E/11/O2", "atom2_id": "///P/111/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 259, "atom2_serNum": 740, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///E/11/N3", "atom2_id": "///P/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 261, "atom2_serNum": 739, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///E/11/O4", "atom2_id": "///P/23/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 266, "atom2_serNum": 272, "donAcc_type": "acceptable", "distance": 3.063, "atom1_id": "///P/12/O1G", "atom2_id": "///P/12/O2B", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 268, "atom2_serNum": 275, "donAcc_type": "acceptable", "distance": 3.176, "atom1_id": "///P/12/O3G", "atom2_id": "///P/12/O1A", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 271, "atom2_serNum": 276, "donAcc_type": "acceptable", "distance": 3.042, "atom1_id": "///P/12/O1B", "atom2_id": "///P/12/O2A", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 284, "atom2_serNum": 2574, "donAcc_type": "acceptable", "distance": 3.195, "atom1_id": "///P/12/O2'", "atom2_id": "///P/110/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 291, "atom2_serNum": 719, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///P/12/O6", "atom2_id": "///P/22/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 292, "atom2_serNum": 717, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///P/12/N1", "atom2_id": "///P/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 294, "atom2_serNum": 716, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///P/12/N2", "atom2_id": "///P/22/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 305, "atom2_serNum": 13220, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///P/13/O3'", "atom2_id": "///A/22/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 66, "atom1_serNum": 314, "atom2_serNum": 699, "donAcc_type": "standard", "distance": 3.548, "atom1_id": "///P/13/O6", "atom2_id": "///P/21/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 315, "atom2_serNum": 697, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///P/13/N1", "atom2_id": "///P/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 317, "atom2_serNum": 696, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///P/13/N2", "atom2_id": "///P/21/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 321, "atom2_serNum": 13220, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///P/14/OP1", "atom2_id": "///A/22/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 70, "atom1_serNum": 334, "atom2_serNum": 679, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///P/14/O2", "atom2_id": "///P/20/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 335, "atom2_serNum": 677, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///P/14/N3", "atom2_id": "///P/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 337, "atom2_serNum": 676, "donAcc_type": "standard", "distance": 3.677, "atom1_id": "///P/14/N4", "atom2_id": "///P/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 357, "atom2_serNum": 656, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///P/15/N6", "atom2_id": "///P/19/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 358, "atom2_serNum": 654, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///P/15/N1", "atom2_id": "///P/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 364, "atom2_serNum": 13203, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///P/16/OP2", "atom2_id": "///A/20/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 76, "atom1_serNum": 376, "atom2_serNum": 636, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///P/16/O2", "atom2_id": "///P/18/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 377, "atom2_serNum": 634, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///P/16/N3", "atom2_id": "///P/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 379, "atom2_serNum": 633, "donAcc_type": "standard", "distance": 2.658, "atom1_id": "///P/16/N4", "atom2_id": "///P/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 396, "atom2_serNum": 613, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///P/17/O2", "atom2_id": "///P/17/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 397, "atom2_serNum": 611, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///P/17/N3", "atom2_id": "///P/17/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 399, "atom2_serNum": 610, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///P/17/N4", "atom2_id": "///P/17/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 420, "atom2_serNum": 13466, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///P/17/N1", "atom2_id": "///A/52/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 83, "atom1_serNum": 438, "atom2_serNum": 484, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///P/17/O2", "atom2_id": "///P/17/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 439, "atom2_serNum": 13194, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///P/17/N3", "atom2_id": "///A/19/OE2", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 85, "atom1_serNum": 459, "atom2_serNum": 13168, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///P/17/N3", "atom2_id": "///A/16/OD1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 86, "atom1_serNum": 461, "atom2_serNum": 13688, "donAcc_type": "standard", "distance": 2.570, "atom1_id": "///P/17/O4", "atom2_id": "///A/80/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 87, "atom1_serNum": 474, "atom2_serNum": 13443, "donAcc_type": "acceptable", "distance": 2.796, "atom1_id": "///P/17/O2'", "atom2_id": "///A/50/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 88, "atom1_serNum": 478, "atom2_serNum": 13145, "donAcc_type": "acceptable", "distance": 3.333, "atom1_id": "///P/17/N7", "atom2_id": "///A/13/OH", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 89, "atom1_serNum": 478, "atom2_serNum": 13161, "donAcc_type": "standard", "distance": 3.358, "atom1_id": "///P/17/N7", "atom2_id": "///A/15/ND2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 90, "atom1_serNum": 481, "atom2_serNum": 13162, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///P/17/O6", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 91, "atom1_serNum": 484, "atom2_serNum": 13193, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///P/17/N2", "atom2_id": "///A/19/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 92, "atom1_serNum": 497, "atom2_serNum": 509, "donAcc_type": "acceptable", "distance": 2.975, "atom1_id": "///P/17/O2'", "atom2_id": "///P/17/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 93, "atom1_serNum": 502, "atom2_serNum": 13749, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///P/17/N3", "atom2_id": "///A/88/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 94, "atom1_serNum": 504, "atom2_serNum": 13735, "donAcc_type": "standard", "distance": 3.345, "atom1_id": "///P/17/N4", "atom2_id": "///A/86/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 95, "atom1_serNum": 524, "atom2_serNum": 13757, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///P/17/N6", "atom2_id": "///A/89/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 96, "atom1_serNum": 525, "atom2_serNum": 13774, "donAcc_type": "acceptable", "distance": 2.893, "atom1_id": "///P/17/N1", "atom2_id": "///A/91/OG", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 97, "atom1_serNum": 537, "atom2_serNum": 562, "donAcc_type": "questionable", "distance": 3.303, "atom1_id": "///P/17/O3'", "atom2_id": "///P/17/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 98, "atom1_serNum": 539, "atom2_serNum": 13781, "donAcc_type": "acceptable", "distance": 2.667, "atom1_id": "///P/17/O2'", "atom2_id": "///A/92/OD1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 99, "atom1_serNum": 539, "atom2_serNum": 13782, "donAcc_type": "acceptable", "distance": 3.139, "atom1_id": "///P/17/O2'", "atom2_id": "///A/92/OD2", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 100, "atom1_serNum": 543, "atom2_serNum": 13775, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///P/17/O2", "atom2_id": "///A/92/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 101, "atom1_serNum": 544, "atom2_serNum": 13775, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///P/17/N3", "atom2_id": "///A/92/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 102, "atom1_serNum": 546, "atom2_serNum": 13759, "donAcc_type": "acceptable", "distance": 2.807, "atom1_id": "///P/17/N4", "atom2_id": "///A/89/OG1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 103, "atom1_serNum": 546, "atom2_serNum": 13764, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///P/17/N4", "atom2_id": "///A/90/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 104, "atom1_serNum": 559, "atom2_serNum": 567, "donAcc_type": "acceptable", "distance": 3.338, "atom1_id": "///P/17/O2'", "atom2_id": "///P/17/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 105, "atom1_serNum": 574, "atom2_serNum": 13414, "donAcc_type": "acceptable", "distance": 3.137, "atom1_id": "///P/17/OP1", "atom2_id": "///A/46/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 106, "atom1_serNum": 595, "atom2_serNum": 13432, "donAcc_type": "standard", "distance": 2.766, "atom1_id": "///P/17/OP2", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 107, "atom1_serNum": 607, "atom2_serNum": 13467, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///P/17/N7", "atom2_id": "///A/52/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 108, "atom1_serNum": 610, "atom2_serNum": 13466, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///P/17/O6", "atom2_id": "///A/52/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 109, "atom1_serNum": 754, "atom2_serNum": 2618, "donAcc_type": "acceptable", "distance": 2.572, "atom1_id": "///P/24/O2'", "atom2_id": "///P/112/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 110, "atom1_serNum": 764, "atom2_serNum": 2620, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///P/24/N2", "atom2_id": "///P/112/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 111, "atom1_serNum": 775, "atom2_serNum": 2632, "donAcc_type": "acceptable", "distance": 3.139, "atom1_id": "///P/25/O3'", "atom2_id": "///P/113/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 112, "atom1_serNum": 777, "atom2_serNum": 2632, "donAcc_type": "acceptable", "distance": 2.973, "atom1_id": "///P/25/O2'", "atom2_id": "///P/113/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 113, "atom1_serNum": 817, "atom2_serNum": 1364, "donAcc_type": "acceptable", "distance": 3.096, "atom1_id": "///P/27/O2'", "atom2_id": "///P/52/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 114, "atom1_serNum": 828, "atom2_serNum": 1364, "donAcc_type": "standard", "distance": 3.837, "atom1_id": "///P/27/N3", "atom2_id": "///P/52/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 115, "atom1_serNum": 850, "atom2_serNum": 869, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///P/28/N3", "atom2_id": "///P/29/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 116, "atom1_serNum": 858, "atom2_serNum": 2353, "donAcc_type": "acceptable", "distance": 3.497, "atom1_id": "///P/29/O4'", "atom2_id": "///P/100/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 117, "atom1_serNum": 860, "atom2_serNum": 2331, "donAcc_type": "acceptable", "distance": 2.932, "atom1_id": "///P/29/O3'", "atom2_id": "///P/99/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 118, "atom1_serNum": 862, "atom2_serNum": 2331, "donAcc_type": "acceptable", "distance": 2.803, "atom1_id": "///P/29/O2'", "atom2_id": "///P/99/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 119, "atom1_serNum": 862, "atom2_serNum": 2341, "donAcc_type": "acceptable", "distance": 2.674, "atom1_id": "///P/29/O2'", "atom2_id": "///P/99/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 120, "atom1_serNum": 862, "atom2_serNum": 2349, "donAcc_type": "acceptable", "distance": 3.063, "atom1_id": "///P/29/O2'", "atom2_id": "///P/100/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 121, "atom1_serNum": 866, "atom2_serNum": 1217, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///P/29/O2", "atom2_id": "///P/45/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 122, "atom1_serNum": 867, "atom2_serNum": 1215, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///P/29/N3", "atom2_id": "///P/45/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 123, "atom1_serNum": 869, "atom2_serNum": 1214, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///P/29/N4", "atom2_id": "///P/45/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 124, "atom1_serNum": 882, "atom2_serNum": 2309, "donAcc_type": "acceptable", "distance": 2.945, "atom1_id": "///P/30/O2'", "atom2_id": "///P/98/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 125, "atom1_serNum": 882, "atom2_serNum": 2319, "donAcc_type": "acceptable", "distance": 2.951, "atom1_id": "///P/30/O2'", "atom2_id": "///P/98/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 126, "atom1_serNum": 882, "atom2_serNum": 2327, "donAcc_type": "acceptable", "distance": 3.449, "atom1_id": "///P/30/O2'", "atom2_id": "///P/99/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 127, "atom1_serNum": 889, "atom2_serNum": 1194, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///P/30/O6", "atom2_id": "///P/44/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 128, "atom1_serNum": 890, "atom2_serNum": 1192, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///P/30/N1", "atom2_id": "///P/44/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 129, "atom1_serNum": 892, "atom2_serNum": 1191, "donAcc_type": "standard", "distance": 2.666, "atom1_id": "///P/30/N2", "atom2_id": "///P/44/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 130, "atom1_serNum": 892, "atom2_serNum": 2853, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///P/30/N2", "atom2_id": "///P/123/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 131, "atom1_serNum": 901, "atom2_serNum": 2852, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///P/31/O4'", "atom2_id": "///P/123/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 132, "atom1_serNum": 905, "atom2_serNum": 2875, "donAcc_type": "acceptable", "distance": 3.327, "atom1_id": "///P/31/O2'", "atom2_id": "///P/124/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 133, "atom1_serNum": 905, "atom2_serNum": 2897, "donAcc_type": "acceptable", "distance": 2.926, "atom1_id": "///P/31/O2'", "atom2_id": "///P/125/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 134, "atom1_serNum": 912, "atom2_serNum": 1174, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///P/31/N6", "atom2_id": "///P/43/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 135, "atom1_serNum": 913, "atom2_serNum": 1172, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///P/31/N1", "atom2_id": "///P/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 136, "atom1_serNum": 950, "atom2_serNum": 1511, "donAcc_type": "acceptable", "distance": 2.678, "atom1_id": "///P/33/O2'", "atom2_id": "///P/59/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 137, "atom1_serNum": 961, "atom2_serNum": 1511, "donAcc_type": "acceptable", "distance": 2.692, "atom1_id": "///P/33/N3", "atom2_id": "///P/59/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 138, "atom1_serNum": 969, "atom2_serNum": 1507, "donAcc_type": "questionable", "distance": 2.955, "atom1_id": "///P/34/O4'", "atom2_id": "///P/59/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 139, "atom1_serNum": 985, "atom2_serNum": 2033, "donAcc_type": "acceptable", "distance": 3.139, "atom1_id": "///P/35/OP2", "atom2_id": "///P/84/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 140, "atom1_serNum": 989, "atom2_serNum": 2033, "donAcc_type": "acceptable", "distance": 3.108, "atom1_id": "///P/35/O4'", "atom2_id": "///P/84/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 141, "atom1_serNum": 993, "atom2_serNum": 5322, "donAcc_type": "acceptable", "distance": 3.569, "atom1_id": "///P/35/O2'", "atom2_id": "///Q/85/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 142, "atom1_serNum": 1000, "atom2_serNum": 1643, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///P/35/O6", "atom2_id": "///P/65/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 143, "atom1_serNum": 1001, "atom2_serNum": 1641, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///P/35/N1", "atom2_id": "///P/65/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 144, "atom1_serNum": 1003, "atom2_serNum": 1640, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///P/35/N2", "atom2_id": "///P/65/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 145, "atom1_serNum": 1023, "atom2_serNum": 1623, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///P/36/O6", "atom2_id": "///P/64/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 146, "atom1_serNum": 1024, "atom2_serNum": 1621, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///P/36/N1", "atom2_id": "///P/64/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 147, "atom1_serNum": 1026, "atom2_serNum": 1620, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///P/36/N2", "atom2_id": "///P/64/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 148, "atom1_serNum": 1046, "atom2_serNum": 1601, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///P/37/O6", "atom2_id": "///P/63/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 149, "atom1_serNum": 1047, "atom2_serNum": 1600, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///P/37/N1", "atom2_id": "///P/63/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 150, "atom1_serNum": 1069, "atom2_serNum": 1561, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///P/38/O6", "atom2_id": "///P/61/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 151, "atom1_serNum": 1069, "atom2_serNum": 1583, "donAcc_type": "standard", "distance": 3.058, "atom1_id": "///P/38/O6", "atom2_id": "///P/62/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 152, "atom1_serNum": 1070, "atom2_serNum": 1581, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///P/38/N1", "atom2_id": "///P/62/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 153, "atom1_serNum": 1072, "atom2_serNum": 1580, "donAcc_type": "standard", "distance": 2.624, "atom1_id": "///P/38/N2", "atom2_id": "///P/62/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 154, "atom1_serNum": 1090, "atom2_serNum": 1562, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///P/39/N3", "atom2_id": "///P/61/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 155, "atom1_serNum": 1092, "atom2_serNum": 1561, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///P/39/O4", "atom2_id": "///P/61/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 156, "atom1_serNum": 1109, "atom2_serNum": 1539, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///P/40/O2", "atom2_id": "///P/60/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 157, "atom1_serNum": 1110, "atom2_serNum": 1538, "donAcc_type": "standard", "distance": 3.428, "atom1_id": "///P/40/N3", "atom2_id": "///P/60/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 158, "atom1_serNum": 1125, "atom2_serNum": 1129, "donAcc_type": "acceptable", "distance": 2.711, "atom1_id": "///P/41/O2'", "atom2_id": "///P/41/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 159, "atom1_serNum": 1145, "atom2_serNum": 16009, "donAcc_type": "acceptable", "distance": 3.327, "atom1_id": "///P/42/O2'", "atom2_id": "///P/5001/O3", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 160, "atom1_serNum": 1152, "atom2_serNum": 1503, "donAcc_type": "standard", "distance": 2.645, "atom1_id": "///P/42/N6", "atom2_id": "///P/59/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 161, "atom1_serNum": 1159, "atom2_serNum": 16009, "donAcc_type": "acceptable", "distance": 2.692, "atom1_id": "///P/43/OP2", "atom2_id": "///P/5001/O3", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 162, "atom1_serNum": 1163, "atom2_serNum": 1531, "donAcc_type": "acceptable", "distance": 3.383, "atom1_id": "///P/43/O4'", "atom2_id": "///P/60/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 163, "atom1_serNum": 1174, "atom2_serNum": 16008, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///P/43/O4", "atom2_id": "///P/5001/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 164, "atom1_serNum": 1185, "atom2_serNum": 2867, "donAcc_type": "acceptable", "distance": 2.765, "atom1_id": "///P/44/O3'", "atom2_id": "///P/124/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 165, "atom1_serNum": 1187, "atom2_serNum": 2867, "donAcc_type": "acceptable", "distance": 2.930, "atom1_id": "///P/44/O2'", "atom2_id": "///P/124/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 166, "atom1_serNum": 1187, "atom2_serNum": 2877, "donAcc_type": "acceptable", "distance": 2.461, "atom1_id": "///P/44/O2'", "atom2_id": "///P/124/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 167, "atom1_serNum": 1187, "atom2_serNum": 2885, "donAcc_type": "acceptable", "distance": 2.836, "atom1_id": "///P/44/O2'", "atom2_id": "///P/125/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 168, "atom1_serNum": 1207, "atom2_serNum": 2845, "donAcc_type": "acceptable", "distance": 2.906, "atom1_id": "///P/45/O2'", "atom2_id": "///P/123/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 169, "atom1_serNum": 1207, "atom2_serNum": 2855, "donAcc_type": "acceptable", "distance": 2.723, "atom1_id": "///P/45/O2'", "atom2_id": "///P/123/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 170, "atom1_serNum": 1207, "atom2_serNum": 2863, "donAcc_type": "acceptable", "distance": 3.234, "atom1_id": "///P/45/O2'", "atom2_id": "///P/124/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 171, "atom1_serNum": 1217, "atom2_serNum": 2317, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///P/45/N2", "atom2_id": "///P/98/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 172, "atom1_serNum": 1226, "atom2_serNum": 2316, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///P/46/O4'", "atom2_id": "///P/98/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 173, "atom1_serNum": 1230, "atom2_serNum": 2338, "donAcc_type": "acceptable", "distance": 3.392, "atom1_id": "///P/46/O2'", "atom2_id": "///P/99/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 174, "atom1_serNum": 1230, "atom2_serNum": 2361, "donAcc_type": "acceptable", "distance": 2.615, "atom1_id": "///P/46/O2'", "atom2_id": "///P/100/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 175, "atom1_serNum": 1237, "atom2_serNum": 1341, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///P/46/N6", "atom2_id": "///P/51/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 176, "atom1_serNum": 1238, "atom2_serNum": 1342, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///P/46/N1", "atom2_id": "///P/51/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 177, "atom1_serNum": 1252, "atom2_serNum": 2375, "donAcc_type": "acceptable", "distance": 2.776, "atom1_id": "///P/47/O2'", "atom2_id": "///P/101/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 178, "atom1_serNum": 1262, "atom2_serNum": 1337, "donAcc_type": "acceptable", "distance": 2.880, "atom1_id": "///P/47/N2", "atom2_id": "///P/51/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 179, "atom1_serNum": 1313, "atom2_serNum": 1353, "donAcc_type": "questionable", "distance": 2.830, "atom1_id": "///P/50/O4'", "atom2_id": "///P/52/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 180, "atom1_serNum": 1474, "atom2_serNum": 16007, "donAcc_type": "acceptable", "distance": 3.174, "atom1_id": "///P/57/N1", "atom2_id": "///P/5001/O1", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 181, "atom1_serNum": 1660, "atom2_serNum": 2043, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///P/66/O2", "atom2_id": "///P/84/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 182, "atom1_serNum": 1661, "atom2_serNum": 2041, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///P/66/N3", "atom2_id": "///P/84/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 183, "atom1_serNum": 1663, "atom2_serNum": 2040, "donAcc_type": "standard", "distance": 3.288, "atom1_id": "///P/66/N4", "atom2_id": "///P/84/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 184, "atom1_serNum": 1683, "atom2_serNum": 2020, "donAcc_type": "standard", "distance": 3.481, "atom1_id": "///P/67/O6", "atom2_id": "///P/83/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 185, "atom1_serNum": 1684, "atom2_serNum": 2018, "donAcc_type": "standard", "distance": 3.172, "atom1_id": "///P/67/N1", "atom2_id": "///P/83/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 186, "atom1_serNum": 1686, "atom2_serNum": 2017, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///P/67/N2", "atom2_id": "///P/83/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 187, "atom1_serNum": 1699, "atom2_serNum": 2098, "donAcc_type": "acceptable", "distance": 2.757, "atom1_id": "///P/68/O2'", "atom2_id": "///P/87/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 188, "atom1_serNum": 1707, "atom2_serNum": 1998, "donAcc_type": "standard", "distance": 3.316, "atom1_id": "///P/68/N1", "atom2_id": "///P/82/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 189, "atom1_serNum": 1709, "atom2_serNum": 1997, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///P/68/N2", "atom2_id": "///P/82/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 190, "atom1_serNum": 1709, "atom2_serNum": 1998, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///P/68/N2", "atom2_id": "///P/82/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 191, "atom1_serNum": 1709, "atom2_serNum": 2100, "donAcc_type": "standard", "distance": 3.650, "atom1_id": "///P/68/N2", "atom2_id": "///P/87/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 192, "atom1_serNum": 1726, "atom2_serNum": 2090, "donAcc_type": "acceptable", "distance": 2.862, "atom1_id": "///P/69/O2", "atom2_id": "///P/87/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 193, "atom1_serNum": 1727, "atom2_serNum": 1979, "donAcc_type": "standard", "distance": 3.412, "atom1_id": "///P/69/N3", "atom2_id": "///P/81/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 194, "atom1_serNum": 1729, "atom2_serNum": 1978, "donAcc_type": "standard", "distance": 2.798, "atom1_id": "///P/69/O4", "atom2_id": "///P/81/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 195, "atom1_serNum": 1742, "atom2_serNum": 3108, "donAcc_type": "acceptable", "distance": 3.384, "atom1_id": "///P/70/O2'", "atom2_id": "///P/135/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 196, "atom1_serNum": 1746, "atom2_serNum": 3111, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///P/70/O2", "atom2_id": "///P/135/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 197, "atom1_serNum": 1747, "atom2_serNum": 1957, "donAcc_type": "standard", "distance": 3.401, "atom1_id": "///P/70/N3", "atom2_id": "///P/80/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 198, "atom1_serNum": 1749, "atom2_serNum": 1956, "donAcc_type": "standard", "distance": 3.542, "atom1_id": "///P/70/O4", "atom2_id": "///P/80/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 199, "atom1_serNum": 1762, "atom2_serNum": 3117, "donAcc_type": "acceptable", "distance": 3.377, "atom1_id": "///P/71/O2'", "atom2_id": "///P/136/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 200, "atom1_serNum": 1769, "atom2_serNum": 1936, "donAcc_type": "standard", "distance": 3.566, "atom1_id": "///P/71/O6", "atom2_id": "///P/79/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 201, "atom1_serNum": 1770, "atom2_serNum": 1934, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///P/71/N1", "atom2_id": "///P/79/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 202, "atom1_serNum": 1772, "atom2_serNum": 1933, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///P/71/N2", "atom2_id": "///P/79/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 203, "atom1_serNum": 1772, "atom2_serNum": 1934, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///P/71/N2", "atom2_id": "///P/79/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 204, "atom1_serNum": 1785, "atom2_serNum": 1789, "donAcc_type": "acceptable", "distance": 3.044, "atom1_id": "///P/72/O2'", "atom2_id": "///P/72/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 205, "atom1_serNum": 1810, "atom2_serNum": 3240, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///P/73/N3", "atom2_id": "///P/141/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 206, "atom1_serNum": 1812, "atom2_serNum": 3239, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///P/73/O4", "atom2_id": "///P/141/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 207, "atom1_serNum": 1829, "atom2_serNum": 3219, "donAcc_type": "standard", "distance": 2.710, "atom1_id": "///P/74/O2", "atom2_id": "///P/140/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 208, "atom1_serNum": 1830, "atom2_serNum": 3217, "donAcc_type": "standard", "distance": 3.336, "atom1_id": "///P/74/N3", "atom2_id": "///P/140/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 209, "atom1_serNum": 1830, "atom2_serNum": 3219, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///P/74/N3", "atom2_id": "///P/140/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 210, "atom1_serNum": 1852, "atom2_serNum": 3196, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///P/75/N6", "atom2_id": "///P/139/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 211, "atom1_serNum": 1867, "atom2_serNum": 1883, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///P/76/O2'", "atom2_id": "///P/77/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 212, "atom1_serNum": 1871, "atom2_serNum": 3175, "donAcc_type": "questionable", "distance": 3.158, "atom1_id": "///P/76/O2", "atom2_id": "///P/138/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 213, "atom1_serNum": 1872, "atom2_serNum": 3175, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///P/76/N3", "atom2_id": "///P/138/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 214, "atom1_serNum": 1891, "atom2_serNum": 3154, "donAcc_type": "standard", "distance": 3.539, "atom1_id": "///P/77/O2", "atom2_id": "///P/137/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 215, "atom1_serNum": 1892, "atom2_serNum": 3152, "donAcc_type": "standard", "distance": 3.634, "atom1_id": "///P/77/N3", "atom2_id": "///P/137/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 216, "atom1_serNum": 1894, "atom2_serNum": 3151, "donAcc_type": "standard", "distance": 3.738, "atom1_id": "///P/77/N4", "atom2_id": "///P/137/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 217, "atom1_serNum": 1914, "atom2_serNum": 3131, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///P/78/N6", "atom2_id": "///P/136/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 218, "atom1_serNum": 1915, "atom2_serNum": 3129, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///P/78/N1", "atom2_id": "///P/136/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 219, "atom1_serNum": 1933, "atom2_serNum": 3129, "donAcc_type": "standard", "distance": 3.218, "atom1_id": "///P/79/O2", "atom2_id": "///P/136/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 220, "atom1_serNum": 1971, "atom2_serNum": 2112, "donAcc_type": "acceptable", "distance": 2.971, "atom1_id": "///P/81/O2'", "atom2_id": "///P/88/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 221, "atom1_serNum": 1993, "atom2_serNum": 2088, "donAcc_type": "acceptable", "distance": 3.379, "atom1_id": "///P/82/O2'", "atom2_id": "///P/87/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 222, "atom1_serNum": 1997, "atom2_serNum": 2090, "donAcc_type": "acceptable", "distance": 2.727, "atom1_id": "///P/82/O2", "atom2_id": "///P/87/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 223, "atom1_serNum": 2013, "atom2_serNum": 2078, "donAcc_type": "acceptable", "distance": 2.426, "atom1_id": "///P/83/O2'", "atom2_id": "///P/86/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 224, "atom1_serNum": 2056, "atom2_serNum": 5309, "donAcc_type": "acceptable", "distance": 3.810, "atom1_id": "///P/85/O2'", "atom2_id": "///Q/84/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 225, "atom1_serNum": 2119, "atom2_serNum": 3073, "donAcc_type": "questionable", "distance": 3.053, "atom1_id": "///P/88/O6", "atom2_id": "///P/133/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 226, "atom1_serNum": 2139, "atom2_serNum": 3076, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///P/89/O2", "atom2_id": "///P/133/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 227, "atom1_serNum": 2140, "atom2_serNum": 3074, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///P/89/N3", "atom2_id": "///P/133/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 228, "atom1_serNum": 2142, "atom2_serNum": 3073, "donAcc_type": "standard", "distance": 3.514, "atom1_id": "///P/89/N4", "atom2_id": "///P/133/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 229, "atom1_serNum": 2160, "atom2_serNum": 3052, "donAcc_type": "standard", "distance": 3.269, "atom1_id": "///P/90/N3", "atom2_id": "///P/132/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 230, "atom1_serNum": 2162, "atom2_serNum": 3051, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///P/90/O4", "atom2_id": "///P/132/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 231, "atom1_serNum": 2175, "atom2_serNum": 2178, "donAcc_type": "acceptable", "distance": 2.613, "atom1_id": "///P/91/O2'", "atom2_id": "///P/92/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 232, "atom1_serNum": 2175, "atom2_serNum": 2183, "donAcc_type": "acceptable", "distance": 2.703, "atom1_id": "///P/91/O2'", "atom2_id": "///P/92/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 233, "atom1_serNum": 2194, "atom2_serNum": 3007, "donAcc_type": "standard", "distance": 3.452, "atom1_id": "///P/92/O4", "atom2_id": "///P/130/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 234, "atom1_serNum": 2211, "atom2_serNum": 2985, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///P/93/O2", "atom2_id": "///P/129/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 235, "atom1_serNum": 2212, "atom2_serNum": 2984, "donAcc_type": "standard", "distance": 3.317, "atom1_id": "///P/93/N3", "atom2_id": "///P/129/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 236, "atom1_serNum": 2234, "atom2_serNum": 2941, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///P/94/N6", "atom2_id": "///P/127/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 237, "atom1_serNum": 2234, "atom2_serNum": 2964, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///P/94/N6", "atom2_id": "///P/128/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 238, "atom1_serNum": 2235, "atom2_serNum": 2962, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///P/94/N1", "atom2_id": "///P/128/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 239, "atom1_serNum": 2253, "atom2_serNum": 2944, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///P/95/O2", "atom2_id": "///P/127/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 240, "atom1_serNum": 2254, "atom2_serNum": 2942, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///P/95/N3", "atom2_id": "///P/127/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 241, "atom1_serNum": 2256, "atom2_serNum": 2941, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///P/95/N4", "atom2_id": "///P/127/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 242, "atom1_serNum": 2273, "atom2_serNum": 2919, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///P/96/O2", "atom2_id": "///P/126/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 243, "atom1_serNum": 2274, "atom2_serNum": 2918, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///P/96/N3", "atom2_id": "///P/126/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 244, "atom1_serNum": 2289, "atom2_serNum": 2293, "donAcc_type": "acceptable", "distance": 2.771, "atom1_id": "///P/97/O2'", "atom2_id": "///P/97/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 245, "atom1_serNum": 2335, "atom2_serNum": 2832, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///P/99/N7", "atom2_id": "///P/122/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 246, "atom1_serNum": 2338, "atom2_serNum": 2829, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///P/99/N6", "atom2_id": "///P/122/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 247, "atom1_serNum": 2338, "atom2_serNum": 2830, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///P/99/N6", "atom2_id": "///P/122/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 248, "atom1_serNum": 2357, "atom2_serNum": 2810, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///P/100/N7", "atom2_id": "///P/121/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 249, "atom1_serNum": 2360, "atom2_serNum": 2811, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///P/100/N6", "atom2_id": "///P/121/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 250, "atom1_serNum": 2367, "atom2_serNum": 2402, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///P/101/OP2", "atom2_id": "///P/102/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 251, "atom1_serNum": 2382, "atom2_serNum": 2788, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///P/101/O4", "atom2_id": "///P/120/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 252, "atom1_serNum": 2382, "atom2_serNum": 2790, "donAcc_type": "standard", "distance": 2.596, "atom1_id": "///P/101/O4", "atom2_id": "///P/120/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 253, "atom1_serNum": 2399, "atom2_serNum": 2767, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///P/102/O2", "atom2_id": "///P/119/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 254, "atom1_serNum": 2400, "atom2_serNum": 2765, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///P/102/N3", "atom2_id": "///P/119/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 255, "atom1_serNum": 2402, "atom2_serNum": 2764, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///P/102/N4", "atom2_id": "///P/119/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 256, "atom1_serNum": 2422, "atom2_serNum": 2744, "donAcc_type": "standard", "distance": 3.233, "atom1_id": "///P/103/N6", "atom2_id": "///P/118/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 257, "atom1_serNum": 2423, "atom2_serNum": 2742, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///P/103/N1", "atom2_id": "///P/118/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 258, "atom1_serNum": 2441, "atom2_serNum": 2722, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///P/104/O2", "atom2_id": "///P/117/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 259, "atom1_serNum": 2442, "atom2_serNum": 2721, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///P/104/N3", "atom2_id": "///P/117/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 260, "atom1_serNum": 2457, "atom2_serNum": 2470, "donAcc_type": "acceptable", "distance": 2.368, "atom1_id": "///P/105/O2'", "atom2_id": "///P/106/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 261, "atom1_serNum": 2462, "atom2_serNum": 2700, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///P/105/N3", "atom2_id": "///P/116/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 262, "atom1_serNum": 2464, "atom2_serNum": 2699, "donAcc_type": "standard", "distance": 3.111, "atom1_id": "///P/105/O4", "atom2_id": "///P/116/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 263, "atom1_serNum": 2484, "atom2_serNum": 2679, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///P/106/N6", "atom2_id": "///P/115/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 264, "atom1_serNum": 2485, "atom2_serNum": 2677, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///P/106/N1", "atom2_id": "///P/115/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 265, "atom1_serNum": 2499, "atom2_serNum": 4019, "donAcc_type": "acceptable", "distance": 3.405, "atom1_id": "///P/107/O2'", "atom2_id": "///Q/24/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 266, "atom1_serNum": 2506, "atom2_serNum": 2659, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///P/107/N6", "atom2_id": "///P/114/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 267, "atom1_serNum": 2507, "atom2_serNum": 2657, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///P/107/N1", "atom2_id": "///P/114/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 268, "atom1_serNum": 2528, "atom2_serNum": 2639, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///P/108/O6", "atom2_id": "///P/113/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 269, "atom1_serNum": 2529, "atom2_serNum": 2637, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///P/108/N1", "atom2_id": "///P/113/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 270, "atom1_serNum": 2531, "atom2_serNum": 2636, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///P/108/N2", "atom2_id": "///P/113/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 271, "atom1_serNum": 2544, "atom2_serNum": 2591, "donAcc_type": "acceptable", "distance": 2.787, "atom1_id": "///P/109/O2'", "atom2_id": "///P/111/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 272, "atom1_serNum": 2544, "atom2_serNum": 2594, "donAcc_type": "acceptable", "distance": 3.046, "atom1_id": "///P/109/O2'", "atom2_id": "///P/111/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 273, "atom1_serNum": 2552, "atom2_serNum": 2602, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///P/109/N1", "atom2_id": "///P/112/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 274, "atom1_serNum": 2554, "atom2_serNum": 2602, "donAcc_type": "standard", "distance": 2.562, "atom1_id": "///P/109/N2", "atom2_id": "///P/112/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 275, "atom1_serNum": 2554, "atom2_serNum": 2614, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///P/109/N2", "atom2_id": "///P/112/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 276, "atom1_serNum": 2587, "atom2_serNum": 2606, "donAcc_type": "acceptable", "distance": 3.155, "atom1_id": "///P/111/O2'", "atom2_id": "///P/112/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 277, "atom1_serNum": 2692, "atom2_serNum": 2710, "donAcc_type": "acceptable", "distance": 3.058, "atom1_id": "///P/116/O2'", "atom2_id": "///P/117/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 278, "atom1_serNum": 3022, "atom2_serNum": 3040, "donAcc_type": "acceptable", "distance": 3.274, "atom1_id": "///P/131/O2'", "atom2_id": "///P/132/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 279, "atom1_serNum": 3124, "atom2_serNum": 3135, "donAcc_type": "acceptable", "distance": 2.957, "atom1_id": "///P/136/O2'", "atom2_id": "///P/137/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 280, "atom1_serNum": 3124, "atom2_serNum": 3137, "donAcc_type": "acceptable", "distance": 2.689, "atom1_id": "///P/136/O2'", "atom2_id": "///P/137/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 281, "atom1_serNum": 3209, "atom2_serNum": 3225, "donAcc_type": "acceptable", "distance": 3.108, "atom1_id": "///P/140/O2'", "atom2_id": "///P/141/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 282, "atom1_serNum": 3252, "atom2_serNum": 3265, "donAcc_type": "acceptable", "distance": 2.851, "atom1_id": "///F/-1/O2'", "atom2_id": "///F/0/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 283, "atom1_serNum": 3266, "atom2_serNum": 3313, "donAcc_type": "questionable", "distance": 3.324, "atom1_id": "///F/0/O5'", "atom2_id": "///F/2/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 284, "atom1_serNum": 3269, "atom2_serNum": 3316, "donAcc_type": "questionable", "distance": 3.118, "atom1_id": "///F/0/O4'", "atom2_id": "///F/2/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 285, "atom1_serNum": 3273, "atom2_serNum": 4232, "donAcc_type": "acceptable", "distance": 3.226, "atom1_id": "///F/0/O2'", "atom2_id": "///Q/33/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 286, "atom1_serNum": 3282, "atom2_serNum": 4732, "donAcc_type": "acceptable", "distance": 2.766, "atom1_id": "///F/0/N1", "atom2_id": "///Q/57/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 287, "atom1_serNum": 3284, "atom2_serNum": 4742, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///F/0/N3", "atom2_id": "///Q/57/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 288, "atom1_serNum": 3286, "atom2_serNum": 3311, "donAcc_type": "questionable", "distance": 2.920, "atom1_id": "///F/0/OP2", "atom2_id": "///F/2/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 289, "atom1_serNum": 3288, "atom2_serNum": 4209, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///F/1/OP1", "atom2_id": "///Q/32/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 290, "atom1_serNum": 3288, "atom2_serNum": 4232, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///F/1/OP1", "atom2_id": "///Q/33/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 291, "atom1_serNum": 3288, "atom2_serNum": 4234, "donAcc_type": "standard", "distance": 3.374, "atom1_id": "///F/1/OP1", "atom2_id": "///Q/33/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 292, "atom1_serNum": 3289, "atom2_serNum": 4742, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///F/1/OP2", "atom2_id": "///Q/57/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 293, "atom1_serNum": 3289, "atom2_serNum": 16027, "donAcc_type": "acceptable", "distance": 2.508, "atom1_id": "///F/1/OP2", "atom2_id": "///F/5002/O1", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 294, "atom1_serNum": 3290, "atom2_serNum": 16028, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///F/1/O5'", "atom2_id": "///F/5002/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 295, "atom1_serNum": 3297, "atom2_serNum": 4160, "donAcc_type": "acceptable", "distance": 2.760, "atom1_id": "///F/1/O2'", "atom2_id": "///Q/30/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 296, "atom1_serNum": 3301, "atom2_serNum": 4468, "donAcc_type": "standard", "distance": 3.713, "atom1_id": "///F/1/N7", "atom2_id": "///Q/44/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 297, "atom1_serNum": 3304, "atom2_serNum": 7860, "donAcc_type": "questionable", "distance": 2.674, "atom1_id": "///F/1/O6", "atom2_id": "///R/49/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 298, "atom1_serNum": 3305, "atom2_serNum": 16032, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///F/1/N1", "atom2_id": "///F/5002/O6", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 299, "atom1_serNum": 3305, "atom2_serNum": 16034, "donAcc_type": "acceptable", "distance": 3.051, "atom1_id": "///F/1/N1", "atom2_id": "///F/5002/OP1", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 300, "atom1_serNum": 3307, "atom2_serNum": 16034, "donAcc_type": "acceptable", "distance": 3.336, "atom1_id": "///F/1/N2", "atom2_id": "///F/5002/OP1", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 301, "atom1_serNum": 3307, "atom2_serNum": 16035, "donAcc_type": "acceptable", "distance": 3.196, "atom1_id": "///F/1/N2", "atom2_id": "///F/5002/OP2", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 302, "atom1_serNum": 3312, "atom2_serNum": 4148, "donAcc_type": "questionable", "distance": 2.997, "atom1_id": "///F/2/OP2", "atom2_id": "///Q/30/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 303, "atom1_serNum": 3324, "atom2_serNum": 4719, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///F/2/O2", "atom2_id": "///Q/56/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 304, "atom1_serNum": 3325, "atom2_serNum": 4717, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///F/2/N3", "atom2_id": "///Q/56/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 305, "atom1_serNum": 3327, "atom2_serNum": 4716, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///F/2/N4", "atom2_id": "///Q/56/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 306, "atom1_serNum": 3347, "atom2_serNum": 4696, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///F/3/O6", "atom2_id": "///Q/55/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 307, "atom1_serNum": 3348, "atom2_serNum": 4694, "donAcc_type": "standard", "distance": 2.757, "atom1_id": "///F/3/N1", "atom2_id": "///Q/55/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 308, "atom1_serNum": 3350, "atom2_serNum": 4693, "donAcc_type": "standard", "distance": 2.636, "atom1_id": "///F/3/N2", "atom2_id": "///Q/55/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 309, "atom1_serNum": 3367, "atom2_serNum": 4676, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///F/4/O2", "atom2_id": "///Q/54/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 310, "atom1_serNum": 3368, "atom2_serNum": 4674, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///F/4/N3", "atom2_id": "///Q/54/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 311, "atom1_serNum": 3370, "atom2_serNum": 4673, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///F/4/N4", "atom2_id": "///Q/54/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 312, "atom1_serNum": 3383, "atom2_serNum": 3395, "donAcc_type": "acceptable", "distance": 2.810, "atom1_id": "///F/5/O2'", "atom2_id": "///F/6/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 313, "atom1_serNum": 3383, "atom2_serNum": 4099, "donAcc_type": "acceptable", "distance": 3.174, "atom1_id": "///F/5/O2'", "atom2_id": "///Q/27/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 314, "atom1_serNum": 3387, "atom2_serNum": 4653, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///F/5/O2", "atom2_id": "///Q/53/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 315, "atom1_serNum": 3388, "atom2_serNum": 4651, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///F/5/N3", "atom2_id": "///Q/53/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 316, "atom1_serNum": 3390, "atom2_serNum": 4650, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///F/5/N4", "atom2_id": "///Q/53/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 317, "atom1_serNum": 3403, "atom2_serNum": 3418, "donAcc_type": "acceptable", "distance": 3.067, "atom1_id": "///F/6/O2'", "atom2_id": "///F/7/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 318, "atom1_serNum": 3403, "atom2_serNum": 3421, "donAcc_type": "acceptable", "distance": 3.155, "atom1_id": "///F/6/O2'", "atom2_id": "///F/7/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 319, "atom1_serNum": 3432, "atom2_serNum": 4101, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///F/7/O6", "atom2_id": "///Q/27/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 320, "atom1_serNum": 3432, "atom2_serNum": 4630, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///F/7/O6", "atom2_id": "///Q/52/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 321, "atom1_serNum": 3433, "atom2_serNum": 4628, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///F/7/N1", "atom2_id": "///Q/52/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 322, "atom1_serNum": 3435, "atom2_serNum": 4627, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///F/7/N2", "atom2_id": "///Q/52/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 323, "atom1_serNum": 3448, "atom2_serNum": 4590, "donAcc_type": "acceptable", "distance": 2.681, "atom1_id": "///F/8/O2'", "atom2_id": "///Q/50/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 324, "atom1_serNum": 3455, "atom2_serNum": 4078, "donAcc_type": "standard", "distance": 3.323, "atom1_id": "///F/8/N6", "atom2_id": "///Q/26/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 325, "atom1_serNum": 3456, "atom2_serNum": 4076, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///F/8/N1", "atom2_id": "///Q/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 326, "atom1_serNum": 3458, "atom2_serNum": 4588, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///F/8/N3", "atom2_id": "///Q/50/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 327, "atom1_serNum": 3468, "atom2_serNum": 7685, "donAcc_type": "questionable", "distance": 3.331, "atom1_id": "///F/9/O3'", "atom2_id": "///R/41/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 328, "atom1_serNum": 3477, "atom2_serNum": 4035, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///F/9/N6", "atom2_id": "///Q/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 329, "atom1_serNum": 3477, "atom2_serNum": 4058, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///F/9/N6", "atom2_id": "///Q/25/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 330, "atom1_serNum": 3478, "atom2_serNum": 4056, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///F/9/N1", "atom2_id": "///Q/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 331, "atom1_serNum": 3484, "atom2_serNum": 7686, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///F/10/OP2", "atom2_id": "///R/41/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 332, "atom1_serNum": 3492, "atom2_serNum": 5884, "donAcc_type": "acceptable", "distance": 2.859, "atom1_id": "///F/10/O2'", "atom2_id": "///Q/112/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 333, "atom1_serNum": 3496, "atom2_serNum": 4038, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///F/10/O2", "atom2_id": "///Q/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 334, "atom1_serNum": 3497, "atom2_serNum": 4036, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///F/10/N3", "atom2_id": "///Q/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 335, "atom1_serNum": 3499, "atom2_serNum": 4035, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///F/10/N4", "atom2_id": "///Q/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 336, "atom1_serNum": 3508, "atom2_serNum": 5880, "donAcc_type": "questionable", "distance": 3.049, "atom1_id": "///F/11/O4'", "atom2_id": "///Q/112/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 337, "atom1_serNum": 3510, "atom2_serNum": 3524, "donAcc_type": "acceptable", "distance": 2.742, "atom1_id": "///F/11/O3'", "atom2_id": "///Q/12/O1G", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 338, "atom1_serNum": 3510, "atom2_serNum": 3533, "donAcc_type": "acceptable", "distance": 2.884, "atom1_id": "///F/11/O3'", "atom2_id": "///Q/12/O1A", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 339, "atom1_serNum": 3510, "atom2_serNum": 5861, "donAcc_type": "acceptable", "distance": 2.751, "atom1_id": "///F/11/O3'", "atom2_id": "///Q/111/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 340, "atom1_serNum": 3512, "atom2_serNum": 5861, "donAcc_type": "acceptable", "distance": 3.011, "atom1_id": "///F/11/O2'", "atom2_id": "///Q/111/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 341, "atom1_serNum": 3512, "atom2_serNum": 5872, "donAcc_type": "acceptable", "distance": 2.625, "atom1_id": "///F/11/O2'", "atom2_id": "///Q/111/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 342, "atom1_serNum": 3516, "atom2_serNum": 5871, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///F/11/O2", "atom2_id": "///Q/111/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 343, "atom1_serNum": 3517, "atom2_serNum": 4014, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///F/11/N3", "atom2_id": "///Q/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 344, "atom1_serNum": 3519, "atom2_serNum": 4013, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///F/11/O4", "atom2_id": "///Q/23/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 345, "atom1_serNum": 3524, "atom2_serNum": 3533, "donAcc_type": "acceptable", "distance": 2.652, "atom1_id": "///Q/12/O1G", "atom2_id": "///Q/12/O1A", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 346, "atom1_serNum": 3526, "atom2_serNum": 3529, "donAcc_type": "acceptable", "distance": 2.806, "atom1_id": "///Q/12/O3G", "atom2_id": "///Q/12/O1B", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 347, "atom1_serNum": 3526, "atom2_serNum": 3533, "donAcc_type": "acceptable", "distance": 2.644, "atom1_id": "///Q/12/O3G", "atom2_id": "///Q/12/O1A", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 348, "atom1_serNum": 3526, "atom2_serNum": 3837, "donAcc_type": "acceptable", "distance": 3.449, "atom1_id": "///Q/12/O3G", "atom2_id": "///Q/17/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 349, "atom1_serNum": 3542, "atom2_serNum": 5846, "donAcc_type": "acceptable", "distance": 3.001, "atom1_id": "///Q/12/O2'", "atom2_id": "///Q/110/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 350, "atom1_serNum": 3542, "atom2_serNum": 5848, "donAcc_type": "acceptable", "distance": 3.348, "atom1_id": "///Q/12/O2'", "atom2_id": "///Q/110/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 351, "atom1_serNum": 3549, "atom2_serNum": 3993, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///Q/12/O6", "atom2_id": "///Q/22/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 352, "atom1_serNum": 3550, "atom2_serNum": 3991, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///Q/12/N1", "atom2_id": "///Q/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 353, "atom1_serNum": 3552, "atom2_serNum": 3990, "donAcc_type": "standard", "distance": 3.093, "atom1_id": "///Q/12/N2", "atom2_id": "///Q/22/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 354, "atom1_serNum": 3557, "atom2_serNum": 14157, "donAcc_type": "standard", "distance": 3.514, "atom1_id": "///Q/13/OP2", "atom2_id": "///B/47/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 355, "atom1_serNum": 3572, "atom2_serNum": 3973, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///Q/13/O6", "atom2_id": "///Q/21/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 356, "atom1_serNum": 3573, "atom2_serNum": 3971, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///Q/13/N1", "atom2_id": "///Q/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 357, "atom1_serNum": 3575, "atom2_serNum": 3970, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///Q/13/N2", "atom2_id": "///Q/21/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 358, "atom1_serNum": 3592, "atom2_serNum": 3953, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///Q/14/O2", "atom2_id": "///Q/20/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 359, "atom1_serNum": 3593, "atom2_serNum": 3951, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///Q/14/N3", "atom2_id": "///Q/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 360, "atom1_serNum": 3595, "atom2_serNum": 3950, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///Q/14/N4", "atom2_id": "///Q/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 361, "atom1_serNum": 3615, "atom2_serNum": 3930, "donAcc_type": "standard", "distance": 3.149, "atom1_id": "///Q/15/N6", "atom2_id": "///Q/19/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 362, "atom1_serNum": 3616, "atom2_serNum": 3928, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///Q/15/N1", "atom2_id": "///Q/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 363, "atom1_serNum": 3634, "atom2_serNum": 3910, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///Q/16/O2", "atom2_id": "///Q/18/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 364, "atom1_serNum": 3635, "atom2_serNum": 3908, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///Q/16/N3", "atom2_id": "///Q/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 365, "atom1_serNum": 3637, "atom2_serNum": 3907, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///Q/16/N4", "atom2_id": "///Q/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 366, "atom1_serNum": 3654, "atom2_serNum": 3887, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///Q/17/O2", "atom2_id": "///Q/17/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 367, "atom1_serNum": 3655, "atom2_serNum": 3885, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///Q/17/N3", "atom2_id": "///Q/17/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 368, "atom1_serNum": 3657, "atom2_serNum": 3884, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///Q/17/N4", "atom2_id": "///Q/17/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 369, "atom1_serNum": 3678, "atom2_serNum": 14199, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///Q/17/N1", "atom2_id": "///B/52/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 370, "atom1_serNum": 3696, "atom2_serNum": 3742, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///Q/17/O2", "atom2_id": "///Q/17/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 371, "atom1_serNum": 3697, "atom2_serNum": 13926, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///Q/17/N3", "atom2_id": "///B/19/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 372, "atom1_serNum": 3716, "atom2_serNum": 14447, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///Q/17/O2", "atom2_id": "///B/83/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 373, "atom1_serNum": 3717, "atom2_serNum": 13901, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///Q/17/N3", "atom2_id": "///B/16/OD1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 374, "atom1_serNum": 3719, "atom2_serNum": 14421, "donAcc_type": "standard", "distance": 2.574, "atom1_id": "///Q/17/O4", "atom2_id": "///B/80/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 375, "atom1_serNum": 3732, "atom2_serNum": 14176, "donAcc_type": "acceptable", "distance": 2.527, "atom1_id": "///Q/17/O2'", "atom2_id": "///B/50/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 376, "atom1_serNum": 3736, "atom2_serNum": 13894, "donAcc_type": "standard", "distance": 3.074, "atom1_id": "///Q/17/N7", "atom2_id": "///B/15/ND2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 377, "atom1_serNum": 3739, "atom2_serNum": 13895, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///Q/17/O6", "atom2_id": "///B/16/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 378, "atom1_serNum": 3742, "atom2_serNum": 13927, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///Q/17/N2", "atom2_id": "///B/19/OE2", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 379, "atom1_serNum": 3760, "atom2_serNum": 14482, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///Q/17/N3", "atom2_id": "///B/88/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 380, "atom1_serNum": 3762, "atom2_serNum": 14468, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///Q/17/N4", "atom2_id": "///B/86/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 381, "atom1_serNum": 3782, "atom2_serNum": 14494, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///Q/17/N6", "atom2_id": "///B/89/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 382, "atom1_serNum": 3783, "atom2_serNum": 14511, "donAcc_type": "acceptable", "distance": 2.763, "atom1_id": "///Q/17/N1", "atom2_id": "///B/91/OG", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 383, "atom1_serNum": 3801, "atom2_serNum": 14512, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///Q/17/O2", "atom2_id": "///B/92/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 384, "atom1_serNum": 3802, "atom2_serNum": 14512, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///Q/17/N3", "atom2_id": "///B/92/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 385, "atom1_serNum": 3804, "atom2_serNum": 14496, "donAcc_type": "acceptable", "distance": 3.512, "atom1_id": "///Q/17/N4", "atom2_id": "///B/89/OG1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 386, "atom1_serNum": 3804, "atom2_serNum": 14501, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///Q/17/N4", "atom2_id": "///B/90/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 387, "atom1_serNum": 3817, "atom2_serNum": 3830, "donAcc_type": "acceptable", "distance": 2.470, "atom1_id": "///Q/17/O2'", "atom2_id": "///Q/17/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 388, "atom1_serNum": 3817, "atom2_serNum": 3833, "donAcc_type": "acceptable", "distance": 2.846, "atom1_id": "///Q/17/O2'", "atom2_id": "///Q/17/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 389, "atom1_serNum": 3848, "atom2_serNum": 14147, "donAcc_type": "acceptable", "distance": 2.978, "atom1_id": "///Q/17/OP1", "atom2_id": "///B/46/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 390, "atom1_serNum": 3868, "atom2_serNum": 14165, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///Q/17/OP1", "atom2_id": "///B/49/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 391, "atom1_serNum": 3881, "atom2_serNum": 14200, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///Q/17/N7", "atom2_id": "///B/52/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 392, "atom1_serNum": 3884, "atom2_serNum": 14199, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///Q/17/O6", "atom2_id": "///B/52/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 393, "atom1_serNum": 3914, "atom2_serNum": 7652, "donAcc_type": "questionable", "distance": 3.105, "atom1_id": "///Q/19/OP1", "atom2_id": "///R/40/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 394, "atom1_serNum": 4028, "atom2_serNum": 5892, "donAcc_type": "acceptable", "distance": 2.753, "atom1_id": "///Q/24/O2'", "atom2_id": "///Q/112/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 395, "atom1_serNum": 4038, "atom2_serNum": 5894, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///Q/24/N2", "atom2_id": "///Q/112/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 396, "atom1_serNum": 4049, "atom2_serNum": 5906, "donAcc_type": "acceptable", "distance": 3.122, "atom1_id": "///Q/25/O3'", "atom2_id": "///Q/113/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 397, "atom1_serNum": 4051, "atom2_serNum": 5906, "donAcc_type": "acceptable", "distance": 2.518, "atom1_id": "///Q/25/O2'", "atom2_id": "///Q/113/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 398, "atom1_serNum": 4091, "atom2_serNum": 4630, "donAcc_type": "acceptable", "distance": 2.957, "atom1_id": "///Q/27/O2'", "atom2_id": "///Q/52/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 399, "atom1_serNum": 4102, "atom2_serNum": 4630, "donAcc_type": "standard", "distance": 3.923, "atom1_id": "///Q/27/N3", "atom2_id": "///Q/52/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 400, "atom1_serNum": 4121, "atom2_serNum": 4614, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///Q/28/N6", "atom2_id": "///Q/52/OP1", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 401, "atom1_serNum": 4121, "atom2_serNum": 7860, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///Q/28/N6", "atom2_id": "///R/49/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 402, "atom1_serNum": 4124, "atom2_serNum": 4143, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///Q/28/N3", "atom2_id": "///Q/29/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 403, "atom1_serNum": 4132, "atom2_serNum": 5627, "donAcc_type": "acceptable", "distance": 3.325, "atom1_id": "///Q/29/O4'", "atom2_id": "///Q/100/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 404, "atom1_serNum": 4134, "atom2_serNum": 5605, "donAcc_type": "acceptable", "distance": 3.064, "atom1_id": "///Q/29/O3'", "atom2_id": "///Q/99/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 405, "atom1_serNum": 4136, "atom2_serNum": 5605, "donAcc_type": "acceptable", "distance": 2.695, "atom1_id": "///Q/29/O2'", "atom2_id": "///Q/99/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 406, "atom1_serNum": 4136, "atom2_serNum": 5615, "donAcc_type": "acceptable", "distance": 2.619, "atom1_id": "///Q/29/O2'", "atom2_id": "///Q/99/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 407, "atom1_serNum": 4136, "atom2_serNum": 5623, "donAcc_type": "acceptable", "distance": 3.382, "atom1_id": "///Q/29/O2'", "atom2_id": "///Q/100/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 408, "atom1_serNum": 4140, "atom2_serNum": 4491, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///Q/29/O2", "atom2_id": "///Q/45/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 409, "atom1_serNum": 4141, "atom2_serNum": 4489, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///Q/29/N3", "atom2_id": "///Q/45/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 410, "atom1_serNum": 4143, "atom2_serNum": 4488, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///Q/29/N4", "atom2_id": "///Q/45/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 411, "atom1_serNum": 4149, "atom2_serNum": 5605, "donAcc_type": "acceptable", "distance": 3.402, "atom1_id": "///Q/30/O5'", "atom2_id": "///Q/99/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 412, "atom1_serNum": 4156, "atom2_serNum": 5583, "donAcc_type": "acceptable", "distance": 2.879, "atom1_id": "///Q/30/O2'", "atom2_id": "///Q/98/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 413, "atom1_serNum": 4156, "atom2_serNum": 5593, "donAcc_type": "acceptable", "distance": 2.690, "atom1_id": "///Q/30/O2'", "atom2_id": "///Q/98/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 414, "atom1_serNum": 4156, "atom2_serNum": 5601, "donAcc_type": "acceptable", "distance": 3.596, "atom1_id": "///Q/30/O2'", "atom2_id": "///Q/99/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 415, "atom1_serNum": 4163, "atom2_serNum": 4468, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///Q/30/O6", "atom2_id": "///Q/44/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 416, "atom1_serNum": 4164, "atom2_serNum": 4466, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///Q/30/N1", "atom2_id": "///Q/44/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 417, "atom1_serNum": 4166, "atom2_serNum": 4465, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///Q/30/N2", "atom2_id": "///Q/44/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 418, "atom1_serNum": 4166, "atom2_serNum": 6127, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///Q/30/N2", "atom2_id": "///Q/123/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 419, "atom1_serNum": 4175, "atom2_serNum": 6126, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///Q/31/O4'", "atom2_id": "///Q/123/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 420, "atom1_serNum": 4179, "atom2_serNum": 6148, "donAcc_type": "acceptable", "distance": 3.275, "atom1_id": "///Q/31/O2'", "atom2_id": "///Q/124/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 421, "atom1_serNum": 4179, "atom2_serNum": 6149, "donAcc_type": "acceptable", "distance": 3.080, "atom1_id": "///Q/31/O2'", "atom2_id": "///Q/124/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 422, "atom1_serNum": 4179, "atom2_serNum": 6171, "donAcc_type": "acceptable", "distance": 2.822, "atom1_id": "///Q/31/O2'", "atom2_id": "///Q/125/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 423, "atom1_serNum": 4186, "atom2_serNum": 4448, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///Q/31/N6", "atom2_id": "///Q/43/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 424, "atom1_serNum": 4187, "atom2_serNum": 4446, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///Q/31/N1", "atom2_id": "///Q/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 425, "atom1_serNum": 4224, "atom2_serNum": 4777, "donAcc_type": "acceptable", "distance": 2.631, "atom1_id": "///Q/33/O2'", "atom2_id": "///Q/59/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 426, "atom1_serNum": 4235, "atom2_serNum": 4777, "donAcc_type": "acceptable", "distance": 2.668, "atom1_id": "///Q/33/N3", "atom2_id": "///Q/59/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 427, "atom1_serNum": 4259, "atom2_serNum": 5299, "donAcc_type": "acceptable", "distance": 2.823, "atom1_id": "///Q/35/OP2", "atom2_id": "///Q/84/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 428, "atom1_serNum": 4263, "atom2_serNum": 5299, "donAcc_type": "acceptable", "distance": 2.885, "atom1_id": "///Q/35/O4'", "atom2_id": "///Q/84/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 429, "atom1_serNum": 4274, "atom2_serNum": 4909, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///Q/35/O6", "atom2_id": "///Q/65/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 430, "atom1_serNum": 4275, "atom2_serNum": 4907, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///Q/35/N1", "atom2_id": "///Q/65/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 431, "atom1_serNum": 4277, "atom2_serNum": 4906, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///Q/35/N2", "atom2_id": "///Q/65/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 432, "atom1_serNum": 4297, "atom2_serNum": 4889, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///Q/36/O6", "atom2_id": "///Q/64/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 433, "atom1_serNum": 4298, "atom2_serNum": 4887, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///Q/36/N1", "atom2_id": "///Q/64/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 434, "atom1_serNum": 4300, "atom2_serNum": 4886, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///Q/36/N2", "atom2_id": "///Q/64/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 435, "atom1_serNum": 4320, "atom2_serNum": 4867, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///Q/37/O6", "atom2_id": "///Q/63/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 436, "atom1_serNum": 4321, "atom2_serNum": 4866, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///Q/37/N1", "atom2_id": "///Q/63/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 437, "atom1_serNum": 4343, "atom2_serNum": 4849, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///Q/38/O6", "atom2_id": "///Q/62/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 438, "atom1_serNum": 4344, "atom2_serNum": 4847, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///Q/38/N1", "atom2_id": "///Q/62/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 439, "atom1_serNum": 4346, "atom2_serNum": 4846, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///Q/38/N2", "atom2_id": "///Q/62/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 440, "atom1_serNum": 4364, "atom2_serNum": 4828, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///Q/39/N3", "atom2_id": "///Q/61/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 441, "atom1_serNum": 4366, "atom2_serNum": 4827, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///Q/39/O4", "atom2_id": "///Q/61/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 442, "atom1_serNum": 4383, "atom2_serNum": 4805, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///Q/40/O2", "atom2_id": "///Q/60/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 443, "atom1_serNum": 4384, "atom2_serNum": 4804, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///Q/40/N3", "atom2_id": "///Q/60/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 444, "atom1_serNum": 4404, "atom2_serNum": 6766, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///Q/41/N3", "atom2_id": "///G/10/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 445, "atom1_serNum": 4419, "atom2_serNum": 16030, "donAcc_type": "acceptable", "distance": 2.950, "atom1_id": "///Q/42/O2'", "atom2_id": "///F/5002/O4", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 446, "atom1_serNum": 4426, "atom2_serNum": 4769, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///Q/42/N6", "atom2_id": "///Q/59/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 447, "atom1_serNum": 4433, "atom2_serNum": 16029, "donAcc_type": "acceptable", "distance": 2.782, "atom1_id": "///Q/43/OP2", "atom2_id": "///F/5002/O3", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 448, "atom1_serNum": 4448, "atom2_serNum": 16028, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///Q/43/O4", "atom2_id": "///F/5002/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 449, "atom1_serNum": 4459, "atom2_serNum": 6141, "donAcc_type": "acceptable", "distance": 2.816, "atom1_id": "///Q/44/O3'", "atom2_id": "///Q/124/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 450, "atom1_serNum": 4461, "atom2_serNum": 6141, "donAcc_type": "acceptable", "distance": 2.725, "atom1_id": "///Q/44/O2'", "atom2_id": "///Q/124/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 451, "atom1_serNum": 4461, "atom2_serNum": 6151, "donAcc_type": "acceptable", "distance": 2.781, "atom1_id": "///Q/44/O2'", "atom2_id": "///Q/124/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 452, "atom1_serNum": 4461, "atom2_serNum": 6159, "donAcc_type": "acceptable", "distance": 2.829, "atom1_id": "///Q/44/O2'", "atom2_id": "///Q/125/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 453, "atom1_serNum": 4477, "atom2_serNum": 6141, "donAcc_type": "acceptable", "distance": 3.607, "atom1_id": "///Q/45/O4'", "atom2_id": "///Q/124/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 454, "atom1_serNum": 4481, "atom2_serNum": 6119, "donAcc_type": "acceptable", "distance": 2.843, "atom1_id": "///Q/45/O2'", "atom2_id": "///Q/123/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 455, "atom1_serNum": 4481, "atom2_serNum": 6129, "donAcc_type": "acceptable", "distance": 2.667, "atom1_id": "///Q/45/O2'", "atom2_id": "///Q/123/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 456, "atom1_serNum": 4481, "atom2_serNum": 6137, "donAcc_type": "acceptable", "distance": 3.319, "atom1_id": "///Q/45/O2'", "atom2_id": "///Q/124/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 457, "atom1_serNum": 4491, "atom2_serNum": 5591, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///Q/45/N2", "atom2_id": "///Q/98/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 458, "atom1_serNum": 4500, "atom2_serNum": 5590, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///Q/46/O4'", "atom2_id": "///Q/98/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 459, "atom1_serNum": 4504, "atom2_serNum": 5612, "donAcc_type": "acceptable", "distance": 3.037, "atom1_id": "///Q/46/O2'", "atom2_id": "///Q/99/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 460, "atom1_serNum": 4504, "atom2_serNum": 5613, "donAcc_type": "acceptable", "distance": 3.215, "atom1_id": "///Q/46/O2'", "atom2_id": "///Q/99/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 461, "atom1_serNum": 4504, "atom2_serNum": 5635, "donAcc_type": "acceptable", "distance": 2.632, "atom1_id": "///Q/46/O2'", "atom2_id": "///Q/100/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 462, "atom1_serNum": 4511, "atom2_serNum": 4607, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///Q/46/N6", "atom2_id": "///Q/51/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 463, "atom1_serNum": 4512, "atom2_serNum": 4608, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///Q/46/N1", "atom2_id": "///Q/51/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 464, "atom1_serNum": 4522, "atom2_serNum": 5635, "donAcc_type": "questionable", "distance": 3.236, "atom1_id": "///Q/47/O4'", "atom2_id": "///Q/100/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 465, "atom1_serNum": 4526, "atom2_serNum": 5649, "donAcc_type": "acceptable", "distance": 2.468, "atom1_id": "///Q/47/O2'", "atom2_id": "///Q/101/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 466, "atom1_serNum": 4536, "atom2_serNum": 4603, "donAcc_type": "acceptable", "distance": 2.711, "atom1_id": "///Q/47/N2", "atom2_id": "///Q/51/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 467, "atom1_serNum": 4549, "atom2_serNum": 7838, "donAcc_type": "acceptable", "distance": 2.637, "atom1_id": "///Q/48/O2'", "atom2_id": "///R/48/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 468, "atom1_serNum": 4556, "atom2_serNum": 7845, "donAcc_type": "standard", "distance": 3.379, "atom1_id": "///Q/48/N6", "atom2_id": "///R/49/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 469, "atom1_serNum": 4579, "atom2_serNum": 4619, "donAcc_type": "questionable", "distance": 3.192, "atom1_id": "///Q/50/O4'", "atom2_id": "///Q/52/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 470, "atom1_serNum": 4614, "atom2_serNum": 7858, "donAcc_type": "standard", "distance": 2.924, "atom1_id": "///Q/52/OP1", "atom2_id": "///R/49/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 471, "atom1_serNum": 4623, "atom2_serNum": 7913, "donAcc_type": "acceptable", "distance": 3.427, "atom1_id": "///Q/52/O2'", "atom2_id": "///R/52/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 472, "atom1_serNum": 4740, "atom2_serNum": 16027, "donAcc_type": "acceptable", "distance": 3.152, "atom1_id": "///Q/57/N1", "atom2_id": "///F/5002/O1", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 473, "atom1_serNum": 4777, "atom2_serNum": 4781, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///Q/59/O2'", "atom2_id": "///Q/59/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 474, "atom1_serNum": 4873, "atom2_serNum": 14914, "donAcc_type": "standard", "distance": 3.616, "atom1_id": "///Q/64/OP1", "atom2_id": "///C/50/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 475, "atom1_serNum": 4926, "atom2_serNum": 5309, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///Q/66/O2", "atom2_id": "///Q/84/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 476, "atom1_serNum": 4927, "atom2_serNum": 5307, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///Q/66/N3", "atom2_id": "///Q/84/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 477, "atom1_serNum": 4929, "atom2_serNum": 5306, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///Q/66/N4", "atom2_id": "///Q/84/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 478, "atom1_serNum": 4949, "atom2_serNum": 5286, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///Q/67/O6", "atom2_id": "///Q/83/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 479, "atom1_serNum": 4950, "atom2_serNum": 5284, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///Q/67/N1", "atom2_id": "///Q/83/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 480, "atom1_serNum": 4952, "atom2_serNum": 5283, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///Q/67/N2", "atom2_id": "///Q/83/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 481, "atom1_serNum": 4952, "atom2_serNum": 5342, "donAcc_type": "standard", "distance": 3.715, "atom1_id": "///Q/67/N2", "atom2_id": "///Q/86/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 482, "atom1_serNum": 4965, "atom2_serNum": 5364, "donAcc_type": "acceptable", "distance": 2.729, "atom1_id": "///Q/68/O2'", "atom2_id": "///Q/87/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 483, "atom1_serNum": 4972, "atom2_serNum": 5266, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///Q/68/O6", "atom2_id": "///Q/82/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 484, "atom1_serNum": 4973, "atom2_serNum": 5264, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///Q/68/N1", "atom2_id": "///Q/82/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 485, "atom1_serNum": 4975, "atom2_serNum": 5263, "donAcc_type": "standard", "distance": 2.648, "atom1_id": "///Q/68/N2", "atom2_id": "///Q/82/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 486, "atom1_serNum": 4975, "atom2_serNum": 5366, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///Q/68/N2", "atom2_id": "///Q/87/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 487, "atom1_serNum": 4992, "atom2_serNum": 5356, "donAcc_type": "acceptable", "distance": 2.960, "atom1_id": "///Q/69/O2", "atom2_id": "///Q/87/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 488, "atom1_serNum": 4993, "atom2_serNum": 5245, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///Q/69/N3", "atom2_id": "///Q/81/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 489, "atom1_serNum": 4995, "atom2_serNum": 5244, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///Q/69/O4", "atom2_id": "///Q/81/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 490, "atom1_serNum": 5008, "atom2_serNum": 6391, "donAcc_type": "acceptable", "distance": 3.187, "atom1_id": "///Q/70/O2'", "atom2_id": "///Q/135/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 491, "atom1_serNum": 5008, "atom2_serNum": 6393, "donAcc_type": "acceptable", "distance": 3.337, "atom1_id": "///Q/70/O2'", "atom2_id": "///Q/135/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 492, "atom1_serNum": 5013, "atom2_serNum": 5223, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///Q/70/N3", "atom2_id": "///Q/80/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 493, "atom1_serNum": 5015, "atom2_serNum": 5222, "donAcc_type": "standard", "distance": 3.254, "atom1_id": "///Q/70/O4", "atom2_id": "///Q/80/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 494, "atom1_serNum": 5035, "atom2_serNum": 5202, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///Q/71/O6", "atom2_id": "///Q/79/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 495, "atom1_serNum": 5036, "atom2_serNum": 5200, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///Q/71/N1", "atom2_id": "///Q/79/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 496, "atom1_serNum": 5038, "atom2_serNum": 5199, "donAcc_type": "standard", "distance": 2.671, "atom1_id": "///Q/71/N2", "atom2_id": "///Q/79/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 497, "atom1_serNum": 5058, "atom2_serNum": 6390, "donAcc_type": "questionable", "distance": 2.954, "atom1_id": "///Q/72/O4", "atom2_id": "///Q/135/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 498, "atom1_serNum": 5076, "atom2_serNum": 6522, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///Q/73/N3", "atom2_id": "///Q/141/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 499, "atom1_serNum": 5078, "atom2_serNum": 6521, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///Q/73/O4", "atom2_id": "///Q/141/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 500, "atom1_serNum": 5095, "atom2_serNum": 6501, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///Q/74/O2", "atom2_id": "///Q/140/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 501, "atom1_serNum": 5096, "atom2_serNum": 6499, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///Q/74/N3", "atom2_id": "///Q/140/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 502, "atom1_serNum": 5096, "atom2_serNum": 6501, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///Q/74/N3", "atom2_id": "///Q/140/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 503, "atom1_serNum": 5118, "atom2_serNum": 6478, "donAcc_type": "standard", "distance": 3.606, "atom1_id": "///Q/75/N6", "atom2_id": "///Q/139/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 504, "atom1_serNum": 5119, "atom2_serNum": 6476, "donAcc_type": "standard", "distance": 3.538, "atom1_id": "///Q/75/N1", "atom2_id": "///Q/139/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 505, "atom1_serNum": 5138, "atom2_serNum": 6457, "donAcc_type": "standard", "distance": 3.187, "atom1_id": "///Q/76/N3", "atom2_id": "///Q/138/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 506, "atom1_serNum": 5140, "atom2_serNum": 6456, "donAcc_type": "standard", "distance": 3.612, "atom1_id": "///Q/76/O4", "atom2_id": "///Q/138/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 507, "atom1_serNum": 5157, "atom2_serNum": 6436, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///Q/77/O2", "atom2_id": "///Q/137/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 508, "atom1_serNum": 5158, "atom2_serNum": 6434, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///Q/77/N3", "atom2_id": "///Q/137/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 509, "atom1_serNum": 5160, "atom2_serNum": 6433, "donAcc_type": "standard", "distance": 3.491, "atom1_id": "///Q/77/N4", "atom2_id": "///Q/137/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 510, "atom1_serNum": 5180, "atom2_serNum": 6413, "donAcc_type": "standard", "distance": 2.588, "atom1_id": "///Q/78/N6", "atom2_id": "///Q/136/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 511, "atom1_serNum": 5181, "atom2_serNum": 6411, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///Q/78/N1", "atom2_id": "///Q/136/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 512, "atom1_serNum": 5215, "atom2_serNum": 5233, "donAcc_type": "acceptable", "distance": 3.079, "atom1_id": "///Q/80/O2'", "atom2_id": "///Q/81/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 513, "atom1_serNum": 5237, "atom2_serNum": 5376, "donAcc_type": "acceptable", "distance": 2.895, "atom1_id": "///Q/81/O2'", "atom2_id": "///Q/88/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 514, "atom1_serNum": 5237, "atom2_serNum": 5378, "donAcc_type": "acceptable", "distance": 2.681, "atom1_id": "///Q/81/O2'", "atom2_id": "///Q/88/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 515, "atom1_serNum": 5259, "atom2_serNum": 5356, "donAcc_type": "acceptable", "distance": 2.651, "atom1_id": "///Q/82/O2'", "atom2_id": "///Q/87/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 516, "atom1_serNum": 5263, "atom2_serNum": 5356, "donAcc_type": "acceptable", "distance": 3.024, "atom1_id": "///Q/82/O2", "atom2_id": "///Q/87/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 517, "atom1_serNum": 5275, "atom2_serNum": 5352, "donAcc_type": "questionable", "distance": 3.169, "atom1_id": "///Q/83/O4'", "atom2_id": "///Q/87/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 518, "atom1_serNum": 5279, "atom2_serNum": 5344, "donAcc_type": "acceptable", "distance": 2.468, "atom1_id": "///Q/83/O2'", "atom2_id": "///Q/86/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 519, "atom1_serNum": 5334, "atom2_serNum": 5347, "donAcc_type": "acceptable", "distance": 2.497, "atom1_id": "///Q/86/O2'", "atom2_id": "///Q/87/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 520, "atom1_serNum": 5385, "atom2_serNum": 6368, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///Q/88/O6", "atom2_id": "///Q/134/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 521, "atom1_serNum": 5386, "atom2_serNum": 6367, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///Q/88/N1", "atom2_id": "///Q/134/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 522, "atom1_serNum": 5401, "atom2_serNum": 5417, "donAcc_type": "acceptable", "distance": 3.266, "atom1_id": "///Q/89/O2'", "atom2_id": "///Q/90/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 523, "atom1_serNum": 5405, "atom2_serNum": 6350, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///Q/89/O2", "atom2_id": "///Q/133/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 524, "atom1_serNum": 5406, "atom2_serNum": 6348, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///Q/89/N3", "atom2_id": "///Q/133/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 525, "atom1_serNum": 5408, "atom2_serNum": 6347, "donAcc_type": "standard", "distance": 3.232, "atom1_id": "///Q/89/N4", "atom2_id": "///Q/133/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 526, "atom1_serNum": 5426, "atom2_serNum": 6326, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///Q/90/N3", "atom2_id": "///Q/132/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 527, "atom1_serNum": 5428, "atom2_serNum": 6325, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///Q/90/O4", "atom2_id": "///Q/132/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 528, "atom1_serNum": 5446, "atom2_serNum": 6304, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///Q/91/N3", "atom2_id": "///Q/131/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 529, "atom1_serNum": 5448, "atom2_serNum": 6303, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///Q/91/O4", "atom2_id": "///Q/131/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 530, "atom1_serNum": 5466, "atom2_serNum": 6282, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///Q/92/N3", "atom2_id": "///Q/130/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 531, "atom1_serNum": 5468, "atom2_serNum": 6281, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///Q/92/O4", "atom2_id": "///Q/130/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 532, "atom1_serNum": 5485, "atom2_serNum": 6259, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///Q/93/O2", "atom2_id": "///Q/129/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 533, "atom1_serNum": 5486, "atom2_serNum": 6258, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///Q/93/N3", "atom2_id": "///Q/129/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 534, "atom1_serNum": 5508, "atom2_serNum": 6238, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///Q/94/N6", "atom2_id": "///Q/128/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 535, "atom1_serNum": 5509, "atom2_serNum": 6236, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///Q/94/N1", "atom2_id": "///Q/128/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 536, "atom1_serNum": 5527, "atom2_serNum": 6218, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///Q/95/O2", "atom2_id": "///Q/127/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 537, "atom1_serNum": 5528, "atom2_serNum": 6216, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///Q/95/N3", "atom2_id": "///Q/127/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 538, "atom1_serNum": 5530, "atom2_serNum": 6215, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///Q/95/N4", "atom2_id": "///Q/127/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 539, "atom1_serNum": 5547, "atom2_serNum": 6193, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///Q/96/O2", "atom2_id": "///Q/126/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 540, "atom1_serNum": 5548, "atom2_serNum": 6192, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///Q/96/N3", "atom2_id": "///Q/126/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 541, "atom1_serNum": 5609, "atom2_serNum": 6106, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///Q/99/N7", "atom2_id": "///Q/122/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 542, "atom1_serNum": 5612, "atom2_serNum": 6104, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///Q/99/N6", "atom2_id": "///Q/122/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 543, "atom1_serNum": 5631, "atom2_serNum": 6084, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///Q/100/N7", "atom2_id": "///Q/121/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 544, "atom1_serNum": 5634, "atom2_serNum": 6085, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///Q/100/N6", "atom2_id": "///Q/121/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 545, "atom1_serNum": 5641, "atom2_serNum": 5676, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///Q/101/OP2", "atom2_id": "///Q/102/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 546, "atom1_serNum": 5656, "atom2_serNum": 6062, "donAcc_type": "standard", "distance": 3.051, "atom1_id": "///Q/101/O4", "atom2_id": "///Q/120/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 547, "atom1_serNum": 5656, "atom2_serNum": 6064, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///Q/101/O4", "atom2_id": "///Q/120/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 548, "atom1_serNum": 5673, "atom2_serNum": 6041, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///Q/102/O2", "atom2_id": "///Q/119/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 549, "atom1_serNum": 5674, "atom2_serNum": 6039, "donAcc_type": "standard", "distance": 2.946, "atom1_id": "///Q/102/N3", "atom2_id": "///Q/119/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 550, "atom1_serNum": 5676, "atom2_serNum": 6038, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///Q/102/N4", "atom2_id": "///Q/119/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 551, "atom1_serNum": 5696, "atom2_serNum": 6018, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///Q/103/N6", "atom2_id": "///Q/118/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 552, "atom1_serNum": 5697, "atom2_serNum": 6016, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///Q/103/N1", "atom2_id": "///Q/118/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 553, "atom1_serNum": 5715, "atom2_serNum": 5996, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///Q/104/O2", "atom2_id": "///Q/117/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 554, "atom1_serNum": 5716, "atom2_serNum": 5995, "donAcc_type": "standard", "distance": 3.286, "atom1_id": "///Q/104/N3", "atom2_id": "///Q/117/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 555, "atom1_serNum": 5736, "atom2_serNum": 5974, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///Q/105/N3", "atom2_id": "///Q/116/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 556, "atom1_serNum": 5738, "atom2_serNum": 5973, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///Q/105/O4", "atom2_id": "///Q/116/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 557, "atom1_serNum": 5751, "atom2_serNum": 5769, "donAcc_type": "acceptable", "distance": 3.041, "atom1_id": "///Q/106/O2'", "atom2_id": "///Q/107/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 558, "atom1_serNum": 5758, "atom2_serNum": 5953, "donAcc_type": "standard", "distance": 3.522, "atom1_id": "///Q/106/N6", "atom2_id": "///Q/115/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 559, "atom1_serNum": 5759, "atom2_serNum": 5951, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///Q/106/N1", "atom2_id": "///Q/115/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 560, "atom1_serNum": 5780, "atom2_serNum": 5933, "donAcc_type": "standard", "distance": 3.208, "atom1_id": "///Q/107/N6", "atom2_id": "///Q/114/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 561, "atom1_serNum": 5781, "atom2_serNum": 5931, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///Q/107/N1", "atom2_id": "///Q/114/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 562, "atom1_serNum": 5802, "atom2_serNum": 5913, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///Q/108/O6", "atom2_id": "///Q/113/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 563, "atom1_serNum": 5803, "atom2_serNum": 5911, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///Q/108/N1", "atom2_id": "///Q/113/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 564, "atom1_serNum": 5805, "atom2_serNum": 5910, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///Q/108/N2", "atom2_id": "///Q/113/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 565, "atom1_serNum": 5818, "atom2_serNum": 5865, "donAcc_type": "acceptable", "distance": 3.055, "atom1_id": "///Q/109/O2'", "atom2_id": "///Q/111/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 566, "atom1_serNum": 5818, "atom2_serNum": 5868, "donAcc_type": "acceptable", "distance": 3.183, "atom1_id": "///Q/109/O2'", "atom2_id": "///Q/111/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 567, "atom1_serNum": 5826, "atom2_serNum": 5876, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///Q/109/N1", "atom2_id": "///Q/112/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 568, "atom1_serNum": 5828, "atom2_serNum": 5876, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///Q/109/N2", "atom2_id": "///Q/112/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 569, "atom1_serNum": 5828, "atom2_serNum": 5888, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///Q/109/N2", "atom2_id": "///Q/112/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 570, "atom1_serNum": 6141, "atom2_serNum": 6159, "donAcc_type": "acceptable", "distance": 2.989, "atom1_id": "///Q/124/O2'", "atom2_id": "///Q/125/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 571, "atom1_serNum": 6231, "atom2_serNum": 6247, "donAcc_type": "acceptable", "distance": 3.297, "atom1_id": "///Q/128/O2'", "atom2_id": "///Q/129/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 572, "atom1_serNum": 6406, "atom2_serNum": 6417, "donAcc_type": "acceptable", "distance": 2.486, "atom1_id": "///Q/136/O2'", "atom2_id": "///Q/137/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 573, "atom1_serNum": 6426, "atom2_serNum": 6440, "donAcc_type": "acceptable", "distance": 2.608, "atom1_id": "///Q/137/O2'", "atom2_id": "///Q/138/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 574, "atom1_serNum": 6449, "atom2_serNum": 6467, "donAcc_type": "acceptable", "distance": 3.053, "atom1_id": "///Q/138/O2'", "atom2_id": "///Q/139/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 575, "atom1_serNum": 6534, "atom2_serNum": 9853, "donAcc_type": "acceptable", "distance": 3.149, "atom1_id": "///G/-1/O2'", "atom2_id": "///H/0/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 576, "atom1_serNum": 6541, "atom2_serNum": 9896, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///G/-1/N6", "atom2_id": "///H/2/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 577, "atom1_serNum": 6541, "atom2_serNum": 11273, "donAcc_type": "questionable", "distance": 3.149, "atom1_id": "///G/-1/N6", "atom2_id": "///S/56/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 578, "atom1_serNum": 6542, "atom2_serNum": 9892, "donAcc_type": "acceptable", "distance": 2.848, "atom1_id": "///G/-1/N1", "atom2_id": "///H/2/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 579, "atom1_serNum": 6548, "atom2_serNum": 7513, "donAcc_type": "questionable", "distance": 3.111, "atom1_id": "///G/0/O5'", "atom2_id": "///R/33/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 580, "atom1_serNum": 6551, "atom2_serNum": 6598, "donAcc_type": "questionable", "distance": 2.979, "atom1_id": "///G/0/O4'", "atom2_id": "///G/2/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 581, "atom1_serNum": 6555, "atom2_serNum": 7514, "donAcc_type": "acceptable", "distance": 3.193, "atom1_id": "///G/0/O2'", "atom2_id": "///R/33/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 582, "atom1_serNum": 6563, "atom2_serNum": 9824, "donAcc_type": "acceptable", "distance": 3.331, "atom1_id": "///G/0/N6", "atom2_id": "///H/-1/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 583, "atom1_serNum": 6564, "atom2_serNum": 8022, "donAcc_type": "acceptable", "distance": 2.721, "atom1_id": "///G/0/N1", "atom2_id": "///R/57/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 584, "atom1_serNum": 6566, "atom2_serNum": 8032, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///G/0/N3", "atom2_id": "///R/57/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 585, "atom1_serNum": 6570, "atom2_serNum": 7491, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///G/1/OP1", "atom2_id": "///R/32/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 586, "atom1_serNum": 6570, "atom2_serNum": 7514, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///G/1/OP1", "atom2_id": "///R/33/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 587, "atom1_serNum": 6570, "atom2_serNum": 7516, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///G/1/OP1", "atom2_id": "///R/33/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 588, "atom1_serNum": 6571, "atom2_serNum": 8032, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///G/1/OP2", "atom2_id": "///R/57/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 589, "atom1_serNum": 6571, "atom2_serNum": 16047, "donAcc_type": "acceptable", "distance": 2.439, "atom1_id": "///G/1/OP2", "atom2_id": "///G/5003/O1", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 590, "atom1_serNum": 6572, "atom2_serNum": 16048, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///G/1/O5'", "atom2_id": "///G/5003/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 591, "atom1_serNum": 6579, "atom2_serNum": 7442, "donAcc_type": "acceptable", "distance": 2.629, "atom1_id": "///G/1/O2'", "atom2_id": "///R/30/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 592, "atom1_serNum": 6583, "atom2_serNum": 7750, "donAcc_type": "standard", "distance": 3.828, "atom1_id": "///G/1/N7", "atom2_id": "///R/44/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 593, "atom1_serNum": 6587, "atom2_serNum": 16052, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///G/1/N1", "atom2_id": "///G/5003/O6", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 594, "atom1_serNum": 6587, "atom2_serNum": 16054, "donAcc_type": "acceptable", "distance": 2.918, "atom1_id": "///G/1/N1", "atom2_id": "///G/5003/OP1", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 595, "atom1_serNum": 6589, "atom2_serNum": 16055, "donAcc_type": "acceptable", "distance": 3.261, "atom1_id": "///G/1/N2", "atom2_id": "///G/5003/OP2", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 596, "atom1_serNum": 6594, "atom2_serNum": 7430, "donAcc_type": "questionable", "distance": 3.089, "atom1_id": "///G/2/OP2", "atom2_id": "///R/30/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 597, "atom1_serNum": 6602, "atom2_serNum": 9832, "donAcc_type": "acceptable", "distance": 2.900, "atom1_id": "///G/2/O2'", "atom2_id": "///H/-1/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 598, "atom1_serNum": 6606, "atom2_serNum": 8009, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///G/2/O2", "atom2_id": "///R/56/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 599, "atom1_serNum": 6606, "atom2_serNum": 9831, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///G/2/O2", "atom2_id": "///H/-1/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 600, "atom1_serNum": 6607, "atom2_serNum": 8007, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///G/2/N3", "atom2_id": "///R/56/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 601, "atom1_serNum": 6609, "atom2_serNum": 8006, "donAcc_type": "standard", "distance": 2.678, "atom1_id": "///G/2/N4", "atom2_id": "///R/56/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 602, "atom1_serNum": 6609, "atom2_serNum": 16051, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///G/2/N4", "atom2_id": "///G/5003/O5", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 603, "atom1_serNum": 6629, "atom2_serNum": 7986, "donAcc_type": "standard", "distance": 2.755, "atom1_id": "///G/3/O6", "atom2_id": "///R/55/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 604, "atom1_serNum": 6630, "atom2_serNum": 7984, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///G/3/N1", "atom2_id": "///R/55/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 605, "atom1_serNum": 6632, "atom2_serNum": 7983, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///G/3/N2", "atom2_id": "///R/55/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 606, "atom1_serNum": 6649, "atom2_serNum": 7966, "donAcc_type": "standard", "distance": 2.602, "atom1_id": "///G/4/O2", "atom2_id": "///R/54/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 607, "atom1_serNum": 6650, "atom2_serNum": 7964, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///G/4/N3", "atom2_id": "///R/54/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 608, "atom1_serNum": 6652, "atom2_serNum": 7963, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///G/4/N4", "atom2_id": "///R/54/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 609, "atom1_serNum": 6665, "atom2_serNum": 7381, "donAcc_type": "acceptable", "distance": 3.044, "atom1_id": "///G/5/O2'", "atom2_id": "///R/27/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 610, "atom1_serNum": 6669, "atom2_serNum": 7943, "donAcc_type": "standard", "distance": 2.792, "atom1_id": "///G/5/O2", "atom2_id": "///R/53/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 611, "atom1_serNum": 6670, "atom2_serNum": 7941, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///G/5/N3", "atom2_id": "///R/53/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 612, "atom1_serNum": 6672, "atom2_serNum": 7940, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///G/5/N4", "atom2_id": "///R/53/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 613, "atom1_serNum": 6685, "atom2_serNum": 6703, "donAcc_type": "acceptable", "distance": 2.843, "atom1_id": "///G/6/O2'", "atom2_id": "///G/7/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 614, "atom1_serNum": 6714, "atom2_serNum": 7383, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///G/7/O6", "atom2_id": "///R/27/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 615, "atom1_serNum": 6714, "atom2_serNum": 7920, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///G/7/O6", "atom2_id": "///R/52/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 616, "atom1_serNum": 6715, "atom2_serNum": 7918, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///G/7/N1", "atom2_id": "///R/52/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 617, "atom1_serNum": 6717, "atom2_serNum": 7917, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///G/7/N2", "atom2_id": "///R/52/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 618, "atom1_serNum": 6730, "atom2_serNum": 6748, "donAcc_type": "acceptable", "distance": 3.200, "atom1_id": "///G/8/O2'", "atom2_id": "///G/9/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 619, "atom1_serNum": 6730, "atom2_serNum": 7880, "donAcc_type": "acceptable", "distance": 2.735, "atom1_id": "///G/8/O2'", "atom2_id": "///R/50/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 620, "atom1_serNum": 6737, "atom2_serNum": 7360, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///G/8/N6", "atom2_id": "///R/26/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 621, "atom1_serNum": 6738, "atom2_serNum": 7358, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///G/8/N1", "atom2_id": "///R/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 622, "atom1_serNum": 6740, "atom2_serNum": 7877, "donAcc_type": "questionable", "distance": 3.170, "atom1_id": "///G/8/N3", "atom2_id": "///R/50/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 623, "atom1_serNum": 6740, "atom2_serNum": 7878, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///G/8/N3", "atom2_id": "///R/50/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 624, "atom1_serNum": 6759, "atom2_serNum": 7317, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///G/9/N6", "atom2_id": "///R/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 625, "atom1_serNum": 6759, "atom2_serNum": 7340, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///G/9/N6", "atom2_id": "///R/25/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 626, "atom1_serNum": 6760, "atom2_serNum": 7338, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///G/9/N1", "atom2_id": "///R/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 627, "atom1_serNum": 6774, "atom2_serNum": 9174, "donAcc_type": "acceptable", "distance": 2.502, "atom1_id": "///G/10/O2'", "atom2_id": "///R/112/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 628, "atom1_serNum": 6778, "atom2_serNum": 7320, "donAcc_type": "standard", "distance": 3.272, "atom1_id": "///G/10/O2", "atom2_id": "///R/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 629, "atom1_serNum": 6778, "atom2_serNum": 9174, "donAcc_type": "acceptable", "distance": 3.274, "atom1_id": "///G/10/O2", "atom2_id": "///R/112/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 630, "atom1_serNum": 6779, "atom2_serNum": 7318, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///G/10/N3", "atom2_id": "///R/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 631, "atom1_serNum": 6781, "atom2_serNum": 7317, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///G/10/N4", "atom2_id": "///R/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 632, "atom1_serNum": 6790, "atom2_serNum": 9170, "donAcc_type": "questionable", "distance": 2.929, "atom1_id": "///G/11/O4'", "atom2_id": "///R/112/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 633, "atom1_serNum": 6792, "atom2_serNum": 6811, "donAcc_type": "acceptable", "distance": 2.429, "atom1_id": "///G/11/O3'", "atom2_id": "///R/12/O1B", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 634, "atom1_serNum": 6792, "atom2_serNum": 9151, "donAcc_type": "acceptable", "distance": 2.716, "atom1_id": "///G/11/O3'", "atom2_id": "///R/111/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 635, "atom1_serNum": 6794, "atom2_serNum": 9162, "donAcc_type": "acceptable", "distance": 2.597, "atom1_id": "///G/11/O2'", "atom2_id": "///R/111/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 636, "atom1_serNum": 6798, "atom2_serNum": 9161, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///G/11/O2", "atom2_id": "///R/111/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 637, "atom1_serNum": 6799, "atom2_serNum": 7296, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///G/11/N3", "atom2_id": "///R/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 638, "atom1_serNum": 6801, "atom2_serNum": 7295, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///G/11/O4", "atom2_id": "///R/23/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 639, "atom1_serNum": 6806, "atom2_serNum": 6813, "donAcc_type": "acceptable", "distance": 2.778, "atom1_id": "///R/12/O1G", "atom2_id": "///R/12/O3A", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 640, "atom1_serNum": 6806, "atom2_serNum": 6816, "donAcc_type": "acceptable", "distance": 2.685, "atom1_id": "///R/12/O1G", "atom2_id": "///R/12/O2A", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 641, "atom1_serNum": 6807, "atom2_serNum": 6812, "donAcc_type": "acceptable", "distance": 3.105, "atom1_id": "///R/12/O2G", "atom2_id": "///R/12/O2B", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 642, "atom1_serNum": 6824, "atom2_serNum": 9136, "donAcc_type": "acceptable", "distance": 3.265, "atom1_id": "///R/12/O2'", "atom2_id": "///R/110/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 643, "atom1_serNum": 6831, "atom2_serNum": 7275, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///R/12/O6", "atom2_id": "///R/22/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 644, "atom1_serNum": 6832, "atom2_serNum": 7273, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///R/12/N1", "atom2_id": "///R/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 645, "atom1_serNum": 6834, "atom2_serNum": 7272, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///R/12/N2", "atom2_id": "///R/22/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 646, "atom1_serNum": 6839, "atom2_serNum": 14890, "donAcc_type": "standard", "distance": 3.947, "atom1_id": "///R/13/OP2", "atom2_id": "///C/47/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 647, "atom1_serNum": 6854, "atom2_serNum": 7255, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///R/13/O6", "atom2_id": "///R/21/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 648, "atom1_serNum": 6855, "atom2_serNum": 7253, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///R/13/N1", "atom2_id": "///R/21/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 649, "atom1_serNum": 6861, "atom2_serNum": 14686, "donAcc_type": "standard", "distance": 3.420, "atom1_id": "///R/14/OP1", "atom2_id": "///C/22/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 650, "atom1_serNum": 6874, "atom2_serNum": 7235, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///R/14/O2", "atom2_id": "///R/20/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 651, "atom1_serNum": 6875, "atom2_serNum": 7233, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///R/14/N3", "atom2_id": "///R/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 652, "atom1_serNum": 6877, "atom2_serNum": 7232, "donAcc_type": "standard", "distance": 3.540, "atom1_id": "///R/14/N4", "atom2_id": "///R/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 653, "atom1_serNum": 6897, "atom2_serNum": 7212, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///R/15/N6", "atom2_id": "///R/19/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 654, "atom1_serNum": 6898, "atom2_serNum": 7210, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///R/15/N1", "atom2_id": "///R/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 655, "atom1_serNum": 6916, "atom2_serNum": 7192, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///R/16/O2", "atom2_id": "///R/18/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 656, "atom1_serNum": 6917, "atom2_serNum": 7190, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///R/16/N3", "atom2_id": "///R/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 657, "atom1_serNum": 6919, "atom2_serNum": 7189, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///R/16/N4", "atom2_id": "///R/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 658, "atom1_serNum": 6936, "atom2_serNum": 7169, "donAcc_type": "standard", "distance": 2.771, "atom1_id": "///R/17/O2", "atom2_id": "///R/17/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 659, "atom1_serNum": 6937, "atom2_serNum": 7167, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///R/17/N3", "atom2_id": "///R/17/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 660, "atom1_serNum": 6939, "atom2_serNum": 7166, "donAcc_type": "standard", "distance": 3.366, "atom1_id": "///R/17/N4", "atom2_id": "///R/17/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 661, "atom1_serNum": 6960, "atom2_serNum": 14932, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///R/17/N1", "atom2_id": "///C/52/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 662, "atom1_serNum": 6978, "atom2_serNum": 7024, "donAcc_type": "standard", "distance": 2.396, "atom1_id": "///R/17/O2", "atom2_id": "///R/17/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 663, "atom1_serNum": 6979, "atom2_serNum": 14659, "donAcc_type": "standard", "distance": 2.896, "atom1_id": "///R/17/N3", "atom2_id": "///C/19/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 664, "atom1_serNum": 6998, "atom2_serNum": 15180, "donAcc_type": "standard", "distance": 3.380, "atom1_id": "///R/17/O2", "atom2_id": "///C/83/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 665, "atom1_serNum": 6999, "atom2_serNum": 14634, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///R/17/N3", "atom2_id": "///C/16/OD1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 666, "atom1_serNum": 7014, "atom2_serNum": 14909, "donAcc_type": "acceptable", "distance": 2.702, "atom1_id": "///R/17/O2'", "atom2_id": "///C/50/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 667, "atom1_serNum": 7018, "atom2_serNum": 14611, "donAcc_type": "acceptable", "distance": 3.453, "atom1_id": "///R/17/N7", "atom2_id": "///C/13/OH", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 668, "atom1_serNum": 7021, "atom2_serNum": 14628, "donAcc_type": "standard", "distance": 3.264, "atom1_id": "///R/17/O6", "atom2_id": "///C/16/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 669, "atom1_serNum": 7022, "atom2_serNum": 14660, "donAcc_type": "standard", "distance": 3.180, "atom1_id": "///R/17/N1", "atom2_id": "///C/19/OE2", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 670, "atom1_serNum": 7024, "atom2_serNum": 14660, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///R/17/N2", "atom2_id": "///C/19/OE2", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 671, "atom1_serNum": 7042, "atom2_serNum": 15215, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///R/17/N3", "atom2_id": "///C/88/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 672, "atom1_serNum": 7044, "atom2_serNum": 15197, "donAcc_type": "questionable", "distance": 2.955, "atom1_id": "///R/17/N4", "atom2_id": "///C/85/NE2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 673, "atom1_serNum": 7044, "atom2_serNum": 15201, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///R/17/N4", "atom2_id": "///C/86/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 674, "atom1_serNum": 7064, "atom2_serNum": 15223, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///R/17/N6", "atom2_id": "///C/89/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 675, "atom1_serNum": 7065, "atom2_serNum": 15240, "donAcc_type": "acceptable", "distance": 2.581, "atom1_id": "///R/17/N1", "atom2_id": "///C/91/OG", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 676, "atom1_serNum": 7084, "atom2_serNum": 15241, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///R/17/N3", "atom2_id": "///C/92/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 677, "atom1_serNum": 7086, "atom2_serNum": 15225, "donAcc_type": "acceptable", "distance": 3.878, "atom1_id": "///R/17/N4", "atom2_id": "///C/89/OG1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 678, "atom1_serNum": 7086, "atom2_serNum": 15230, "donAcc_type": "standard", "distance": 3.069, "atom1_id": "///R/17/N4", "atom2_id": "///C/90/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 679, "atom1_serNum": 7130, "atom2_serNum": 14880, "donAcc_type": "acceptable", "distance": 2.985, "atom1_id": "///R/17/OP1", "atom2_id": "///C/46/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 680, "atom1_serNum": 7150, "atom2_serNum": 14898, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///R/17/OP1", "atom2_id": "///C/49/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 681, "atom1_serNum": 7163, "atom2_serNum": 14933, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///R/17/N7", "atom2_id": "///C/52/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 682, "atom1_serNum": 7166, "atom2_serNum": 14932, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///R/17/O6", "atom2_id": "///C/52/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 683, "atom1_serNum": 7225, "atom2_serNum": 7244, "donAcc_type": "acceptable", "distance": 3.109, "atom1_id": "///R/20/O2'", "atom2_id": "///R/21/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 684, "atom1_serNum": 7301, "atom2_serNum": 12335, "donAcc_type": "acceptable", "distance": 3.237, "atom1_id": "///R/24/OP1", "atom2_id": "///S/107/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 685, "atom1_serNum": 7310, "atom2_serNum": 9182, "donAcc_type": "acceptable", "distance": 2.710, "atom1_id": "///R/24/O2'", "atom2_id": "///R/112/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 686, "atom1_serNum": 7320, "atom2_serNum": 9184, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///R/24/N2", "atom2_id": "///R/112/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 687, "atom1_serNum": 7331, "atom2_serNum": 9196, "donAcc_type": "acceptable", "distance": 3.104, "atom1_id": "///R/25/O3'", "atom2_id": "///R/113/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 688, "atom1_serNum": 7333, "atom2_serNum": 9196, "donAcc_type": "acceptable", "distance": 2.539, "atom1_id": "///R/25/O2'", "atom2_id": "///R/113/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 689, "atom1_serNum": 7373, "atom2_serNum": 7920, "donAcc_type": "acceptable", "distance": 2.864, "atom1_id": "///R/27/O2'", "atom2_id": "///R/52/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 690, "atom1_serNum": 7384, "atom2_serNum": 7920, "donAcc_type": "standard", "distance": 3.825, "atom1_id": "///R/27/N3", "atom2_id": "///R/52/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 691, "atom1_serNum": 7403, "atom2_serNum": 16054, "donAcc_type": "acceptable", "distance": 3.279, "atom1_id": "///R/28/N6", "atom2_id": "///G/5003/OP1", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 692, "atom1_serNum": 7406, "atom2_serNum": 7425, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///R/28/N3", "atom2_id": "///R/29/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 693, "atom1_serNum": 7414, "atom2_serNum": 8917, "donAcc_type": "acceptable", "distance": 3.438, "atom1_id": "///R/29/O4'", "atom2_id": "///R/100/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 694, "atom1_serNum": 7416, "atom2_serNum": 8895, "donAcc_type": "acceptable", "distance": 2.840, "atom1_id": "///R/29/O3'", "atom2_id": "///R/99/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 695, "atom1_serNum": 7418, "atom2_serNum": 8895, "donAcc_type": "acceptable", "distance": 2.787, "atom1_id": "///R/29/O2'", "atom2_id": "///R/99/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 696, "atom1_serNum": 7418, "atom2_serNum": 8905, "donAcc_type": "acceptable", "distance": 2.511, "atom1_id": "///R/29/O2'", "atom2_id": "///R/99/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 697, "atom1_serNum": 7418, "atom2_serNum": 8913, "donAcc_type": "acceptable", "distance": 3.251, "atom1_id": "///R/29/O2'", "atom2_id": "///R/100/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 698, "atom1_serNum": 7422, "atom2_serNum": 7773, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///R/29/O2", "atom2_id": "///R/45/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 699, "atom1_serNum": 7423, "atom2_serNum": 7771, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///R/29/N3", "atom2_id": "///R/45/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 700, "atom1_serNum": 7425, "atom2_serNum": 7770, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///R/29/N4", "atom2_id": "///R/45/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 701, "atom1_serNum": 7434, "atom2_serNum": 8895, "donAcc_type": "acceptable", "distance": 3.612, "atom1_id": "///R/30/O4'", "atom2_id": "///R/99/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 702, "atom1_serNum": 7438, "atom2_serNum": 8873, "donAcc_type": "acceptable", "distance": 3.063, "atom1_id": "///R/30/O2'", "atom2_id": "///R/98/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 703, "atom1_serNum": 7438, "atom2_serNum": 8883, "donAcc_type": "acceptable", "distance": 2.514, "atom1_id": "///R/30/O2'", "atom2_id": "///R/98/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 704, "atom1_serNum": 7445, "atom2_serNum": 7750, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///R/30/O6", "atom2_id": "///R/44/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 705, "atom1_serNum": 7446, "atom2_serNum": 7748, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///R/30/N1", "atom2_id": "///R/44/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 706, "atom1_serNum": 7448, "atom2_serNum": 7747, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///R/30/N2", "atom2_id": "///R/44/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 707, "atom1_serNum": 7448, "atom2_serNum": 9417, "donAcc_type": "standard", "distance": 3.134, "atom1_id": "///R/30/N2", "atom2_id": "///R/123/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 708, "atom1_serNum": 7457, "atom2_serNum": 9416, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///R/31/O4'", "atom2_id": "///R/123/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 709, "atom1_serNum": 7461, "atom2_serNum": 9439, "donAcc_type": "acceptable", "distance": 3.327, "atom1_id": "///R/31/O2'", "atom2_id": "///R/124/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 710, "atom1_serNum": 7461, "atom2_serNum": 9461, "donAcc_type": "acceptable", "distance": 2.981, "atom1_id": "///R/31/O2'", "atom2_id": "///R/125/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 711, "atom1_serNum": 7468, "atom2_serNum": 7730, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///R/31/N6", "atom2_id": "///R/43/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 712, "atom1_serNum": 7469, "atom2_serNum": 7728, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///R/31/N1", "atom2_id": "///R/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 713, "atom1_serNum": 7506, "atom2_serNum": 8067, "donAcc_type": "acceptable", "distance": 2.910, "atom1_id": "///R/33/O2'", "atom2_id": "///R/59/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 714, "atom1_serNum": 7517, "atom2_serNum": 8067, "donAcc_type": "acceptable", "distance": 2.636, "atom1_id": "///R/33/N3", "atom2_id": "///R/59/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 715, "atom1_serNum": 7525, "atom2_serNum": 8063, "donAcc_type": "questionable", "distance": 3.052, "atom1_id": "///R/34/O4'", "atom2_id": "///R/59/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 716, "atom1_serNum": 7541, "atom2_serNum": 8589, "donAcc_type": "acceptable", "distance": 2.770, "atom1_id": "///R/35/OP2", "atom2_id": "///R/84/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 717, "atom1_serNum": 7545, "atom2_serNum": 8589, "donAcc_type": "acceptable", "distance": 3.154, "atom1_id": "///R/35/O4'", "atom2_id": "///R/84/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 718, "atom1_serNum": 7556, "atom2_serNum": 8199, "donAcc_type": "standard", "distance": 2.523, "atom1_id": "///R/35/O6", "atom2_id": "///R/65/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 719, "atom1_serNum": 7557, "atom2_serNum": 8197, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///R/35/N1", "atom2_id": "///R/65/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 720, "atom1_serNum": 7559, "atom2_serNum": 8196, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///R/35/N2", "atom2_id": "///R/65/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 721, "atom1_serNum": 7579, "atom2_serNum": 8179, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///R/36/O6", "atom2_id": "///R/64/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 722, "atom1_serNum": 7580, "atom2_serNum": 8177, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///R/36/N1", "atom2_id": "///R/64/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 723, "atom1_serNum": 7582, "atom2_serNum": 8176, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///R/36/N2", "atom2_id": "///R/64/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 724, "atom1_serNum": 7602, "atom2_serNum": 8157, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///R/37/O6", "atom2_id": "///R/63/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 725, "atom1_serNum": 7603, "atom2_serNum": 8156, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///R/37/N1", "atom2_id": "///R/63/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 726, "atom1_serNum": 7625, "atom2_serNum": 8139, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///R/38/O6", "atom2_id": "///R/62/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 727, "atom1_serNum": 7626, "atom2_serNum": 8137, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///R/38/N1", "atom2_id": "///R/62/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 728, "atom1_serNum": 7628, "atom2_serNum": 8136, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///R/38/N2", "atom2_id": "///R/62/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 729, "atom1_serNum": 7646, "atom2_serNum": 8118, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///R/39/N3", "atom2_id": "///R/61/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 730, "atom1_serNum": 7648, "atom2_serNum": 8117, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///R/39/O4", "atom2_id": "///R/61/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 731, "atom1_serNum": 7665, "atom2_serNum": 8095, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///R/40/O2", "atom2_id": "///R/60/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 732, "atom1_serNum": 7666, "atom2_serNum": 8094, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///R/40/N3", "atom2_id": "///R/60/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 733, "atom1_serNum": 7701, "atom2_serNum": 16050, "donAcc_type": "acceptable", "distance": 2.919, "atom1_id": "///R/42/O2'", "atom2_id": "///G/5003/O4", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 734, "atom1_serNum": 7708, "atom2_serNum": 8059, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///R/42/N6", "atom2_id": "///R/59/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 735, "atom1_serNum": 7715, "atom2_serNum": 16049, "donAcc_type": "acceptable", "distance": 2.973, "atom1_id": "///R/43/OP2", "atom2_id": "///G/5003/O3", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 736, "atom1_serNum": 7730, "atom2_serNum": 16048, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///R/43/O4", "atom2_id": "///G/5003/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 737, "atom1_serNum": 7741, "atom2_serNum": 9431, "donAcc_type": "acceptable", "distance": 2.971, "atom1_id": "///R/44/O3'", "atom2_id": "///R/124/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 738, "atom1_serNum": 7743, "atom2_serNum": 9431, "donAcc_type": "acceptable", "distance": 2.910, "atom1_id": "///R/44/O2'", "atom2_id": "///R/124/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 739, "atom1_serNum": 7743, "atom2_serNum": 9441, "donAcc_type": "acceptable", "distance": 2.694, "atom1_id": "///R/44/O2'", "atom2_id": "///R/124/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 740, "atom1_serNum": 7743, "atom2_serNum": 9449, "donAcc_type": "acceptable", "distance": 2.899, "atom1_id": "///R/44/O2'", "atom2_id": "///R/125/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 741, "atom1_serNum": 7763, "atom2_serNum": 9409, "donAcc_type": "acceptable", "distance": 2.747, "atom1_id": "///R/45/O2'", "atom2_id": "///R/123/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 742, "atom1_serNum": 7763, "atom2_serNum": 9419, "donAcc_type": "acceptable", "distance": 2.837, "atom1_id": "///R/45/O2'", "atom2_id": "///R/123/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 743, "atom1_serNum": 7763, "atom2_serNum": 9427, "donAcc_type": "acceptable", "distance": 3.259, "atom1_id": "///R/45/O2'", "atom2_id": "///R/124/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 744, "atom1_serNum": 7773, "atom2_serNum": 8881, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///R/45/N2", "atom2_id": "///R/98/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 745, "atom1_serNum": 7782, "atom2_serNum": 8880, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///R/46/O4'", "atom2_id": "///R/98/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 746, "atom1_serNum": 7786, "atom2_serNum": 8902, "donAcc_type": "acceptable", "distance": 3.196, "atom1_id": "///R/46/O2'", "atom2_id": "///R/99/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 747, "atom1_serNum": 7786, "atom2_serNum": 8925, "donAcc_type": "acceptable", "distance": 2.690, "atom1_id": "///R/46/O2'", "atom2_id": "///R/100/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 748, "atom1_serNum": 7793, "atom2_serNum": 7897, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///R/46/N6", "atom2_id": "///R/51/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 749, "atom1_serNum": 7794, "atom2_serNum": 7898, "donAcc_type": "standard", "distance": 2.903, "atom1_id": "///R/46/N1", "atom2_id": "///R/51/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 750, "atom1_serNum": 7808, "atom2_serNum": 8939, "donAcc_type": "acceptable", "distance": 2.714, "atom1_id": "///R/47/O2'", "atom2_id": "///R/101/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 751, "atom1_serNum": 7818, "atom2_serNum": 7893, "donAcc_type": "acceptable", "distance": 2.971, "atom1_id": "///R/47/N2", "atom2_id": "///R/51/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 752, "atom1_serNum": 7831, "atom2_serNum": 7846, "donAcc_type": "acceptable", "distance": 3.174, "atom1_id": "///R/48/O2'", "atom2_id": "///R/49/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 753, "atom1_serNum": 7831, "atom2_serNum": 7865, "donAcc_type": "acceptable", "distance": 3.135, "atom1_id": "///R/48/O2'", "atom2_id": "///R/50/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 754, "atom1_serNum": 7853, "atom2_serNum": 7864, "donAcc_type": "acceptable", "distance": 2.407, "atom1_id": "///R/49/O2'", "atom2_id": "///R/50/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 755, "atom1_serNum": 7853, "atom2_serNum": 7866, "donAcc_type": "acceptable", "distance": 2.899, "atom1_id": "///R/49/O2'", "atom2_id": "///R/50/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 756, "atom1_serNum": 8009, "atom2_serNum": 9831, "donAcc_type": "questionable", "distance": 2.894, "atom1_id": "///R/56/N2", "atom2_id": "///H/-1/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 757, "atom1_serNum": 8030, "atom2_serNum": 16047, "donAcc_type": "acceptable", "distance": 3.204, "atom1_id": "///R/57/N1", "atom2_id": "///G/5003/O1", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 758, "atom1_serNum": 8163, "atom2_serNum": 14181, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///R/64/OP1", "atom2_id": "///B/50/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 759, "atom1_serNum": 8216, "atom2_serNum": 8599, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///R/66/O2", "atom2_id": "///R/84/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 760, "atom1_serNum": 8217, "atom2_serNum": 8597, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///R/66/N3", "atom2_id": "///R/84/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 761, "atom1_serNum": 8219, "atom2_serNum": 8596, "donAcc_type": "standard", "distance": 2.617, "atom1_id": "///R/66/N4", "atom2_id": "///R/84/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 762, "atom1_serNum": 8239, "atom2_serNum": 8576, "donAcc_type": "standard", "distance": 2.952, "atom1_id": "///R/67/O6", "atom2_id": "///R/83/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 763, "atom1_serNum": 8240, "atom2_serNum": 8574, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///R/67/N1", "atom2_id": "///R/83/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 764, "atom1_serNum": 8242, "atom2_serNum": 8573, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///R/67/N2", "atom2_id": "///R/83/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 765, "atom1_serNum": 8242, "atom2_serNum": 8632, "donAcc_type": "standard", "distance": 3.873, "atom1_id": "///R/67/N2", "atom2_id": "///R/86/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 766, "atom1_serNum": 8255, "atom2_serNum": 8654, "donAcc_type": "acceptable", "distance": 2.585, "atom1_id": "///R/68/O2'", "atom2_id": "///R/87/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 767, "atom1_serNum": 8262, "atom2_serNum": 8556, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///R/68/O6", "atom2_id": "///R/82/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 768, "atom1_serNum": 8263, "atom2_serNum": 8554, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///R/68/N1", "atom2_id": "///R/82/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 769, "atom1_serNum": 8265, "atom2_serNum": 8553, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///R/68/N2", "atom2_id": "///R/82/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 770, "atom1_serNum": 8265, "atom2_serNum": 8656, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///R/68/N2", "atom2_id": "///R/87/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 771, "atom1_serNum": 8282, "atom2_serNum": 8646, "donAcc_type": "acceptable", "distance": 2.814, "atom1_id": "///R/69/O2", "atom2_id": "///R/87/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 772, "atom1_serNum": 8283, "atom2_serNum": 8535, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///R/69/N3", "atom2_id": "///R/81/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 773, "atom1_serNum": 8285, "atom2_serNum": 8534, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///R/69/O4", "atom2_id": "///R/81/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 774, "atom1_serNum": 8298, "atom2_serNum": 9681, "donAcc_type": "acceptable", "distance": 3.058, "atom1_id": "///R/70/O2'", "atom2_id": "///R/135/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 775, "atom1_serNum": 8303, "atom2_serNum": 8513, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///R/70/N3", "atom2_id": "///R/80/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 776, "atom1_serNum": 8305, "atom2_serNum": 8512, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///R/70/O4", "atom2_id": "///R/80/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 777, "atom1_serNum": 8325, "atom2_serNum": 8492, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///R/71/O6", "atom2_id": "///R/79/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 778, "atom1_serNum": 8326, "atom2_serNum": 8490, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///R/71/N1", "atom2_id": "///R/79/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 779, "atom1_serNum": 8328, "atom2_serNum": 8489, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///R/71/N2", "atom2_id": "///R/79/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 780, "atom1_serNum": 8348, "atom2_serNum": 9660, "donAcc_type": "questionable", "distance": 2.865, "atom1_id": "///R/72/O4", "atom2_id": "///R/134/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 781, "atom1_serNum": 8366, "atom2_serNum": 9812, "donAcc_type": "standard", "distance": 3.480, "atom1_id": "///R/73/N3", "atom2_id": "///R/141/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 782, "atom1_serNum": 8368, "atom2_serNum": 9812, "donAcc_type": "questionable", "distance": 3.321, "atom1_id": "///R/73/O4", "atom2_id": "///R/141/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 783, "atom1_serNum": 8385, "atom2_serNum": 9791, "donAcc_type": "standard", "distance": 2.657, "atom1_id": "///R/74/O2", "atom2_id": "///R/140/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 784, "atom1_serNum": 8386, "atom2_serNum": 9789, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///R/74/N3", "atom2_id": "///R/140/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 785, "atom1_serNum": 8386, "atom2_serNum": 9791, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///R/74/N3", "atom2_id": "///R/140/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 786, "atom1_serNum": 8388, "atom2_serNum": 9788, "donAcc_type": "standard", "distance": 3.388, "atom1_id": "///R/74/N4", "atom2_id": "///R/140/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 787, "atom1_serNum": 8408, "atom2_serNum": 9768, "donAcc_type": "standard", "distance": 3.417, "atom1_id": "///R/75/N6", "atom2_id": "///R/139/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 788, "atom1_serNum": 8409, "atom2_serNum": 9766, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///R/75/N1", "atom2_id": "///R/139/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 789, "atom1_serNum": 8428, "atom2_serNum": 9747, "donAcc_type": "standard", "distance": 3.000, "atom1_id": "///R/76/N3", "atom2_id": "///R/138/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 790, "atom1_serNum": 8430, "atom2_serNum": 9746, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///R/76/O4", "atom2_id": "///R/138/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 791, "atom1_serNum": 8447, "atom2_serNum": 9726, "donAcc_type": "standard", "distance": 3.458, "atom1_id": "///R/77/O2", "atom2_id": "///R/137/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 792, "atom1_serNum": 8448, "atom2_serNum": 9724, "donAcc_type": "standard", "distance": 3.155, "atom1_id": "///R/77/N3", "atom2_id": "///R/137/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 793, "atom1_serNum": 8450, "atom2_serNum": 9723, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///R/77/N4", "atom2_id": "///R/137/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 794, "atom1_serNum": 8470, "atom2_serNum": 9703, "donAcc_type": "standard", "distance": 2.692, "atom1_id": "///R/78/N6", "atom2_id": "///R/136/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 795, "atom1_serNum": 8471, "atom2_serNum": 9701, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///R/78/N1", "atom2_id": "///R/136/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 796, "atom1_serNum": 8505, "atom2_serNum": 8523, "donAcc_type": "acceptable", "distance": 3.125, "atom1_id": "///R/80/O2'", "atom2_id": "///R/81/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 797, "atom1_serNum": 8527, "atom2_serNum": 8666, "donAcc_type": "acceptable", "distance": 2.876, "atom1_id": "///R/81/O2'", "atom2_id": "///R/88/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 798, "atom1_serNum": 8527, "atom2_serNum": 8668, "donAcc_type": "acceptable", "distance": 2.418, "atom1_id": "///R/81/O2'", "atom2_id": "///R/88/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 799, "atom1_serNum": 8549, "atom2_serNum": 8646, "donAcc_type": "acceptable", "distance": 2.657, "atom1_id": "///R/82/O2'", "atom2_id": "///R/87/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 800, "atom1_serNum": 8553, "atom2_serNum": 8646, "donAcc_type": "acceptable", "distance": 2.934, "atom1_id": "///R/82/O2", "atom2_id": "///R/87/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 801, "atom1_serNum": 8565, "atom2_serNum": 8642, "donAcc_type": "questionable", "distance": 3.078, "atom1_id": "///R/83/O4'", "atom2_id": "///R/87/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 802, "atom1_serNum": 8569, "atom2_serNum": 8634, "donAcc_type": "acceptable", "distance": 2.724, "atom1_id": "///R/83/O2'", "atom2_id": "///R/86/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 803, "atom1_serNum": 8585, "atom2_serNum": 8634, "donAcc_type": "questionable", "distance": 3.182, "atom1_id": "///R/84/O4'", "atom2_id": "///R/86/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 804, "atom1_serNum": 8624, "atom2_serNum": 8637, "donAcc_type": "acceptable", "distance": 2.636, "atom1_id": "///R/86/O2'", "atom2_id": "///R/87/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 805, "atom1_serNum": 8624, "atom2_serNum": 8642, "donAcc_type": "acceptable", "distance": 3.084, "atom1_id": "///R/86/O2'", "atom2_id": "///R/87/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 806, "atom1_serNum": 8632, "atom2_serNum": 11883, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///R/86/N1", "atom2_id": "///S/85/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 807, "atom1_serNum": 8675, "atom2_serNum": 9658, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///R/88/O6", "atom2_id": "///R/134/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 808, "atom1_serNum": 8676, "atom2_serNum": 9657, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///R/88/N1", "atom2_id": "///R/134/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 809, "atom1_serNum": 8695, "atom2_serNum": 9640, "donAcc_type": "standard", "distance": 2.899, "atom1_id": "///R/89/O2", "atom2_id": "///R/133/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 810, "atom1_serNum": 8696, "atom2_serNum": 9638, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///R/89/N3", "atom2_id": "///R/133/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 811, "atom1_serNum": 8698, "atom2_serNum": 9637, "donAcc_type": "standard", "distance": 3.189, "atom1_id": "///R/89/N4", "atom2_id": "///R/133/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 812, "atom1_serNum": 8716, "atom2_serNum": 9616, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///R/90/N3", "atom2_id": "///R/132/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 813, "atom1_serNum": 8718, "atom2_serNum": 9615, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///R/90/O4", "atom2_id": "///R/132/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 814, "atom1_serNum": 8736, "atom2_serNum": 9594, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///R/91/N3", "atom2_id": "///R/131/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 815, "atom1_serNum": 8738, "atom2_serNum": 9593, "donAcc_type": "standard", "distance": 3.112, "atom1_id": "///R/91/O4", "atom2_id": "///R/131/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 816, "atom1_serNum": 8756, "atom2_serNum": 9572, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///R/92/N3", "atom2_id": "///R/130/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 817, "atom1_serNum": 8758, "atom2_serNum": 9571, "donAcc_type": "standard", "distance": 2.732, "atom1_id": "///R/92/O4", "atom2_id": "///R/130/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 818, "atom1_serNum": 8771, "atom2_serNum": 8787, "donAcc_type": "acceptable", "distance": 3.236, "atom1_id": "///R/93/O2'", "atom2_id": "///R/94/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 819, "atom1_serNum": 8775, "atom2_serNum": 9549, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///R/93/O2", "atom2_id": "///R/129/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 820, "atom1_serNum": 8776, "atom2_serNum": 9548, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///R/93/N3", "atom2_id": "///R/129/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 821, "atom1_serNum": 8798, "atom2_serNum": 9528, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///R/94/N6", "atom2_id": "///R/128/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 822, "atom1_serNum": 8799, "atom2_serNum": 9526, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///R/94/N1", "atom2_id": "///R/128/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 823, "atom1_serNum": 8817, "atom2_serNum": 9508, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///R/95/O2", "atom2_id": "///R/127/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 824, "atom1_serNum": 8818, "atom2_serNum": 9506, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///R/95/N3", "atom2_id": "///R/127/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 825, "atom1_serNum": 8820, "atom2_serNum": 9505, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///R/95/N4", "atom2_id": "///R/127/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 826, "atom1_serNum": 8837, "atom2_serNum": 9483, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///R/96/O2", "atom2_id": "///R/126/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 827, "atom1_serNum": 8838, "atom2_serNum": 9482, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///R/96/N3", "atom2_id": "///R/126/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 828, "atom1_serNum": 8899, "atom2_serNum": 9396, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///R/99/N7", "atom2_id": "///R/122/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 829, "atom1_serNum": 8902, "atom2_serNum": 9393, "donAcc_type": "standard", "distance": 3.350, "atom1_id": "///R/99/N6", "atom2_id": "///R/122/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 830, "atom1_serNum": 8902, "atom2_serNum": 9394, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///R/99/N6", "atom2_id": "///R/122/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 831, "atom1_serNum": 8921, "atom2_serNum": 9374, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///R/100/N7", "atom2_id": "///R/121/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 832, "atom1_serNum": 8924, "atom2_serNum": 9375, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///R/100/N6", "atom2_id": "///R/121/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 833, "atom1_serNum": 8931, "atom2_serNum": 8966, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///R/101/OP2", "atom2_id": "///R/102/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 834, "atom1_serNum": 8946, "atom2_serNum": 9352, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///R/101/O4", "atom2_id": "///R/120/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 835, "atom1_serNum": 8946, "atom2_serNum": 9354, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///R/101/O4", "atom2_id": "///R/120/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 836, "atom1_serNum": 8963, "atom2_serNum": 9331, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///R/102/O2", "atom2_id": "///R/119/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 837, "atom1_serNum": 8964, "atom2_serNum": 9329, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///R/102/N3", "atom2_id": "///R/119/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 838, "atom1_serNum": 8966, "atom2_serNum": 9328, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///R/102/N4", "atom2_id": "///R/119/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 839, "atom1_serNum": 8986, "atom2_serNum": 9308, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///R/103/N6", "atom2_id": "///R/118/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 840, "atom1_serNum": 8987, "atom2_serNum": 9306, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///R/103/N1", "atom2_id": "///R/118/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 841, "atom1_serNum": 9005, "atom2_serNum": 9286, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///R/104/O2", "atom2_id": "///R/117/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 842, "atom1_serNum": 9006, "atom2_serNum": 9285, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///R/104/N3", "atom2_id": "///R/117/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 843, "atom1_serNum": 9026, "atom2_serNum": 9264, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///R/105/N3", "atom2_id": "///R/116/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 844, "atom1_serNum": 9028, "atom2_serNum": 9263, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///R/105/O4", "atom2_id": "///R/116/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 845, "atom1_serNum": 9041, "atom2_serNum": 9059, "donAcc_type": "acceptable", "distance": 3.210, "atom1_id": "///R/106/O2'", "atom2_id": "///R/107/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 846, "atom1_serNum": 9049, "atom2_serNum": 9241, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///R/106/N1", "atom2_id": "///R/115/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 847, "atom1_serNum": 9063, "atom2_serNum": 10558, "donAcc_type": "acceptable", "distance": 3.570, "atom1_id": "///R/107/O2'", "atom2_id": "///S/23/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 848, "atom1_serNum": 9070, "atom2_serNum": 9223, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///R/107/N6", "atom2_id": "///R/114/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 849, "atom1_serNum": 9071, "atom2_serNum": 9221, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///R/107/N1", "atom2_id": "///R/114/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 850, "atom1_serNum": 9092, "atom2_serNum": 9203, "donAcc_type": "standard", "distance": 3.500, "atom1_id": "///R/108/O6", "atom2_id": "///R/113/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 851, "atom1_serNum": 9093, "atom2_serNum": 9201, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///R/108/N1", "atom2_id": "///R/113/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 852, "atom1_serNum": 9095, "atom2_serNum": 9200, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///R/108/N2", "atom2_id": "///R/113/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 853, "atom1_serNum": 9108, "atom2_serNum": 9155, "donAcc_type": "acceptable", "distance": 2.938, "atom1_id": "///R/109/O2'", "atom2_id": "///R/111/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 854, "atom1_serNum": 9108, "atom2_serNum": 9158, "donAcc_type": "acceptable", "distance": 2.967, "atom1_id": "///R/109/O2'", "atom2_id": "///R/111/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 855, "atom1_serNum": 9116, "atom2_serNum": 9166, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///R/109/N1", "atom2_id": "///R/112/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 856, "atom1_serNum": 9118, "atom2_serNum": 9166, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///R/109/N2", "atom2_id": "///R/112/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 857, "atom1_serNum": 9118, "atom2_serNum": 9178, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///R/109/N2", "atom2_id": "///R/112/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 858, "atom1_serNum": 9151, "atom2_serNum": 9170, "donAcc_type": "acceptable", "distance": 3.086, "atom1_id": "///R/111/O2'", "atom2_id": "///R/112/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 859, "atom1_serNum": 9216, "atom2_serNum": 9227, "donAcc_type": "acceptable", "distance": 2.567, "atom1_id": "///R/114/O2'", "atom2_id": "///R/115/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 860, "atom1_serNum": 9696, "atom2_serNum": 9707, "donAcc_type": "acceptable", "distance": 2.481, "atom1_id": "///R/136/O2'", "atom2_id": "///R/137/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 861, "atom1_serNum": 9838, "atom2_serNum": 10785, "donAcc_type": "questionable", "distance": 3.016, "atom1_id": "///H/0/O5'", "atom2_id": "///S/33/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 862, "atom1_serNum": 9841, "atom2_serNum": 9888, "donAcc_type": "questionable", "distance": 3.034, "atom1_id": "///H/0/O4'", "atom2_id": "///H/2/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 863, "atom1_serNum": 9845, "atom2_serNum": 10786, "donAcc_type": "acceptable", "distance": 3.117, "atom1_id": "///H/0/O2'", "atom2_id": "///S/33/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 864, "atom1_serNum": 9854, "atom2_serNum": 11286, "donAcc_type": "acceptable", "distance": 2.822, "atom1_id": "///H/0/N1", "atom2_id": "///S/57/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 865, "atom1_serNum": 9856, "atom2_serNum": 11296, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///H/0/N3", "atom2_id": "///S/57/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 866, "atom1_serNum": 9860, "atom2_serNum": 10763, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///H/1/OP1", "atom2_id": "///S/32/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 867, "atom1_serNum": 9860, "atom2_serNum": 10786, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///H/1/OP1", "atom2_id": "///S/33/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 868, "atom1_serNum": 9860, "atom2_serNum": 10788, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///H/1/OP1", "atom2_id": "///S/33/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 869, "atom1_serNum": 9861, "atom2_serNum": 11296, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///H/1/OP2", "atom2_id": "///S/57/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 870, "atom1_serNum": 9861, "atom2_serNum": 16067, "donAcc_type": "acceptable", "distance": 2.553, "atom1_id": "///H/1/OP2", "atom2_id": "///H/5004/O1", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 871, "atom1_serNum": 9862, "atom2_serNum": 16068, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///H/1/O5'", "atom2_id": "///H/5004/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 872, "atom1_serNum": 9869, "atom2_serNum": 10714, "donAcc_type": "acceptable", "distance": 2.579, "atom1_id": "///H/1/O2'", "atom2_id": "///S/30/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 873, "atom1_serNum": 9873, "atom2_serNum": 11022, "donAcc_type": "standard", "distance": 3.826, "atom1_id": "///H/1/N7", "atom2_id": "///S/44/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 874, "atom1_serNum": 9877, "atom2_serNum": 16072, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///H/1/N1", "atom2_id": "///H/5004/O6", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 875, "atom1_serNum": 9877, "atom2_serNum": 16075, "donAcc_type": "acceptable", "distance": 2.862, "atom1_id": "///H/1/N1", "atom2_id": "///H/5004/OP2", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 876, "atom1_serNum": 9884, "atom2_serNum": 10702, "donAcc_type": "questionable", "distance": 3.307, "atom1_id": "///H/2/OP2", "atom2_id": "///S/30/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 877, "atom1_serNum": 9896, "atom2_serNum": 11273, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///H/2/O2", "atom2_id": "///S/56/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 878, "atom1_serNum": 9897, "atom2_serNum": 11271, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///H/2/N3", "atom2_id": "///S/56/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 879, "atom1_serNum": 9899, "atom2_serNum": 11270, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///H/2/N4", "atom2_id": "///S/56/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 880, "atom1_serNum": 9899, "atom2_serNum": 16071, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///H/2/N4", "atom2_id": "///H/5004/O5", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 881, "atom1_serNum": 9919, "atom2_serNum": 11250, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///H/3/O6", "atom2_id": "///S/55/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 882, "atom1_serNum": 9920, "atom2_serNum": 11248, "donAcc_type": "standard", "distance": 2.841, "atom1_id": "///H/3/N1", "atom2_id": "///S/55/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 883, "atom1_serNum": 9922, "atom2_serNum": 11247, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///H/3/N2", "atom2_id": "///S/55/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 884, "atom1_serNum": 9939, "atom2_serNum": 11230, "donAcc_type": "standard", "distance": 2.628, "atom1_id": "///H/4/O2", "atom2_id": "///S/54/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 885, "atom1_serNum": 9940, "atom2_serNum": 11228, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///H/4/N3", "atom2_id": "///S/54/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 886, "atom1_serNum": 9942, "atom2_serNum": 11227, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///H/4/N4", "atom2_id": "///S/54/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 887, "atom1_serNum": 9955, "atom2_serNum": 9967, "donAcc_type": "acceptable", "distance": 2.999, "atom1_id": "///H/5/O2'", "atom2_id": "///H/6/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 888, "atom1_serNum": 9955, "atom2_serNum": 10653, "donAcc_type": "acceptable", "distance": 3.118, "atom1_id": "///H/5/O2'", "atom2_id": "///S/27/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 889, "atom1_serNum": 9959, "atom2_serNum": 11207, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///H/5/O2", "atom2_id": "///S/53/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 890, "atom1_serNum": 9960, "atom2_serNum": 11205, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///H/5/N3", "atom2_id": "///S/53/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 891, "atom1_serNum": 9962, "atom2_serNum": 11204, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///H/5/N4", "atom2_id": "///S/53/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 892, "atom1_serNum": 9994, "atom2_serNum": 10655, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///H/7/O6", "atom2_id": "///S/27/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 893, "atom1_serNum": 9994, "atom2_serNum": 11184, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///H/7/O6", "atom2_id": "///S/52/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 894, "atom1_serNum": 9995, "atom2_serNum": 11182, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///H/7/N1", "atom2_id": "///S/52/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 895, "atom1_serNum": 9997, "atom2_serNum": 11181, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///H/7/N2", "atom2_id": "///S/52/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 896, "atom1_serNum": 10010, "atom2_serNum": 11144, "donAcc_type": "acceptable", "distance": 2.369, "atom1_id": "///H/8/O2'", "atom2_id": "///S/50/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 897, "atom1_serNum": 10017, "atom2_serNum": 10632, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///H/8/N6", "atom2_id": "///S/26/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 898, "atom1_serNum": 10018, "atom2_serNum": 10630, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///H/8/N1", "atom2_id": "///S/26/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 899, "atom1_serNum": 10020, "atom2_serNum": 11142, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///H/8/N3", "atom2_id": "///S/50/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 900, "atom1_serNum": 10039, "atom2_serNum": 10589, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///H/9/N6", "atom2_id": "///S/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 901, "atom1_serNum": 10039, "atom2_serNum": 10612, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///H/9/N6", "atom2_id": "///S/25/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 902, "atom1_serNum": 10040, "atom2_serNum": 10610, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///H/9/N1", "atom2_id": "///S/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 903, "atom1_serNum": 10054, "atom2_serNum": 12446, "donAcc_type": "acceptable", "distance": 2.603, "atom1_id": "///H/10/O2'", "atom2_id": "///S/112/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 904, "atom1_serNum": 10058, "atom2_serNum": 10592, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///H/10/O2", "atom2_id": "///S/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 905, "atom1_serNum": 10059, "atom2_serNum": 10590, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///H/10/N3", "atom2_id": "///S/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 906, "atom1_serNum": 10061, "atom2_serNum": 10589, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///H/10/N4", "atom2_id": "///S/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 907, "atom1_serNum": 10070, "atom2_serNum": 12442, "donAcc_type": "questionable", "distance": 3.198, "atom1_id": "///H/11/O4'", "atom2_id": "///S/112/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 908, "atom1_serNum": 10072, "atom2_serNum": 10091, "donAcc_type": "acceptable", "distance": 2.591, "atom1_id": "///H/11/O3'", "atom2_id": "///S/12/O1B", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 909, "atom1_serNum": 10072, "atom2_serNum": 12423, "donAcc_type": "acceptable", "distance": 3.040, "atom1_id": "///H/11/O3'", "atom2_id": "///S/111/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 910, "atom1_serNum": 10074, "atom2_serNum": 12423, "donAcc_type": "acceptable", "distance": 3.200, "atom1_id": "///H/11/O2'", "atom2_id": "///S/111/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 911, "atom1_serNum": 10074, "atom2_serNum": 12434, "donAcc_type": "acceptable", "distance": 2.708, "atom1_id": "///H/11/O2'", "atom2_id": "///S/111/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 912, "atom1_serNum": 10078, "atom2_serNum": 12433, "donAcc_type": "standard", "distance": 2.683, "atom1_id": "///H/11/O2", "atom2_id": "///S/111/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 913, "atom1_serNum": 10079, "atom2_serNum": 10568, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///H/11/N3", "atom2_id": "///S/23/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 914, "atom1_serNum": 10081, "atom2_serNum": 10567, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///H/11/O4", "atom2_id": "///S/23/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 915, "atom1_serNum": 10087, "atom2_serNum": 10096, "donAcc_type": "acceptable", "distance": 3.014, "atom1_id": "///S/12/O2G", "atom2_id": "///S/12/O2A", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 916, "atom1_serNum": 10088, "atom2_serNum": 10092, "donAcc_type": "acceptable", "distance": 2.998, "atom1_id": "///S/12/O3G", "atom2_id": "///S/12/O2B", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 917, "atom1_serNum": 10088, "atom2_serNum": 10391, "donAcc_type": "acceptable", "distance": 3.115, "atom1_id": "///S/12/O3G", "atom2_id": "///S/17/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 918, "atom1_serNum": 10111, "atom2_serNum": 10547, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///S/12/O6", "atom2_id": "///S/22/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 919, "atom1_serNum": 10112, "atom2_serNum": 10545, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///S/12/N1", "atom2_id": "///S/22/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 920, "atom1_serNum": 10114, "atom2_serNum": 10544, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///S/12/N2", "atom2_id": "///S/22/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 921, "atom1_serNum": 10137, "atom2_serNum": 10524, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///S/13/N2", "atom2_id": "///S/21/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 922, "atom1_serNum": 10141, "atom2_serNum": 15411, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///S/14/OP1", "atom2_id": "///D/22/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 923, "atom1_serNum": 10154, "atom2_serNum": 10507, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///S/14/O2", "atom2_id": "///S/20/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 924, "atom1_serNum": 10155, "atom2_serNum": 10505, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///S/14/N3", "atom2_id": "///S/20/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 925, "atom1_serNum": 10157, "atom2_serNum": 10504, "donAcc_type": "standard", "distance": 3.788, "atom1_id": "///S/14/N4", "atom2_id": "///S/20/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 926, "atom1_serNum": 10177, "atom2_serNum": 10482, "donAcc_type": "questionable", "distance": 3.259, "atom1_id": "///S/15/N6", "atom2_id": "///S/19/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 927, "atom1_serNum": 10178, "atom2_serNum": 10481, "donAcc_type": "questionable", "distance": 3.382, "atom1_id": "///S/15/N1", "atom2_id": "///S/19/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 928, "atom1_serNum": 10196, "atom2_serNum": 10464, "donAcc_type": "standard", "distance": 3.503, "atom1_id": "///S/16/O2", "atom2_id": "///S/18/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 929, "atom1_serNum": 10197, "atom2_serNum": 10462, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///S/16/N3", "atom2_id": "///S/18/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 930, "atom1_serNum": 10199, "atom2_serNum": 10461, "donAcc_type": "standard", "distance": 2.586, "atom1_id": "///S/16/N4", "atom2_id": "///S/18/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 931, "atom1_serNum": 10216, "atom2_serNum": 10441, "donAcc_type": "standard", "distance": 2.665, "atom1_id": "///S/17/O2", "atom2_id": "///S/17/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 932, "atom1_serNum": 10217, "atom2_serNum": 10439, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///S/17/N3", "atom2_id": "///S/17/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 933, "atom1_serNum": 10219, "atom2_serNum": 10438, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///S/17/N4", "atom2_id": "///S/17/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 934, "atom1_serNum": 10240, "atom2_serNum": 15657, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///S/17/N1", "atom2_id": "///D/52/NH1", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 935, "atom1_serNum": 10258, "atom2_serNum": 10304, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///S/17/O2", "atom2_id": "///S/17/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 936, "atom1_serNum": 10259, "atom2_serNum": 15387, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///S/17/N3", "atom2_id": "///D/19/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 937, "atom1_serNum": 10278, "atom2_serNum": 15905, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///S/17/O2", "atom2_id": "///D/83/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 938, "atom1_serNum": 10279, "atom2_serNum": 15362, "donAcc_type": "standard", "distance": 2.911, "atom1_id": "///S/17/N3", "atom2_id": "///D/16/OD1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 939, "atom1_serNum": 10281, "atom2_serNum": 15879, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///S/17/O4", "atom2_id": "///D/80/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 940, "atom1_serNum": 10294, "atom2_serNum": 15634, "donAcc_type": "acceptable", "distance": 2.715, "atom1_id": "///S/17/O2'", "atom2_id": "///D/50/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 941, "atom1_serNum": 10298, "atom2_serNum": 15339, "donAcc_type": "acceptable", "distance": 3.092, "atom1_id": "///S/17/N7", "atom2_id": "///D/13/OH", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 942, "atom1_serNum": 10301, "atom2_serNum": 15356, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///S/17/O6", "atom2_id": "///D/16/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 943, "atom1_serNum": 10302, "atom2_serNum": 15651, "donAcc_type": "standard", "distance": 3.278, "atom1_id": "///S/17/N1", "atom2_id": "///D/52/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 944, "atom1_serNum": 10304, "atom2_serNum": 15388, "donAcc_type": "standard", "distance": 2.630, "atom1_id": "///S/17/N2", "atom2_id": "///D/19/OE2", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 945, "atom1_serNum": 10317, "atom2_serNum": 10329, "donAcc_type": "acceptable", "distance": 2.974, "atom1_id": "///S/17/O2'", "atom2_id": "///S/17/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 946, "atom1_serNum": 10324, "atom2_serNum": 15926, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///S/17/N4", "atom2_id": "///D/86/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 947, "atom1_serNum": 10344, "atom2_serNum": 15948, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///S/17/N6", "atom2_id": "///D/89/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 948, "atom1_serNum": 10344, "atom2_serNum": 15965, "donAcc_type": "acceptable", "distance": 3.031, "atom1_id": "///S/17/N6", "atom2_id": "///D/91/OG", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 949, "atom1_serNum": 10345, "atom2_serNum": 15965, "donAcc_type": "acceptable", "distance": 2.635, "atom1_id": "///S/17/N1", "atom2_id": "///D/91/OG", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 950, "atom1_serNum": 10363, "atom2_serNum": 15966, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///S/17/O2", "atom2_id": "///D/92/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 951, "atom1_serNum": 10364, "atom2_serNum": 15966, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///S/17/N3", "atom2_id": "///D/92/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 952, "atom1_serNum": 10366, "atom2_serNum": 15950, "donAcc_type": "acceptable", "distance": 3.990, "atom1_id": "///S/17/N4", "atom2_id": "///D/89/OG1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 953, "atom1_serNum": 10366, "atom2_serNum": 15955, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///S/17/N4", "atom2_id": "///D/90/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 954, "atom1_serNum": 10379, "atom2_serNum": 10387, "donAcc_type": "acceptable", "distance": 3.343, "atom1_id": "///S/17/O2'", "atom2_id": "///S/17/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 955, "atom1_serNum": 10402, "atom2_serNum": 15605, "donAcc_type": "acceptable", "distance": 3.151, "atom1_id": "///S/17/OP1", "atom2_id": "///D/46/OG", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 956, "atom1_serNum": 10422, "atom2_serNum": 15623, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///S/17/OP1", "atom2_id": "///D/49/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 957, "atom1_serNum": 10435, "atom2_serNum": 15658, "donAcc_type": "standard", "distance": 3.329, "atom1_id": "///S/17/N7", "atom2_id": "///D/52/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 958, "atom1_serNum": 10582, "atom2_serNum": 12454, "donAcc_type": "acceptable", "distance": 2.531, "atom1_id": "///S/24/O2'", "atom2_id": "///S/112/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 959, "atom1_serNum": 10592, "atom2_serNum": 12456, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///S/24/N2", "atom2_id": "///S/112/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 960, "atom1_serNum": 10603, "atom2_serNum": 12468, "donAcc_type": "acceptable", "distance": 3.157, "atom1_id": "///S/25/O3'", "atom2_id": "///S/113/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 961, "atom1_serNum": 10605, "atom2_serNum": 12468, "donAcc_type": "acceptable", "distance": 2.589, "atom1_id": "///S/25/O2'", "atom2_id": "///S/113/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 962, "atom1_serNum": 10645, "atom2_serNum": 11184, "donAcc_type": "acceptable", "distance": 2.929, "atom1_id": "///S/27/O2'", "atom2_id": "///S/52/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 963, "atom1_serNum": 10656, "atom2_serNum": 11184, "donAcc_type": "standard", "distance": 3.836, "atom1_id": "///S/27/N3", "atom2_id": "///S/52/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 964, "atom1_serNum": 10675, "atom2_serNum": 16075, "donAcc_type": "acceptable", "distance": 3.111, "atom1_id": "///S/28/N6", "atom2_id": "///H/5004/OP2", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 965, "atom1_serNum": 10678, "atom2_serNum": 10697, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///S/28/N3", "atom2_id": "///S/29/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 966, "atom1_serNum": 10682, "atom2_serNum": 10702, "donAcc_type": "questionable", "distance": 2.451, "atom1_id": "///S/29/OP2", "atom2_id": "///S/30/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 967, "atom1_serNum": 10686, "atom2_serNum": 12189, "donAcc_type": "acceptable", "distance": 3.353, "atom1_id": "///S/29/O4'", "atom2_id": "///S/100/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 968, "atom1_serNum": 10688, "atom2_serNum": 12167, "donAcc_type": "acceptable", "distance": 2.567, "atom1_id": "///S/29/O3'", "atom2_id": "///S/99/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 969, "atom1_serNum": 10690, "atom2_serNum": 12167, "donAcc_type": "acceptable", "distance": 2.738, "atom1_id": "///S/29/O2'", "atom2_id": "///S/99/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 970, "atom1_serNum": 10690, "atom2_serNum": 12177, "donAcc_type": "acceptable", "distance": 2.701, "atom1_id": "///S/29/O2'", "atom2_id": "///S/99/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 971, "atom1_serNum": 10690, "atom2_serNum": 12185, "donAcc_type": "acceptable", "distance": 3.041, "atom1_id": "///S/29/O2'", "atom2_id": "///S/100/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 972, "atom1_serNum": 10694, "atom2_serNum": 11045, "donAcc_type": "standard", "distance": 2.803, "atom1_id": "///S/29/O2", "atom2_id": "///S/45/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 973, "atom1_serNum": 10695, "atom2_serNum": 11043, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///S/29/N3", "atom2_id": "///S/45/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 974, "atom1_serNum": 10697, "atom2_serNum": 11042, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///S/29/N4", "atom2_id": "///S/45/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 975, "atom1_serNum": 10706, "atom2_serNum": 12167, "donAcc_type": "acceptable", "distance": 3.475, "atom1_id": "///S/30/O4'", "atom2_id": "///S/99/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 976, "atom1_serNum": 10710, "atom2_serNum": 12145, "donAcc_type": "acceptable", "distance": 2.950, "atom1_id": "///S/30/O2'", "atom2_id": "///S/98/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 977, "atom1_serNum": 10710, "atom2_serNum": 12155, "donAcc_type": "acceptable", "distance": 2.906, "atom1_id": "///S/30/O2'", "atom2_id": "///S/98/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 978, "atom1_serNum": 10710, "atom2_serNum": 12163, "donAcc_type": "acceptable", "distance": 3.442, "atom1_id": "///S/30/O2'", "atom2_id": "///S/99/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 979, "atom1_serNum": 10717, "atom2_serNum": 11022, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///S/30/O6", "atom2_id": "///S/44/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 980, "atom1_serNum": 10718, "atom2_serNum": 11020, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///S/30/N1", "atom2_id": "///S/44/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 981, "atom1_serNum": 10720, "atom2_serNum": 11019, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///S/30/N2", "atom2_id": "///S/44/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 982, "atom1_serNum": 10720, "atom2_serNum": 12689, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///S/30/N2", "atom2_id": "///S/123/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 983, "atom1_serNum": 10729, "atom2_serNum": 12688, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///S/31/O4'", "atom2_id": "///S/123/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 984, "atom1_serNum": 10733, "atom2_serNum": 12711, "donAcc_type": "acceptable", "distance": 3.278, "atom1_id": "///S/31/O2'", "atom2_id": "///S/124/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 985, "atom1_serNum": 10733, "atom2_serNum": 12733, "donAcc_type": "acceptable", "distance": 3.189, "atom1_id": "///S/31/O2'", "atom2_id": "///S/125/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 986, "atom1_serNum": 10740, "atom2_serNum": 11002, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///S/31/N6", "atom2_id": "///S/43/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 987, "atom1_serNum": 10741, "atom2_serNum": 11000, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///S/31/N1", "atom2_id": "///S/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 988, "atom1_serNum": 10755, "atom2_serNum": 10774, "donAcc_type": "acceptable", "distance": 2.883, "atom1_id": "///S/32/O2'", "atom2_id": "///S/33/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 989, "atom1_serNum": 10778, "atom2_serNum": 11329, "donAcc_type": "acceptable", "distance": 3.134, "atom1_id": "///S/33/O2'", "atom2_id": "///S/59/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 990, "atom1_serNum": 10778, "atom2_serNum": 11331, "donAcc_type": "acceptable", "distance": 2.488, "atom1_id": "///S/33/O2'", "atom2_id": "///S/59/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 991, "atom1_serNum": 10789, "atom2_serNum": 11331, "donAcc_type": "acceptable", "distance": 2.656, "atom1_id": "///S/33/N3", "atom2_id": "///S/59/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 992, "atom1_serNum": 10797, "atom2_serNum": 11327, "donAcc_type": "questionable", "distance": 2.938, "atom1_id": "///S/34/O4'", "atom2_id": "///S/59/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 993, "atom1_serNum": 10813, "atom2_serNum": 11853, "donAcc_type": "acceptable", "distance": 3.192, "atom1_id": "///S/35/OP2", "atom2_id": "///S/84/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 994, "atom1_serNum": 10828, "atom2_serNum": 11463, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///S/35/O6", "atom2_id": "///S/65/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 995, "atom1_serNum": 10829, "atom2_serNum": 11461, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///S/35/N1", "atom2_id": "///S/65/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 996, "atom1_serNum": 10831, "atom2_serNum": 11460, "donAcc_type": "standard", "distance": 3.601, "atom1_id": "///S/35/N2", "atom2_id": "///S/65/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 997, "atom1_serNum": 10851, "atom2_serNum": 11443, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///S/36/O6", "atom2_id": "///S/64/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 998, "atom1_serNum": 10852, "atom2_serNum": 11440, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///S/36/N1", "atom2_id": "///S/64/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 999, "atom1_serNum": 10852, "atom2_serNum": 11441, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///S/36/N1", "atom2_id": "///S/64/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1000, "atom1_serNum": 10854, "atom2_serNum": 11440, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///S/36/N2", "atom2_id": "///S/64/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1001, "atom1_serNum": 10874, "atom2_serNum": 11421, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///S/37/O6", "atom2_id": "///S/63/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1002, "atom1_serNum": 10875, "atom2_serNum": 11420, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///S/37/N1", "atom2_id": "///S/63/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1003, "atom1_serNum": 10897, "atom2_serNum": 11381, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///S/38/O6", "atom2_id": "///S/61/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1004, "atom1_serNum": 10897, "atom2_serNum": 11403, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///S/38/O6", "atom2_id": "///S/62/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1005, "atom1_serNum": 10898, "atom2_serNum": 11401, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///S/38/N1", "atom2_id": "///S/62/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1006, "atom1_serNum": 10900, "atom2_serNum": 11400, "donAcc_type": "standard", "distance": 2.854, "atom1_id": "///S/38/N2", "atom2_id": "///S/62/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1007, "atom1_serNum": 10900, "atom2_serNum": 11401, "donAcc_type": "standard", "distance": 3.237, "atom1_id": "///S/38/N2", "atom2_id": "///S/62/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1008, "atom1_serNum": 10918, "atom2_serNum": 11382, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///S/39/N3", "atom2_id": "///S/61/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1009, "atom1_serNum": 10920, "atom2_serNum": 11381, "donAcc_type": "standard", "distance": 3.410, "atom1_id": "///S/39/O4", "atom2_id": "///S/61/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1010, "atom1_serNum": 10937, "atom2_serNum": 11359, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///S/40/O2", "atom2_id": "///S/60/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1011, "atom1_serNum": 10938, "atom2_serNum": 11358, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///S/40/N3", "atom2_id": "///S/60/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1012, "atom1_serNum": 10953, "atom2_serNum": 10957, "donAcc_type": "acceptable", "distance": 2.630, "atom1_id": "///S/41/O2'", "atom2_id": "///S/41/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1013, "atom1_serNum": 10973, "atom2_serNum": 16070, "donAcc_type": "acceptable", "distance": 3.062, "atom1_id": "///S/42/O2'", "atom2_id": "///H/5004/O4", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 1014, "atom1_serNum": 10980, "atom2_serNum": 11323, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///S/42/N6", "atom2_id": "///S/59/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1015, "atom1_serNum": 10987, "atom2_serNum": 16069, "donAcc_type": "acceptable", "distance": 3.221, "atom1_id": "///S/43/OP2", "atom2_id": "///H/5004/O3", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 1016, "atom1_serNum": 10991, "atom2_serNum": 11351, "donAcc_type": "acceptable", "distance": 3.523, "atom1_id": "///S/43/O4'", "atom2_id": "///S/60/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1017, "atom1_serNum": 11002, "atom2_serNum": 16068, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///S/43/O4", "atom2_id": "///H/5004/N2", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 1018, "atom1_serNum": 11013, "atom2_serNum": 12703, "donAcc_type": "acceptable", "distance": 2.570, "atom1_id": "///S/44/O3'", "atom2_id": "///S/124/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1019, "atom1_serNum": 11015, "atom2_serNum": 12703, "donAcc_type": "acceptable", "distance": 2.924, "atom1_id": "///S/44/O2'", "atom2_id": "///S/124/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1020, "atom1_serNum": 11015, "atom2_serNum": 12713, "donAcc_type": "acceptable", "distance": 2.591, "atom1_id": "///S/44/O2'", "atom2_id": "///S/124/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1021, "atom1_serNum": 11015, "atom2_serNum": 12721, "donAcc_type": "acceptable", "distance": 3.089, "atom1_id": "///S/44/O2'", "atom2_id": "///S/125/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1022, "atom1_serNum": 11031, "atom2_serNum": 12703, "donAcc_type": "acceptable", "distance": 3.445, "atom1_id": "///S/45/O4'", "atom2_id": "///S/124/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1023, "atom1_serNum": 11035, "atom2_serNum": 12681, "donAcc_type": "acceptable", "distance": 2.771, "atom1_id": "///S/45/O2'", "atom2_id": "///S/123/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1024, "atom1_serNum": 11035, "atom2_serNum": 12691, "donAcc_type": "acceptable", "distance": 2.633, "atom1_id": "///S/45/O2'", "atom2_id": "///S/123/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1025, "atom1_serNum": 11035, "atom2_serNum": 12699, "donAcc_type": "acceptable", "distance": 3.275, "atom1_id": "///S/45/O2'", "atom2_id": "///S/124/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1026, "atom1_serNum": 11045, "atom2_serNum": 12153, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///S/45/N2", "atom2_id": "///S/98/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1027, "atom1_serNum": 11054, "atom2_serNum": 12152, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///S/46/O4'", "atom2_id": "///S/98/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1028, "atom1_serNum": 11058, "atom2_serNum": 12174, "donAcc_type": "acceptable", "distance": 3.346, "atom1_id": "///S/46/O2'", "atom2_id": "///S/99/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1029, "atom1_serNum": 11058, "atom2_serNum": 12197, "donAcc_type": "acceptable", "distance": 2.680, "atom1_id": "///S/46/O2'", "atom2_id": "///S/100/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1030, "atom1_serNum": 11065, "atom2_serNum": 11161, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///S/46/N6", "atom2_id": "///S/51/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1031, "atom1_serNum": 11066, "atom2_serNum": 11162, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///S/46/N1", "atom2_id": "///S/51/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1032, "atom1_serNum": 11080, "atom2_serNum": 12211, "donAcc_type": "acceptable", "distance": 2.710, "atom1_id": "///S/47/O2'", "atom2_id": "///S/101/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1033, "atom1_serNum": 11090, "atom2_serNum": 11157, "donAcc_type": "acceptable", "distance": 2.865, "atom1_id": "///S/47/N2", "atom2_id": "///S/51/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1034, "atom1_serNum": 11133, "atom2_serNum": 11173, "donAcc_type": "questionable", "distance": 2.678, "atom1_id": "///S/50/O4'", "atom2_id": "///S/52/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1035, "atom1_serNum": 11137, "atom2_serNum": 11141, "donAcc_type": "acceptable", "distance": 2.802, "atom1_id": "///S/50/O2'", "atom2_id": "///S/50/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1036, "atom1_serNum": 11250, "atom2_serNum": 16076, "donAcc_type": "acceptable", "distance": 3.968, "atom1_id": "///S/55/N4", "atom2_id": "///H/5004/OP3", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 1037, "atom1_serNum": 11294, "atom2_serNum": 16067, "donAcc_type": "acceptable", "distance": 3.153, "atom1_id": "///S/57/N1", "atom2_id": "///H/5004/O1", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 1038, "atom1_serNum": 11480, "atom2_serNum": 11863, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///S/66/O2", "atom2_id": "///S/84/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1039, "atom1_serNum": 11481, "atom2_serNum": 11861, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///S/66/N3", "atom2_id": "///S/84/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1040, "atom1_serNum": 11483, "atom2_serNum": 11860, "donAcc_type": "standard", "distance": 3.408, "atom1_id": "///S/66/N4", "atom2_id": "///S/84/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1041, "atom1_serNum": 11503, "atom2_serNum": 11840, "donAcc_type": "standard", "distance": 3.292, "atom1_id": "///S/67/O6", "atom2_id": "///S/83/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1042, "atom1_serNum": 11504, "atom2_serNum": 11838, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///S/67/N1", "atom2_id": "///S/83/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1043, "atom1_serNum": 11506, "atom2_serNum": 11837, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///S/67/N2", "atom2_id": "///S/83/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1044, "atom1_serNum": 11519, "atom2_serNum": 11926, "donAcc_type": "acceptable", "distance": 2.599, "atom1_id": "///S/68/O2'", "atom2_id": "///S/87/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1045, "atom1_serNum": 11526, "atom2_serNum": 11820, "donAcc_type": "standard", "distance": 3.742, "atom1_id": "///S/68/O6", "atom2_id": "///S/82/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1046, "atom1_serNum": 11527, "atom2_serNum": 11818, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///S/68/N1", "atom2_id": "///S/82/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1047, "atom1_serNum": 11529, "atom2_serNum": 11817, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///S/68/N2", "atom2_id": "///S/82/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1048, "atom1_serNum": 11529, "atom2_serNum": 11928, "donAcc_type": "standard", "distance": 3.657, "atom1_id": "///S/68/N2", "atom2_id": "///S/87/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1049, "atom1_serNum": 11549, "atom2_serNum": 11798, "donAcc_type": "standard", "distance": 3.374, "atom1_id": "///S/69/O4", "atom2_id": "///S/81/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1050, "atom1_serNum": 11562, "atom2_serNum": 12952, "donAcc_type": "acceptable", "distance": 3.122, "atom1_id": "///S/70/O2'", "atom2_id": "///S/135/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1051, "atom1_serNum": 11562, "atom2_serNum": 12953, "donAcc_type": "acceptable", "distance": 3.338, "atom1_id": "///S/70/O2'", "atom2_id": "///S/135/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1052, "atom1_serNum": 11566, "atom2_serNum": 12955, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///S/70/O2", "atom2_id": "///S/135/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1053, "atom1_serNum": 11567, "atom2_serNum": 11777, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///S/70/N3", "atom2_id": "///S/80/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1054, "atom1_serNum": 11569, "atom2_serNum": 11776, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///S/70/O4", "atom2_id": "///S/80/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1055, "atom1_serNum": 11573, "atom2_serNum": 11601, "donAcc_type": "questionable", "distance": 3.335, "atom1_id": "///S/71/OP1", "atom2_id": "///S/72/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1056, "atom1_serNum": 11582, "atom2_serNum": 12961, "donAcc_type": "acceptable", "distance": 3.447, "atom1_id": "///S/71/O2'", "atom2_id": "///S/136/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1057, "atom1_serNum": 11589, "atom2_serNum": 11756, "donAcc_type": "standard", "distance": 3.722, "atom1_id": "///S/71/O6", "atom2_id": "///S/79/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1058, "atom1_serNum": 11590, "atom2_serNum": 11754, "donAcc_type": "standard", "distance": 3.394, "atom1_id": "///S/71/N1", "atom2_id": "///S/79/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1059, "atom1_serNum": 11592, "atom2_serNum": 11753, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///S/71/N2", "atom2_id": "///S/79/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1060, "atom1_serNum": 11605, "atom2_serNum": 11609, "donAcc_type": "acceptable", "distance": 2.972, "atom1_id": "///S/72/O2'", "atom2_id": "///S/72/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1061, "atom1_serNum": 11630, "atom2_serNum": 13084, "donAcc_type": "standard", "distance": 3.575, "atom1_id": "///S/73/N3", "atom2_id": "///S/141/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1062, "atom1_serNum": 11649, "atom2_serNum": 13063, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///S/74/O2", "atom2_id": "///S/140/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1063, "atom1_serNum": 11650, "atom2_serNum": 13063, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///S/74/N3", "atom2_id": "///S/140/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1064, "atom1_serNum": 11672, "atom2_serNum": 13018, "donAcc_type": "questionable", "distance": 3.119, "atom1_id": "///S/75/N6", "atom2_id": "///S/138/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1065, "atom1_serNum": 11672, "atom2_serNum": 13038, "donAcc_type": "questionable", "distance": 3.231, "atom1_id": "///S/75/N6", "atom2_id": "///S/139/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1066, "atom1_serNum": 11672, "atom2_serNum": 13040, "donAcc_type": "standard", "distance": 3.376, "atom1_id": "///S/75/N6", "atom2_id": "///S/139/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1067, "atom1_serNum": 11691, "atom2_serNum": 13019, "donAcc_type": "questionable", "distance": 3.153, "atom1_id": "///S/76/O2", "atom2_id": "///S/138/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1068, "atom1_serNum": 11692, "atom2_serNum": 13019, "donAcc_type": "standard", "distance": 3.396, "atom1_id": "///S/76/N3", "atom2_id": "///S/138/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1069, "atom1_serNum": 11711, "atom2_serNum": 12998, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///S/77/O2", "atom2_id": "///S/137/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1070, "atom1_serNum": 11712, "atom2_serNum": 12996, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///S/77/N3", "atom2_id": "///S/137/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1071, "atom1_serNum": 11714, "atom2_serNum": 12995, "donAcc_type": "standard", "distance": 3.512, "atom1_id": "///S/77/N4", "atom2_id": "///S/137/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1072, "atom1_serNum": 11734, "atom2_serNum": 12975, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///S/78/N6", "atom2_id": "///S/136/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1073, "atom1_serNum": 11735, "atom2_serNum": 12973, "donAcc_type": "standard", "distance": 3.489, "atom1_id": "///S/78/N1", "atom2_id": "///S/136/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1074, "atom1_serNum": 11791, "atom2_serNum": 11938, "donAcc_type": "acceptable", "distance": 2.979, "atom1_id": "///S/81/O2'", "atom2_id": "///S/88/O3'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1075, "atom1_serNum": 11791, "atom2_serNum": 11940, "donAcc_type": "acceptable", "distance": 2.633, "atom1_id": "///S/81/O2'", "atom2_id": "///S/88/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1076, "atom1_serNum": 11813, "atom2_serNum": 11918, "donAcc_type": "acceptable", "distance": 2.816, "atom1_id": "///S/82/O2'", "atom2_id": "///S/87/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1077, "atom1_serNum": 11817, "atom2_serNum": 11918, "donAcc_type": "acceptable", "distance": 3.216, "atom1_id": "///S/82/O2", "atom2_id": "///S/87/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1078, "atom1_serNum": 11833, "atom2_serNum": 11906, "donAcc_type": "acceptable", "distance": 2.664, "atom1_id": "///S/83/O2'", "atom2_id": "///S/86/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1079, "atom1_serNum": 11849, "atom2_serNum": 11906, "donAcc_type": "questionable", "distance": 3.341, "atom1_id": "///S/84/O4'", "atom2_id": "///S/86/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1080, "atom1_serNum": 11947, "atom2_serNum": 12930, "donAcc_type": "standard", "distance": 3.115, "atom1_id": "///S/88/O6", "atom2_id": "///S/134/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1081, "atom1_serNum": 11948, "atom2_serNum": 12929, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///S/88/N1", "atom2_id": "///S/134/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1082, "atom1_serNum": 11967, "atom2_serNum": 12912, "donAcc_type": "standard", "distance": 3.568, "atom1_id": "///S/89/O2", "atom2_id": "///S/133/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1083, "atom1_serNum": 11970, "atom2_serNum": 12909, "donAcc_type": "standard", "distance": 3.238, "atom1_id": "///S/89/N4", "atom2_id": "///S/133/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1084, "atom1_serNum": 11987, "atom2_serNum": 12888, "donAcc_type": "questionable", "distance": 3.321, "atom1_id": "///S/90/O2", "atom2_id": "///S/132/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1085, "atom1_serNum": 11988, "atom2_serNum": 12887, "donAcc_type": "questionable", "distance": 3.270, "atom1_id": "///S/90/N3", "atom2_id": "///S/132/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1086, "atom1_serNum": 11988, "atom2_serNum": 12888, "donAcc_type": "standard", "distance": 3.563, "atom1_id": "///S/90/N3", "atom2_id": "///S/132/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1087, "atom1_serNum": 11990, "atom2_serNum": 12887, "donAcc_type": "standard", "distance": 3.403, "atom1_id": "///S/90/O4", "atom2_id": "///S/132/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1088, "atom1_serNum": 12008, "atom2_serNum": 12866, "donAcc_type": "standard", "distance": 3.704, "atom1_id": "///S/91/N3", "atom2_id": "///S/131/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1089, "atom1_serNum": 12030, "atom2_serNum": 12843, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///S/92/O4", "atom2_id": "///S/130/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1090, "atom1_serNum": 12047, "atom2_serNum": 12821, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///S/93/O2", "atom2_id": "///S/129/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1091, "atom1_serNum": 12047, "atom2_serNum": 12823, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///S/93/O2", "atom2_id": "///S/129/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1092, "atom1_serNum": 12070, "atom2_serNum": 12800, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///S/94/N6", "atom2_id": "///S/128/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1093, "atom1_serNum": 12071, "atom2_serNum": 12798, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///S/94/N1", "atom2_id": "///S/128/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1094, "atom1_serNum": 12089, "atom2_serNum": 12780, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///S/95/O2", "atom2_id": "///S/127/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1095, "atom1_serNum": 12090, "atom2_serNum": 12778, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///S/95/N3", "atom2_id": "///S/127/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1096, "atom1_serNum": 12092, "atom2_serNum": 12777, "donAcc_type": "standard", "distance": 3.139, "atom1_id": "///S/95/N4", "atom2_id": "///S/127/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1097, "atom1_serNum": 12109, "atom2_serNum": 12755, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///S/96/O2", "atom2_id": "///S/126/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1098, "atom1_serNum": 12110, "atom2_serNum": 12754, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///S/96/N3", "atom2_id": "///S/126/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1099, "atom1_serNum": 12171, "atom2_serNum": 12668, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///S/99/N7", "atom2_id": "///S/122/N4", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1100, "atom1_serNum": 12174, "atom2_serNum": 12665, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///S/99/N6", "atom2_id": "///S/122/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1101, "atom1_serNum": 12174, "atom2_serNum": 12666, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///S/99/N6", "atom2_id": "///S/122/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1102, "atom1_serNum": 12193, "atom2_serNum": 12646, "donAcc_type": "standard", "distance": 3.311, "atom1_id": "///S/100/N7", "atom2_id": "///S/121/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1103, "atom1_serNum": 12196, "atom2_serNum": 12647, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///S/100/N6", "atom2_id": "///S/121/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1104, "atom1_serNum": 12203, "atom2_serNum": 12238, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///S/101/OP2", "atom2_id": "///S/102/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1105, "atom1_serNum": 12218, "atom2_serNum": 12624, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///S/101/O4", "atom2_id": "///S/120/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1106, "atom1_serNum": 12218, "atom2_serNum": 12626, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///S/101/O4", "atom2_id": "///S/120/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1107, "atom1_serNum": 12235, "atom2_serNum": 12603, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///S/102/O2", "atom2_id": "///S/119/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1108, "atom1_serNum": 12236, "atom2_serNum": 12601, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///S/102/N3", "atom2_id": "///S/119/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1109, "atom1_serNum": 12238, "atom2_serNum": 12600, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///S/102/N4", "atom2_id": "///S/119/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1110, "atom1_serNum": 12258, "atom2_serNum": 12580, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///S/103/N6", "atom2_id": "///S/118/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1111, "atom1_serNum": 12259, "atom2_serNum": 12578, "donAcc_type": "standard", "distance": 2.880, "atom1_id": "///S/103/N1", "atom2_id": "///S/118/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1112, "atom1_serNum": 12277, "atom2_serNum": 12558, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///S/104/O2", "atom2_id": "///S/117/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1113, "atom1_serNum": 12278, "atom2_serNum": 12557, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///S/104/N3", "atom2_id": "///S/117/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1114, "atom1_serNum": 12293, "atom2_serNum": 12306, "donAcc_type": "acceptable", "distance": 2.284, "atom1_id": "///S/105/O2'", "atom2_id": "///S/106/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1115, "atom1_serNum": 12298, "atom2_serNum": 12536, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///S/105/N3", "atom2_id": "///S/116/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1116, "atom1_serNum": 12300, "atom2_serNum": 12535, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///S/105/O4", "atom2_id": "///S/116/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1117, "atom1_serNum": 12320, "atom2_serNum": 12515, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///S/106/N6", "atom2_id": "///S/115/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1118, "atom1_serNum": 12321, "atom2_serNum": 12513, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///S/106/N1", "atom2_id": "///S/115/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1119, "atom1_serNum": 12342, "atom2_serNum": 12495, "donAcc_type": "standard", "distance": 3.401, "atom1_id": "///S/107/N6", "atom2_id": "///S/114/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1120, "atom1_serNum": 12343, "atom2_serNum": 12493, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///S/107/N1", "atom2_id": "///S/114/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1121, "atom1_serNum": 12364, "atom2_serNum": 12475, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///S/108/O6", "atom2_id": "///S/113/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1122, "atom1_serNum": 12365, "atom2_serNum": 12473, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///S/108/N1", "atom2_id": "///S/113/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1123, "atom1_serNum": 12367, "atom2_serNum": 12472, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///S/108/N2", "atom2_id": "///S/113/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1124, "atom1_serNum": 12380, "atom2_serNum": 12427, "donAcc_type": "acceptable", "distance": 3.236, "atom1_id": "///S/109/O2'", "atom2_id": "///S/111/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 1125, "atom1_serNum": 12380, "atom2_serNum": 12430, "donAcc_type": "acceptable", "distance": 3.163, "atom1_id": "///S/109/O2'", "atom2_id": "///S/111/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1126, "atom1_serNum": 12390, "atom2_serNum": 12438, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///S/109/N2", "atom2_id": "///S/112/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 1127, "atom1_serNum": 12390, "atom2_serNum": 12450, "donAcc_type": "standard", "distance": 3.368, "atom1_id": "///S/109/N2", "atom2_id": "///S/112/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1128, "atom1_serNum": 12528, "atom2_serNum": 12546, "donAcc_type": "acceptable", "distance": 2.979, "atom1_id": "///S/116/O2'", "atom2_id": "///S/117/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1129, "atom1_serNum": 12858, "atom2_serNum": 12876, "donAcc_type": "acceptable", "distance": 3.510, "atom1_id": "///S/131/O2'", "atom2_id": "///S/132/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1130, "atom1_serNum": 12930, "atom2_serNum": 12949, "donAcc_type": "standard", "distance": 3.747, "atom1_id": "///S/134/N3", "atom2_id": "///S/135/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 1131, "atom1_serNum": 12968, "atom2_serNum": 12979, "donAcc_type": "acceptable", "distance": 3.123, "atom1_id": "///S/136/O2'", "atom2_id": "///S/137/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1132, "atom1_serNum": 12968, "atom2_serNum": 12981, "donAcc_type": "acceptable", "distance": 2.660, "atom1_id": "///S/136/O2'", "atom2_id": "///S/137/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 1133, "atom1_serNum": 13107, "atom2_serNum": 13119, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///A/9/OD1", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1134, "atom1_serNum": 13108, "atom2_serNum": 13767, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/9/ND2", "atom2_id": "///A/90/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1135, "atom1_serNum": 13112, "atom2_serNum": 13512, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/10/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1136, "atom1_serNum": 13115, "atom2_serNum": 13767, "donAcc_type": "acceptable", "distance": 3.986, "atom1_id": "///A/10/ND1", "atom2_id": "///A/90/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1137, "atom1_serNum": 13122, "atom2_serNum": 13744, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/11/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1138, "atom1_serNum": 13124, "atom2_serNum": 13774, "donAcc_type": "acceptable", "distance": 2.574, "atom1_id": "///A/11/OG1", "atom2_id": "///A/91/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1139, "atom1_serNum": 13126, "atom2_serNum": 13500, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/12/N", "atom2_id": "///A/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1140, "atom1_serNum": 13129, "atom2_serNum": 13497, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/12/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1141, "atom1_serNum": 13134, "atom2_serNum": 13726, "donAcc_type": "standard", "distance": 2.576, "atom1_id": "///A/13/N", "atom2_id": "///A/85/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1142, "atom1_serNum": 13137, "atom2_serNum": 13723, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///A/13/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1143, "atom1_serNum": 13145, "atom2_serNum": 13479, "donAcc_type": "acceptable", "distance": 3.010, "atom1_id": "///A/13/OH", "atom2_id": "///A/54/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1144, "atom1_serNum": 13146, "atom2_serNum": 13484, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/14/N", "atom2_id": "///A/55/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1145, "atom1_serNum": 13149, "atom2_serNum": 13481, "donAcc_type": "standard", "distance": 2.618, "atom1_id": "///A/14/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1146, "atom1_serNum": 13154, "atom2_serNum": 13160, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/15/N", "atom2_id": "///A/15/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1147, "atom1_serNum": 13154, "atom2_serNum": 13707, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/15/N", "atom2_id": "///A/83/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1148, "atom1_serNum": 13157, "atom2_serNum": 13704, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/15/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1149, "atom1_serNum": 13162, "atom2_serNum": 13471, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///A/16/N", "atom2_id": "///A/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1150, "atom1_serNum": 13169, "atom2_serNum": 13692, "donAcc_type": "standard", "distance": 2.518, "atom1_id": "///A/16/ND2", "atom2_id": "///A/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1151, "atom1_serNum": 13170, "atom2_serNum": 13471, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/17/N", "atom2_id": "///A/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1152, "atom1_serNum": 13173, "atom2_serNum": 13186, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/17/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1153, "atom1_serNum": 13181, "atom2_serNum": 13204, "donAcc_type": "standard", "distance": 3.356, "atom1_id": "///A/18/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1154, "atom1_serNum": 13184, "atom2_serNum": 13186, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/18/OD1", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1155, "atom1_serNum": 13184, "atom2_serNum": 13195, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///A/18/OD1", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1156, "atom1_serNum": 13185, "atom2_serNum": 13663, "donAcc_type": "standard", "distance": 3.516, "atom1_id": "///A/18/ND2", "atom2_id": "///A/78/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1157, "atom1_serNum": 13189, "atom2_serNum": 13425, "donAcc_type": "standard", "distance": 3.540, "atom1_id": "///A/19/O", "atom2_id": "///A/47/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1158, "atom1_serNum": 13215, "atom2_serNum": 13247, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///A/22/O", "atom2_id": "///A/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1159, "atom1_serNum": 13224, "atom2_serNum": 13255, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/23/O", "atom2_id": "///A/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1160, "atom1_serNum": 13233, "atom2_serNum": 13264, "donAcc_type": "standard", "distance": 3.161, "atom1_id": "///A/24/O", "atom2_id": "///A/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1161, "atom1_serNum": 13241, "atom2_serNum": 13273, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/25/O", "atom2_id": "///A/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1162, "atom1_serNum": 13246, "atom2_serNum": 13671, "donAcc_type": "acceptable", "distance": 2.891, "atom1_id": "///A/25/OE2", "atom2_id": "///A/78/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1163, "atom1_serNum": 13250, "atom2_serNum": 13279, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/26/O", "atom2_id": "///A/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1164, "atom1_serNum": 13258, "atom2_serNum": 13287, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/27/O", "atom2_id": "///A/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1165, "atom1_serNum": 13263, "atom2_serNum": 13384, "donAcc_type": "standard", "distance": 3.891, "atom1_id": "///A/27/NZ", "atom2_id": "///A/42/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1166, "atom1_serNum": 13263, "atom2_serNum": 13389, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///A/27/NZ", "atom2_id": "///A/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1167, "atom1_serNum": 13267, "atom2_serNum": 13297, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///A/28/O", "atom2_id": "///A/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1168, "atom1_serNum": 13276, "atom2_serNum": 13302, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///A/29/O", "atom2_id": "///A/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1169, "atom1_serNum": 13278, "atom2_serNum": 13671, "donAcc_type": "acceptable", "distance": 2.562, "atom1_id": "///A/29/OG", "atom2_id": "///A/78/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1170, "atom1_serNum": 13278, "atom2_serNum": 14011, "donAcc_type": "acceptable", "distance": 3.608, "atom1_id": "///A/29/OG", "atom2_id": "///B/29/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1171, "atom1_serNum": 13282, "atom2_serNum": 13310, "donAcc_type": "standard", "distance": 2.953, "atom1_id": "///A/30/O", "atom2_id": "///A/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1172, "atom1_serNum": 13290, "atom2_serNum": 13321, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/31/O", "atom2_id": "///A/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1173, "atom1_serNum": 13290, "atom2_serNum": 13326, "donAcc_type": "acceptable", "distance": 2.941, "atom1_id": "///A/31/O", "atom2_id": "///A/35/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1174, "atom1_serNum": 13300, "atom2_serNum": 14393, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///A/32/O", "atom2_id": "///B/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1175, "atom1_serNum": 13313, "atom2_serNum": 13338, "donAcc_type": "standard", "distance": 3.389, "atom1_id": "///A/34/O", "atom2_id": "///A/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1176, "atom1_serNum": 13326, "atom2_serNum": 14411, "donAcc_type": "acceptable", "distance": 2.801, "atom1_id": "///A/35/OG", "atom2_id": "///B/79/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1177, "atom1_serNum": 13341, "atom2_serNum": 13559, "donAcc_type": "acceptable", "distance": 3.046, "atom1_id": "///A/37/O", "atom2_id": "///A/64/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1178, "atom1_serNum": 13356, "atom2_serNum": 13523, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///A/39/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1179, "atom1_serNum": 13370, "atom2_serNum": 13507, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///A/41/N", "atom2_id": "///A/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1180, "atom1_serNum": 13381, "atom2_serNum": 13504, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/42/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1181, "atom1_serNum": 13384, "atom2_serNum": 13386, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/42/OD1", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1182, "atom1_serNum": 13394, "atom2_serNum": 13489, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/44/N", "atom2_id": "///A/56/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1183, "atom1_serNum": 13397, "atom2_serNum": 13486, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/44/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1184, "atom1_serNum": 13414, "atom2_serNum": 13426, "donAcc_type": "acceptable", "distance": 3.563, "atom1_id": "///A/46/OG", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1185, "atom1_serNum": 13418, "atom2_serNum": 13467, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///A/47/O", "atom2_id": "///A/52/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1186, "atom1_serNum": 13429, "atom2_serNum": 13457, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/48/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1187, "atom1_serNum": 13429, "atom2_serNum": 13464, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/48/O", "atom2_id": "///A/52/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1188, "atom1_serNum": 13431, "atom2_serNum": 13449, "donAcc_type": "acceptable", "distance": 3.278, "atom1_id": "///A/48/OG", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1189, "atom1_serNum": 13443, "atom2_serNum": 13480, "donAcc_type": "standard", "distance": 2.611, "atom1_id": "///A/50/O", "atom2_id": "///A/54/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1190, "atom1_serNum": 13460, "atom2_serNum": 13480, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/52/O", "atom2_id": "///A/54/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1191, "atom1_serNum": 13535, "atom2_serNum": 13560, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///A/61/O", "atom2_id": "///A/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1192, "atom1_serNum": 13544, "atom2_serNum": 13565, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///A/62/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1193, "atom1_serNum": 13551, "atom2_serNum": 13572, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///A/63/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1194, "atom1_serNum": 13557, "atom2_serNum": 13580, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/64/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1195, "atom1_serNum": 13563, "atom2_serNum": 13585, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/65/O", "atom2_id": "///A/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1196, "atom1_serNum": 13568, "atom2_serNum": 13593, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///A/66/O", "atom2_id": "///A/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1197, "atom1_serNum": 13570, "atom2_serNum": 13743, "donAcc_type": "acceptable", "distance": 2.707, "atom1_id": "///A/66/OG1", "atom2_id": "///A/86/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1198, "atom1_serNum": 13575, "atom2_serNum": 13604, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/67/O", "atom2_id": "///A/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1199, "atom1_serNum": 13575, "atom2_serNum": 13609, "donAcc_type": "acceptable", "distance": 2.674, "atom1_id": "///A/67/O", "atom2_id": "///A/71/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1200, "atom1_serNum": 13583, "atom2_serNum": 13610, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/68/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1201, "atom1_serNum": 13613, "atom2_serNum": 13631, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/72/O", "atom2_id": "///A/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1202, "atom1_serNum": 13625, "atom2_serNum": 13715, "donAcc_type": "standard", "distance": 2.966, "atom1_id": "///A/73/OE1", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1203, "atom1_serNum": 13626, "atom2_serNum": 13718, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/73/NE2", "atom2_id": "///A/84/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1204, "atom1_serNum": 13627, "atom2_serNum": 13699, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///A/74/N", "atom2_id": "///A/82/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1205, "atom1_serNum": 13634, "atom2_serNum": 13696, "donAcc_type": "standard", "distance": 3.178, "atom1_id": "///A/75/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1206, "atom1_serNum": 13649, "atom2_serNum": 13683, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/77/N", "atom2_id": "///A/80/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1207, "atom1_serNum": 13652, "atom2_serNum": 13680, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/77/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1208, "atom1_serNum": 13652, "atom2_serNum": 13683, "donAcc_type": "questionable", "distance": 3.024, "atom1_id": "///A/77/O", "atom2_id": "///A/80/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1209, "atom1_serNum": 13660, "atom2_serNum": 14033, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/78/N", "atom2_id": "///B/32/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1210, "atom1_serNum": 13678, "atom2_serNum": 14059, "donAcc_type": "acceptable", "distance": 2.537, "atom1_id": "///A/79/OD1", "atom2_id": "///B/35/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1211, "atom1_serNum": 13683, "atom2_serNum": 13696, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/80/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1212, "atom1_serNum": 13772, "atom2_serNum": 13791, "donAcc_type": "standard", "distance": 2.523, "atom1_id": "///A/91/O", "atom2_id": "///A/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1213, "atom1_serNum": 13772, "atom2_serNum": 13799, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/91/O", "atom2_id": "///A/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1214, "atom1_serNum": 13778, "atom2_serNum": 13804, "donAcc_type": "standard", "distance": 3.205, "atom1_id": "///A/92/O", "atom2_id": "///A/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1215, "atom1_serNum": 13782, "atom2_serNum": 13783, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/92/OD2", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1216, "atom1_serNum": 13840, "atom2_serNum": 13852, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///B/9/OD1", "atom2_id": "///B/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1217, "atom1_serNum": 13841, "atom2_serNum": 14504, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/9/ND2", "atom2_id": "///B/90/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1218, "atom1_serNum": 13845, "atom2_serNum": 14245, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///B/10/O", "atom2_id": "///B/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1219, "atom1_serNum": 13855, "atom2_serNum": 14477, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///B/11/O", "atom2_id": "///B/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1220, "atom1_serNum": 13857, "atom2_serNum": 14511, "donAcc_type": "acceptable", "distance": 2.635, "atom1_id": "///B/11/OG1", "atom2_id": "///B/91/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1221, "atom1_serNum": 13859, "atom2_serNum": 14233, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/12/N", "atom2_id": "///B/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1222, "atom1_serNum": 13862, "atom2_serNum": 14230, "donAcc_type": "standard", "distance": 3.053, "atom1_id": "///B/12/O", "atom2_id": "///B/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1223, "atom1_serNum": 13867, "atom2_serNum": 14459, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///B/13/N", "atom2_id": "///B/85/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1224, "atom1_serNum": 13870, "atom2_serNum": 14456, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///B/13/O", "atom2_id": "///B/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1225, "atom1_serNum": 13878, "atom2_serNum": 14212, "donAcc_type": "acceptable", "distance": 2.439, "atom1_id": "///B/13/OH", "atom2_id": "///B/54/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1226, "atom1_serNum": 13879, "atom2_serNum": 14217, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///B/14/N", "atom2_id": "///B/55/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1227, "atom1_serNum": 13882, "atom2_serNum": 14214, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///B/14/O", "atom2_id": "///B/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1228, "atom1_serNum": 13887, "atom2_serNum": 14440, "donAcc_type": "standard", "distance": 2.913, "atom1_id": "///B/15/N", "atom2_id": "///B/83/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1229, "atom1_serNum": 13890, "atom2_serNum": 14437, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///B/15/O", "atom2_id": "///B/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1230, "atom1_serNum": 13893, "atom2_serNum": 14444, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///B/15/OD1", "atom2_id": "///B/83/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1231, "atom1_serNum": 13895, "atom2_serNum": 14204, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///B/16/N", "atom2_id": "///B/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1232, "atom1_serNum": 13901, "atom2_serNum": 14421, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///B/16/OD1", "atom2_id": "///B/80/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1233, "atom1_serNum": 13902, "atom2_serNum": 14425, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///B/16/ND2", "atom2_id": "///B/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1234, "atom1_serNum": 13903, "atom2_serNum": 14204, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///B/17/N", "atom2_id": "///B/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1235, "atom1_serNum": 13914, "atom2_serNum": 13937, "donAcc_type": "standard", "distance": 3.746, "atom1_id": "///B/18/O", "atom2_id": "///B/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1236, "atom1_serNum": 13917, "atom2_serNum": 13919, "donAcc_type": "standard", "distance": 2.951, "atom1_id": "///B/18/OD1", "atom2_id": "///B/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1237, "atom1_serNum": 13917, "atom2_serNum": 13928, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///B/18/OD1", "atom2_id": "///B/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1238, "atom1_serNum": 13918, "atom2_serNum": 14396, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///B/18/ND2", "atom2_id": "///B/78/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1239, "atom1_serNum": 13922, "atom2_serNum": 14158, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///B/19/O", "atom2_id": "///B/47/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1240, "atom1_serNum": 13948, "atom2_serNum": 13980, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///B/22/O", "atom2_id": "///B/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1241, "atom1_serNum": 13957, "atom2_serNum": 13988, "donAcc_type": "standard", "distance": 3.165, "atom1_id": "///B/23/O", "atom2_id": "///B/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1242, "atom1_serNum": 13966, "atom2_serNum": 13997, "donAcc_type": "standard", "distance": 3.158, "atom1_id": "///B/24/O", "atom2_id": "///B/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1243, "atom1_serNum": 13969, "atom2_serNum": 14005, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///B/24/OD1", "atom2_id": "///B/28/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1244, "atom1_serNum": 13974, "atom2_serNum": 14006, "donAcc_type": "standard", "distance": 2.972, "atom1_id": "///B/25/O", "atom2_id": "///B/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1245, "atom1_serNum": 13979, "atom2_serNum": 14404, "donAcc_type": "acceptable", "distance": 2.550, "atom1_id": "///B/25/OE2", "atom2_id": "///B/78/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1246, "atom1_serNum": 13983, "atom2_serNum": 14012, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/26/O", "atom2_id": "///B/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1247, "atom1_serNum": 13991, "atom2_serNum": 14020, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///B/27/O", "atom2_id": "///B/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1248, "atom1_serNum": 14000, "atom2_serNum": 14030, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///B/28/O", "atom2_id": "///B/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1249, "atom1_serNum": 14009, "atom2_serNum": 14035, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///B/29/O", "atom2_id": "///B/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1250, "atom1_serNum": 14011, "atom2_serNum": 14404, "donAcc_type": "acceptable", "distance": 2.657, "atom1_id": "///B/29/OG", "atom2_id": "///B/78/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1251, "atom1_serNum": 14015, "atom2_serNum": 14043, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/30/O", "atom2_id": "///B/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1252, "atom1_serNum": 14023, "atom2_serNum": 14054, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///B/31/O", "atom2_id": "///B/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1253, "atom1_serNum": 14046, "atom2_serNum": 14071, "donAcc_type": "standard", "distance": 3.411, "atom1_id": "///B/34/O", "atom2_id": "///B/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1254, "atom1_serNum": 14057, "atom2_serNum": 14082, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///B/35/O", "atom2_id": "///B/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1255, "atom1_serNum": 14057, "atom2_serNum": 14085, "donAcc_type": "questionable", "distance": 2.744, "atom1_id": "///B/35/O", "atom2_id": "///B/38/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1256, "atom1_serNum": 14074, "atom2_serNum": 14292, "donAcc_type": "acceptable", "distance": 2.853, "atom1_id": "///B/37/O", "atom2_id": "///B/64/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1257, "atom1_serNum": 14089, "atom2_serNum": 14256, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///B/39/O", "atom2_id": "///B/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1258, "atom1_serNum": 14103, "atom2_serNum": 14240, "donAcc_type": "standard", "distance": 2.606, "atom1_id": "///B/41/N", "atom2_id": "///B/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1259, "atom1_serNum": 14111, "atom2_serNum": 14240, "donAcc_type": "standard", "distance": 3.542, "atom1_id": "///B/42/N", "atom2_id": "///B/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1260, "atom1_serNum": 14114, "atom2_serNum": 14237, "donAcc_type": "standard", "distance": 2.906, "atom1_id": "///B/42/O", "atom2_id": "///B/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1261, "atom1_serNum": 14117, "atom2_serNum": 14119, "donAcc_type": "standard", "distance": 2.494, "atom1_id": "///B/42/OD1", "atom2_id": "///B/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1262, "atom1_serNum": 14127, "atom2_serNum": 14222, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///B/44/N", "atom2_id": "///B/56/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1263, "atom1_serNum": 14130, "atom2_serNum": 14219, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///B/44/O", "atom2_id": "///B/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1264, "atom1_serNum": 14147, "atom2_serNum": 14164, "donAcc_type": "acceptable", "distance": 3.331, "atom1_id": "///B/46/OG", "atom2_id": "///B/48/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1265, "atom1_serNum": 14151, "atom2_serNum": 14197, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///B/47/O", "atom2_id": "///B/52/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1266, "atom1_serNum": 14151, "atom2_serNum": 14200, "donAcc_type": "standard", "distance": 3.229, "atom1_id": "///B/47/O", "atom2_id": "///B/52/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1267, "atom1_serNum": 14162, "atom2_serNum": 14190, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///B/48/O", "atom2_id": "///B/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1268, "atom1_serNum": 14176, "atom2_serNum": 14213, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///B/50/O", "atom2_id": "///B/54/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1269, "atom1_serNum": 14193, "atom2_serNum": 14213, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///B/52/O", "atom2_id": "///B/54/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1270, "atom1_serNum": 14268, "atom2_serNum": 14287, "donAcc_type": "standard", "distance": 3.132, "atom1_id": "///B/61/O", "atom2_id": "///B/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1271, "atom1_serNum": 14268, "atom2_serNum": 14293, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///B/61/O", "atom2_id": "///B/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1272, "atom1_serNum": 14277, "atom2_serNum": 14298, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///B/62/O", "atom2_id": "///B/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1273, "atom1_serNum": 14284, "atom2_serNum": 14305, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///B/63/O", "atom2_id": "///B/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1274, "atom1_serNum": 14290, "atom2_serNum": 14313, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///B/64/O", "atom2_id": "///B/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1275, "atom1_serNum": 14296, "atom2_serNum": 14318, "donAcc_type": "standard", "distance": 3.145, "atom1_id": "///B/65/O", "atom2_id": "///B/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1276, "atom1_serNum": 14301, "atom2_serNum": 14326, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///B/66/O", "atom2_id": "///B/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1277, "atom1_serNum": 14303, "atom2_serNum": 14476, "donAcc_type": "acceptable", "distance": 2.457, "atom1_id": "///B/66/OG1", "atom2_id": "///B/86/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1278, "atom1_serNum": 14308, "atom2_serNum": 14337, "donAcc_type": "standard", "distance": 2.933, "atom1_id": "///B/67/O", "atom2_id": "///B/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1279, "atom1_serNum": 14308, "atom2_serNum": 14342, "donAcc_type": "acceptable", "distance": 2.862, "atom1_id": "///B/67/O", "atom2_id": "///B/71/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1280, "atom1_serNum": 14316, "atom2_serNum": 14343, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///B/68/O", "atom2_id": "///B/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1281, "atom1_serNum": 14321, "atom2_serNum": 14351, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///B/69/O", "atom2_id": "///B/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1282, "atom1_serNum": 14346, "atom2_serNum": 14364, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///B/72/O", "atom2_id": "///B/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1283, "atom1_serNum": 14358, "atom2_serNum": 14448, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///B/73/OE1", "atom2_id": "///B/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1284, "atom1_serNum": 14359, "atom2_serNum": 14451, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///B/73/NE2", "atom2_id": "///B/84/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1285, "atom1_serNum": 14360, "atom2_serNum": 14432, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///B/74/N", "atom2_id": "///B/82/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1286, "atom1_serNum": 14363, "atom2_serNum": 14375, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///B/74/O", "atom2_id": "///B/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1287, "atom1_serNum": 14367, "atom2_serNum": 14429, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///B/75/O", "atom2_id": "///B/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1288, "atom1_serNum": 14382, "atom2_serNum": 14416, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///B/77/N", "atom2_id": "///B/80/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1289, "atom1_serNum": 14385, "atom2_serNum": 14413, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///B/77/O", "atom2_id": "///B/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1290, "atom1_serNum": 14416, "atom2_serNum": 14429, "donAcc_type": "standard", "distance": 3.246, "atom1_id": "///B/80/O", "atom2_id": "///B/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1291, "atom1_serNum": 14509, "atom2_serNum": 14528, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///B/91/O", "atom2_id": "///B/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1292, "atom1_serNum": 14509, "atom2_serNum": 14536, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///B/91/O", "atom2_id": "///B/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1293, "atom1_serNum": 14515, "atom2_serNum": 14541, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///B/92/O", "atom2_id": "///B/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1294, "atom1_serNum": 14531, "atom2_serNum": 14546, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///B/94/O", "atom2_id": "///B/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1295, "atom1_serNum": 14573, "atom2_serNum": 14575, "donAcc_type": "standard", "distance": 2.741, "atom1_id": "///C/9/OD1", "atom2_id": "///C/10/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1296, "atom1_serNum": 14573, "atom2_serNum": 14585, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///C/9/OD1", "atom2_id": "///C/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1297, "atom1_serNum": 14574, "atom2_serNum": 15233, "donAcc_type": "standard", "distance": 3.099, "atom1_id": "///C/9/ND2", "atom2_id": "///C/90/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1298, "atom1_serNum": 14578, "atom2_serNum": 14978, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///C/10/O", "atom2_id": "///C/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1299, "atom1_serNum": 14588, "atom2_serNum": 15210, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///C/11/O", "atom2_id": "///C/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1300, "atom1_serNum": 14590, "atom2_serNum": 15240, "donAcc_type": "acceptable", "distance": 2.696, "atom1_id": "///C/11/OG1", "atom2_id": "///C/91/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1301, "atom1_serNum": 14592, "atom2_serNum": 14966, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///C/12/N", "atom2_id": "///C/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1302, "atom1_serNum": 14595, "atom2_serNum": 14963, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///C/12/O", "atom2_id": "///C/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1303, "atom1_serNum": 14600, "atom2_serNum": 15192, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///C/13/N", "atom2_id": "///C/85/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1304, "atom1_serNum": 14603, "atom2_serNum": 15189, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///C/13/O", "atom2_id": "///C/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1305, "atom1_serNum": 14611, "atom2_serNum": 14945, "donAcc_type": "acceptable", "distance": 2.389, "atom1_id": "///C/13/OH", "atom2_id": "///C/54/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1306, "atom1_serNum": 14612, "atom2_serNum": 14950, "donAcc_type": "standard", "distance": 2.633, "atom1_id": "///C/14/N", "atom2_id": "///C/55/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1307, "atom1_serNum": 14615, "atom2_serNum": 14947, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///C/14/O", "atom2_id": "///C/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1308, "atom1_serNum": 14620, "atom2_serNum": 15173, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///C/15/N", "atom2_id": "///C/83/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1309, "atom1_serNum": 14623, "atom2_serNum": 15170, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///C/15/O", "atom2_id": "///C/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1310, "atom1_serNum": 14627, "atom2_serNum": 15173, "donAcc_type": "standard", "distance": 3.045, "atom1_id": "///C/15/ND2", "atom2_id": "///C/83/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1311, "atom1_serNum": 14628, "atom2_serNum": 14937, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///C/16/N", "atom2_id": "///C/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1312, "atom1_serNum": 14635, "atom2_serNum": 15158, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///C/16/ND2", "atom2_id": "///C/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1313, "atom1_serNum": 14636, "atom2_serNum": 14937, "donAcc_type": "standard", "distance": 3.104, "atom1_id": "///C/17/N", "atom2_id": "///C/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1314, "atom1_serNum": 14647, "atom2_serNum": 14670, "donAcc_type": "standard", "distance": 3.915, "atom1_id": "///C/18/O", "atom2_id": "///C/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1315, "atom1_serNum": 14650, "atom2_serNum": 14652, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///C/18/OD1", "atom2_id": "///C/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1316, "atom1_serNum": 14650, "atom2_serNum": 14661, "donAcc_type": "standard", "distance": 3.221, "atom1_id": "///C/18/OD1", "atom2_id": "///C/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1317, "atom1_serNum": 14651, "atom2_serNum": 15129, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///C/18/ND2", "atom2_id": "///C/78/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1318, "atom1_serNum": 14655, "atom2_serNum": 14891, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///C/19/O", "atom2_id": "///C/47/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1319, "atom1_serNum": 14681, "atom2_serNum": 14713, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///C/22/O", "atom2_id": "///C/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1320, "atom1_serNum": 14699, "atom2_serNum": 14730, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///C/24/O", "atom2_id": "///C/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1321, "atom1_serNum": 14707, "atom2_serNum": 14739, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///C/25/O", "atom2_id": "///C/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1322, "atom1_serNum": 14707, "atom2_serNum": 14744, "donAcc_type": "acceptable", "distance": 2.554, "atom1_id": "///C/25/O", "atom2_id": "///C/29/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1323, "atom1_serNum": 14712, "atom2_serNum": 15137, "donAcc_type": "acceptable", "distance": 2.729, "atom1_id": "///C/25/OE2", "atom2_id": "///C/78/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1324, "atom1_serNum": 14716, "atom2_serNum": 14745, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///C/26/O", "atom2_id": "///C/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1325, "atom1_serNum": 14724, "atom2_serNum": 14753, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///C/27/O", "atom2_id": "///C/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1326, "atom1_serNum": 14733, "atom2_serNum": 14763, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///C/28/O", "atom2_id": "///C/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1327, "atom1_serNum": 14744, "atom2_serNum": 15137, "donAcc_type": "acceptable", "distance": 2.466, "atom1_id": "///C/29/OG", "atom2_id": "///C/78/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1328, "atom1_serNum": 14748, "atom2_serNum": 14776, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///C/30/O", "atom2_id": "///C/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1329, "atom1_serNum": 14756, "atom2_serNum": 14787, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///C/31/O", "atom2_id": "///C/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1330, "atom1_serNum": 14756, "atom2_serNum": 14792, "donAcc_type": "acceptable", "distance": 2.940, "atom1_id": "///C/31/O", "atom2_id": "///C/35/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1331, "atom1_serNum": 14766, "atom2_serNum": 15851, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///C/32/O", "atom2_id": "///D/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1332, "atom1_serNum": 14790, "atom2_serNum": 14818, "donAcc_type": "questionable", "distance": 3.006, "atom1_id": "///C/35/O", "atom2_id": "///C/38/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1333, "atom1_serNum": 14807, "atom2_serNum": 15025, "donAcc_type": "acceptable", "distance": 2.981, "atom1_id": "///C/37/O", "atom2_id": "///C/64/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1334, "atom1_serNum": 14822, "atom2_serNum": 14989, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///C/39/O", "atom2_id": "///C/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1335, "atom1_serNum": 14836, "atom2_serNum": 14973, "donAcc_type": "standard", "distance": 2.491, "atom1_id": "///C/41/N", "atom2_id": "///C/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1336, "atom1_serNum": 14844, "atom2_serNum": 14973, "donAcc_type": "standard", "distance": 3.473, "atom1_id": "///C/42/N", "atom2_id": "///C/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1337, "atom1_serNum": 14847, "atom2_serNum": 14970, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///C/42/O", "atom2_id": "///C/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1338, "atom1_serNum": 14860, "atom2_serNum": 14955, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///C/44/N", "atom2_id": "///C/56/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1339, "atom1_serNum": 14863, "atom2_serNum": 14952, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///C/44/O", "atom2_id": "///C/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1340, "atom1_serNum": 14880, "atom2_serNum": 14892, "donAcc_type": "acceptable", "distance": 3.342, "atom1_id": "///C/46/OG", "atom2_id": "///C/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1341, "atom1_serNum": 14884, "atom2_serNum": 14933, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///C/47/O", "atom2_id": "///C/52/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1342, "atom1_serNum": 14895, "atom2_serNum": 14923, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///C/48/O", "atom2_id": "///C/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1343, "atom1_serNum": 14909, "atom2_serNum": 14946, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///C/50/O", "atom2_id": "///C/54/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1344, "atom1_serNum": 14926, "atom2_serNum": 14946, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///C/52/O", "atom2_id": "///C/54/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1345, "atom1_serNum": 15001, "atom2_serNum": 15026, "donAcc_type": "standard", "distance": 3.503, "atom1_id": "///C/61/O", "atom2_id": "///C/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1346, "atom1_serNum": 15010, "atom2_serNum": 15026, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///C/62/O", "atom2_id": "///C/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1347, "atom1_serNum": 15010, "atom2_serNum": 15031, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///C/62/O", "atom2_id": "///C/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1348, "atom1_serNum": 15017, "atom2_serNum": 15038, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///C/63/O", "atom2_id": "///C/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1349, "atom1_serNum": 15023, "atom2_serNum": 15046, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///C/64/O", "atom2_id": "///C/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1350, "atom1_serNum": 15029, "atom2_serNum": 15051, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///C/65/O", "atom2_id": "///C/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1351, "atom1_serNum": 15034, "atom2_serNum": 15059, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///C/66/O", "atom2_id": "///C/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1352, "atom1_serNum": 15036, "atom2_serNum": 15209, "donAcc_type": "acceptable", "distance": 2.693, "atom1_id": "///C/66/OG1", "atom2_id": "///C/86/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1353, "atom1_serNum": 15041, "atom2_serNum": 15070, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///C/67/O", "atom2_id": "///C/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1354, "atom1_serNum": 15041, "atom2_serNum": 15075, "donAcc_type": "acceptable", "distance": 2.992, "atom1_id": "///C/67/O", "atom2_id": "///C/71/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1355, "atom1_serNum": 15049, "atom2_serNum": 15076, "donAcc_type": "standard", "distance": 2.930, "atom1_id": "///C/68/O", "atom2_id": "///C/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1356, "atom1_serNum": 15079, "atom2_serNum": 15097, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///C/72/O", "atom2_id": "///C/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1357, "atom1_serNum": 15091, "atom2_serNum": 15181, "donAcc_type": "standard", "distance": 3.368, "atom1_id": "///C/73/OE1", "atom2_id": "///C/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1358, "atom1_serNum": 15092, "atom2_serNum": 15184, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///C/73/NE2", "atom2_id": "///C/84/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1359, "atom1_serNum": 15093, "atom2_serNum": 15165, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///C/74/N", "atom2_id": "///C/82/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1360, "atom1_serNum": 15100, "atom2_serNum": 15115, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///C/75/O", "atom2_id": "///C/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1361, "atom1_serNum": 15100, "atom2_serNum": 15162, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///C/75/O", "atom2_id": "///C/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1362, "atom1_serNum": 15115, "atom2_serNum": 15149, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///C/77/N", "atom2_id": "///C/80/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1363, "atom1_serNum": 15118, "atom2_serNum": 15146, "donAcc_type": "standard", "distance": 3.176, "atom1_id": "///C/77/O", "atom2_id": "///C/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1364, "atom1_serNum": 15118, "atom2_serNum": 15149, "donAcc_type": "questionable", "distance": 3.112, "atom1_id": "///C/77/O", "atom2_id": "///C/80/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1365, "atom1_serNum": 15126, "atom2_serNum": 15491, "donAcc_type": "standard", "distance": 3.623, "atom1_id": "///C/78/N", "atom2_id": "///D/32/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1366, "atom1_serNum": 15238, "atom2_serNum": 15257, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///C/91/O", "atom2_id": "///C/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1367, "atom1_serNum": 15238, "atom2_serNum": 15265, "donAcc_type": "standard", "distance": 3.371, "atom1_id": "///C/91/O", "atom2_id": "///C/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1368, "atom1_serNum": 15244, "atom2_serNum": 15270, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///C/92/O", "atom2_id": "///C/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1369, "atom1_serNum": 15301, "atom2_serNum": 15958, "donAcc_type": "questionable", "distance": 2.667, "atom1_id": "///D/9/OD1", "atom2_id": "///D/90/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1370, "atom1_serNum": 15303, "atom2_serNum": 15309, "donAcc_type": "acceptable", "distance": 3.159, "atom1_id": "///D/10/N", "atom2_id": "///D/10/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 1371, "atom1_serNum": 15309, "atom2_serNum": 15958, "donAcc_type": "acceptable", "distance": 3.959, "atom1_id": "///D/10/ND1", "atom2_id": "///D/90/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1372, "atom1_serNum": 15316, "atom2_serNum": 15935, "donAcc_type": "standard", "distance": 2.763, "atom1_id": "///D/11/O", "atom2_id": "///D/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1373, "atom1_serNum": 15318, "atom2_serNum": 15965, "donAcc_type": "acceptable", "distance": 2.850, "atom1_id": "///D/11/OG1", "atom2_id": "///D/91/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1374, "atom1_serNum": 15320, "atom2_serNum": 15691, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///D/12/N", "atom2_id": "///D/57/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1375, "atom1_serNum": 15323, "atom2_serNum": 15675, "donAcc_type": "questionable", "distance": 3.349, "atom1_id": "///D/12/O", "atom2_id": "///D/55/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1376, "atom1_serNum": 15323, "atom2_serNum": 15688, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///D/12/O", "atom2_id": "///D/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1377, "atom1_serNum": 15328, "atom2_serNum": 15917, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///D/13/N", "atom2_id": "///D/85/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1378, "atom1_serNum": 15331, "atom2_serNum": 15914, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///D/13/O", "atom2_id": "///D/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1379, "atom1_serNum": 15339, "atom2_serNum": 15670, "donAcc_type": "acceptable", "distance": 2.678, "atom1_id": "///D/13/OH", "atom2_id": "///D/54/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1380, "atom1_serNum": 15340, "atom2_serNum": 15675, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///D/14/N", "atom2_id": "///D/55/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1381, "atom1_serNum": 15343, "atom2_serNum": 15672, "donAcc_type": "standard", "distance": 2.637, "atom1_id": "///D/14/O", "atom2_id": "///D/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1382, "atom1_serNum": 15348, "atom2_serNum": 15898, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///D/15/N", "atom2_id": "///D/83/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1383, "atom1_serNum": 15351, "atom2_serNum": 15895, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///D/15/O", "atom2_id": "///D/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1384, "atom1_serNum": 15356, "atom2_serNum": 15662, "donAcc_type": "standard", "distance": 3.289, "atom1_id": "///D/16/N", "atom2_id": "///D/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1385, "atom1_serNum": 15363, "atom2_serNum": 15883, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///D/16/ND2", "atom2_id": "///D/81/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1386, "atom1_serNum": 15364, "atom2_serNum": 15662, "donAcc_type": "standard", "distance": 3.255, "atom1_id": "///D/17/N", "atom2_id": "///D/53/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1387, "atom1_serNum": 15367, "atom2_serNum": 15380, "donAcc_type": "standard", "distance": 3.184, "atom1_id": "///D/17/O", "atom2_id": "///D/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1388, "atom1_serNum": 15375, "atom2_serNum": 15395, "donAcc_type": "standard", "distance": 3.456, "atom1_id": "///D/18/O", "atom2_id": "///D/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1389, "atom1_serNum": 15378, "atom2_serNum": 15380, "donAcc_type": "standard", "distance": 2.962, "atom1_id": "///D/18/OD1", "atom2_id": "///D/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1390, "atom1_serNum": 15378, "atom2_serNum": 15389, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///D/18/OD1", "atom2_id": "///D/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1391, "atom1_serNum": 15379, "atom2_serNum": 15854, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///D/18/ND2", "atom2_id": "///D/78/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1392, "atom1_serNum": 15383, "atom2_serNum": 15615, "donAcc_type": "standard", "distance": 3.198, "atom1_id": "///D/19/O", "atom2_id": "///D/47/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1393, "atom1_serNum": 15406, "atom2_serNum": 15438, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///D/22/O", "atom2_id": "///D/26/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1394, "atom1_serNum": 15415, "atom2_serNum": 15446, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///D/23/O", "atom2_id": "///D/27/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1395, "atom1_serNum": 15424, "atom2_serNum": 15455, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///D/24/O", "atom2_id": "///D/28/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1396, "atom1_serNum": 15432, "atom2_serNum": 15464, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///D/25/O", "atom2_id": "///D/29/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1397, "atom1_serNum": 15437, "atom2_serNum": 15862, "donAcc_type": "acceptable", "distance": 3.203, "atom1_id": "///D/25/OE2", "atom2_id": "///D/78/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1398, "atom1_serNum": 15441, "atom2_serNum": 15470, "donAcc_type": "standard", "distance": 3.242, "atom1_id": "///D/26/O", "atom2_id": "///D/30/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1399, "atom1_serNum": 15449, "atom2_serNum": 15478, "donAcc_type": "standard", "distance": 2.942, "atom1_id": "///D/27/O", "atom2_id": "///D/31/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1400, "atom1_serNum": 15454, "atom2_serNum": 15580, "donAcc_type": "standard", "distance": 3.188, "atom1_id": "///D/27/NZ", "atom2_id": "///D/43/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1401, "atom1_serNum": 15458, "atom2_serNum": 15488, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///D/28/O", "atom2_id": "///D/32/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1402, "atom1_serNum": 15467, "atom2_serNum": 15493, "donAcc_type": "standard", "distance": 3.175, "atom1_id": "///D/29/O", "atom2_id": "///D/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1403, "atom1_serNum": 15469, "atom2_serNum": 15862, "donAcc_type": "acceptable", "distance": 2.528, "atom1_id": "///D/29/OG", "atom2_id": "///D/78/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1404, "atom1_serNum": 15473, "atom2_serNum": 15493, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///D/30/O", "atom2_id": "///D/33/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1405, "atom1_serNum": 15473, "atom2_serNum": 15501, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///D/30/O", "atom2_id": "///D/34/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1406, "atom1_serNum": 15481, "atom2_serNum": 15512, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///D/31/O", "atom2_id": "///D/35/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1407, "atom1_serNum": 15481, "atom2_serNum": 15517, "donAcc_type": "acceptable", "distance": 2.360, "atom1_id": "///D/31/O", "atom2_id": "///D/35/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1408, "atom1_serNum": 15504, "atom2_serNum": 15529, "donAcc_type": "standard", "distance": 3.345, "atom1_id": "///D/34/O", "atom2_id": "///D/37/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1409, "atom1_serNum": 15515, "atom2_serNum": 15540, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///D/35/O", "atom2_id": "///D/38/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1410, "atom1_serNum": 15547, "atom2_serNum": 15714, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///D/39/O", "atom2_id": "///D/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1411, "atom1_serNum": 15561, "atom2_serNum": 15698, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///D/41/N", "atom2_id": "///D/58/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1412, "atom1_serNum": 15572, "atom2_serNum": 15695, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///D/42/O", "atom2_id": "///D/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1413, "atom1_serNum": 15575, "atom2_serNum": 15577, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///D/42/OD1", "atom2_id": "///D/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1414, "atom1_serNum": 15585, "atom2_serNum": 15680, "donAcc_type": "standard", "distance": 3.033, "atom1_id": "///D/44/N", "atom2_id": "///D/56/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1415, "atom1_serNum": 15588, "atom2_serNum": 15677, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///D/44/O", "atom2_id": "///D/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1416, "atom1_serNum": 15605, "atom2_serNum": 15617, "donAcc_type": "acceptable", "distance": 3.300, "atom1_id": "///D/46/OG", "atom2_id": "///D/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1417, "atom1_serNum": 15609, "atom2_serNum": 15655, "donAcc_type": "standard", "distance": 3.383, "atom1_id": "///D/47/O", "atom2_id": "///D/52/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1418, "atom1_serNum": 15609, "atom2_serNum": 15658, "donAcc_type": "standard", "distance": 3.364, "atom1_id": "///D/47/O", "atom2_id": "///D/52/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1419, "atom1_serNum": 15620, "atom2_serNum": 15648, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///D/48/O", "atom2_id": "///D/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1420, "atom1_serNum": 15634, "atom2_serNum": 15671, "donAcc_type": "standard", "distance": 2.544, "atom1_id": "///D/50/O", "atom2_id": "///D/54/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1421, "atom1_serNum": 15651, "atom2_serNum": 15671, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///D/52/O", "atom2_id": "///D/54/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1422, "atom1_serNum": 15726, "atom2_serNum": 15745, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///D/61/O", "atom2_id": "///D/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1423, "atom1_serNum": 15726, "atom2_serNum": 15750, "donAcc_type": "acceptable", "distance": 2.565, "atom1_id": "///D/61/O", "atom2_id": "///D/64/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1424, "atom1_serNum": 15726, "atom2_serNum": 15751, "donAcc_type": "standard", "distance": 3.357, "atom1_id": "///D/61/O", "atom2_id": "///D/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1425, "atom1_serNum": 15735, "atom2_serNum": 15751, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///D/62/O", "atom2_id": "///D/65/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1426, "atom1_serNum": 15735, "atom2_serNum": 15756, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///D/62/O", "atom2_id": "///D/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1427, "atom1_serNum": 15742, "atom2_serNum": 15763, "donAcc_type": "standard", "distance": 3.498, "atom1_id": "///D/63/O", "atom2_id": "///D/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1428, "atom1_serNum": 15748, "atom2_serNum": 15771, "donAcc_type": "standard", "distance": 2.777, "atom1_id": "///D/64/O", "atom2_id": "///D/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1429, "atom1_serNum": 15754, "atom2_serNum": 15776, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///D/65/O", "atom2_id": "///D/69/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1430, "atom1_serNum": 15759, "atom2_serNum": 15784, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///D/66/O", "atom2_id": "///D/70/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1431, "atom1_serNum": 15761, "atom2_serNum": 15934, "donAcc_type": "acceptable", "distance": 2.699, "atom1_id": "///D/66/OG1", "atom2_id": "///D/86/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 1432, "atom1_serNum": 15766, "atom2_serNum": 15795, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///D/67/O", "atom2_id": "///D/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1433, "atom1_serNum": 15774, "atom2_serNum": 15795, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///D/68/O", "atom2_id": "///D/71/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1434, "atom1_serNum": 15774, "atom2_serNum": 15801, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///D/68/O", "atom2_id": "///D/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1435, "atom1_serNum": 15804, "atom2_serNum": 15822, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///D/72/O", "atom2_id": "///D/75/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1436, "atom1_serNum": 15816, "atom2_serNum": 15818, "donAcc_type": "standard", "distance": 3.287, "atom1_id": "///D/73/OE1", "atom2_id": "///D/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1437, "atom1_serNum": 15816, "atom2_serNum": 15906, "donAcc_type": "standard", "distance": 3.310, "atom1_id": "///D/73/OE1", "atom2_id": "///D/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1438, "atom1_serNum": 15817, "atom2_serNum": 15909, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///D/73/NE2", "atom2_id": "///D/84/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1439, "atom1_serNum": 15818, "atom2_serNum": 15890, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///D/74/N", "atom2_id": "///D/82/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1440, "atom1_serNum": 15821, "atom2_serNum": 15833, "donAcc_type": "standard", "distance": 3.135, "atom1_id": "///D/74/O", "atom2_id": "///D/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1441, "atom1_serNum": 15825, "atom2_serNum": 15887, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///D/75/O", "atom2_id": "///D/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1442, "atom1_serNum": 15840, "atom2_serNum": 15874, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///D/77/N", "atom2_id": "///D/80/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 1443, "atom1_serNum": 15843, "atom2_serNum": 15871, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///D/77/O", "atom2_id": "///D/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1444, "atom1_serNum": 15874, "atom2_serNum": 15887, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///D/80/O", "atom2_id": "///D/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1445, "atom1_serNum": 15963, "atom2_serNum": 15982, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///D/91/O", "atom2_id": "///D/94/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1446, "atom1_serNum": 15963, "atom2_serNum": 15990, "donAcc_type": "standard", "distance": 3.170, "atom1_id": "///D/91/O", "atom2_id": "///D/95/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1447, "atom1_serNum": 15969, "atom2_serNum": 15995, "donAcc_type": "standard", "distance": 2.812, "atom1_id": "///D/92/O", "atom2_id": "///D/96/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 1448, "atom1_serNum": 15973, "atom2_serNum": 15974, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///D/92/OD2", "atom2_id": "///D/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "2nz4", "num_aaChains": 4, "aaChains": "A=90,B=94,C=90,D=90", "num_naChains": 8, "naChains": "E=13,F=13,G=13,H=13,P=141,Q=141,R=141,S=141", "num_atoms": 16274, "num_waters": 206, "num_metals": 16, "metals_desc": "Mg=16", "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 16, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-bulges.pdb", "desc": "an ensemble of bulges" }, { "index": 7, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 8, "name": "dssr-junctions.pdb", "desc": "an ensemble of junctions (multi-branch)" }, { "index": 9, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 10, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 11, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 12, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 13, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 14, "name": "dssr-Aminors.pdb", "desc": "an ensemble of A minor motifs (types I and II)" }, { "index": 15, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 16, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" } ], "time_used": "999" } }