{ "num_pairs": 15, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -122.645, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.508, "chi2": -114.169, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.655, "C1C1_dist": 10.714, "N1N9_dist": 9.011, "C6C8_dist": 9.908, "CNNC_torsion": 5.985, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.04],N3-N1(imino)[3.10],N4(amino)-O6(carbonyl)[3.10]", "interBase_angle": 15.296, "planarity": 0.291, "simple_Shear": 0.604, "simple_Stretch": -0.085, "simple_Buckle": 5.001, "simple_Propeller": 14.455, "bp_simpleParams": [ 0.604, -0.085, 0.665, 5.001, 14.455, 2.622 ], "bp_params": [ 0.598, -0.121, 0.665, 5.827, 14.142, 2.639 ], "frame": { "rmsd": null, "origin": [ 5.903, -17.021, 0.677 ], "x_axis": [ -0.495, -0.046, 0.868 ], "y_axis": [ 0.825, 0.289, 0.486 ], "z_axis": [ -0.273, 0.956, -0.105 ], "quaternion": [ -0.415, 0.284, 0.687, 0.525 ] } }, { "index": 2, "nt1": "///A/2", "nt2": "///A/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -103.536, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 53.142, "chi2": -117.408, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.241, "C1C1_dist": 10.996, "N1N9_dist": 9.210, "C6C8_dist": 10.030, "CNNC_torsion": -10.624, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.03],N1(imino)-N3[3.08],N2(amino)-O2(carbonyl)[3.01]", "interBase_angle": 7.518, "planarity": 0.106, "simple_Shear": -0.175, "simple_Stretch": 0.034, "simple_Buckle": -2.206, "simple_Propeller": -7.187, "bp_simpleParams": [ -0.175, 0.034, 0.171, -2.206, -7.187, -2.338 ], "bp_params": [ -0.176, 0.032, 0.171, -2.106, -7.217, -2.342 ], "frame": { "rmsd": null, "origin": [ 4.330, -11.985, -0.404 ], "x_axis": [ -0.075, 0.155, 0.985 ], "y_axis": [ 0.923, 0.386, 0.010 ], "z_axis": [ -0.378, 0.910, -0.172 ], "quaternion": [ 0.533, -0.422, -0.639, -0.360 ] } }, { "index": 3, "nt1": "///A/3", "nt2": "///A/34", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -102.803, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 48.124, "chi2": -113.099, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 50.398, "C1C1_dist": 11.285, "N1N9_dist": 9.322, "C6C8_dist": 9.960, "CNNC_torsion": -1.572, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[3.09],O4(carbonyl)-N6(amino)[2.75]", "interBase_angle": 6.530, "planarity": 0.097, "simple_Shear": -0.408, "simple_Stretch": 0.078, "simple_Buckle": -2.417, "simple_Propeller": -6.066, "bp_simpleParams": [ -0.408, 0.078, -0.216, -2.417, -6.066, -11.448 ], "bp_params": [ -0.411, 0.060, -0.216, -2.154, -6.164, -11.462 ], "frame": { "rmsd": null, "origin": [ 2.834, -8.188, -1.684 ], "x_axis": [ 0.375, 0.296, 0.878 ], "y_axis": [ 0.832, 0.310, -0.460 ], "z_axis": [ -0.409, 0.903, -0.130 ], "quaternion": [ 0.624, -0.547, -0.516, -0.215 ] } }, { "index": 4, "nt1": "///A/4", "nt2": "///A/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -105.547, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.208, "chi2": -120.305, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 52.344, "C1C1_dist": 11.019, "N1N9_dist": 9.240, "C6C8_dist": 10.068, "CNNC_torsion": 4.680, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.04],N1(imino)-N3[3.11],N2(amino)-O2(carbonyl)[3.02]", "interBase_angle": 6.649, "planarity": 0.118, "simple_Shear": 0.128, "simple_Stretch": 0.090, "simple_Buckle": 6.430, "simple_Propeller": 1.693, "bp_simpleParams": [ 0.128, 0.090, -0.200, 6.430, 1.693, -2.071 ], "bp_params": [ 0.130, 0.088, -0.200, 6.457, 1.586, -2.068 ], "frame": { "rmsd": null, "origin": [ 2.996, -4.042, -1.241 ], "x_axis": [ 0.824, 0.304, 0.479 ], "y_axis": [ 0.464, 0.125, -0.877 ], "z_axis": [ -0.327, 0.944, -0.039 ], "quaternion": [ 0.691, -0.659, -0.291, -0.058 ] } }, { "index": 5, "nt1": "///A/5", "nt2": "///A/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -128.097, "conf1": "anti", "pucker1": "pucker-CHK", "lambda1": 53.711, "chi2": -112.164, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.435, "C1C1_dist": 10.879, "N1N9_dist": 9.132, "C6C8_dist": 9.974, "CNNC_torsion": 8.378, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.97],N3-N1(imino)[3.06],N4(amino)-O6(carbonyl)[3.06]", "interBase_angle": 20.966, "planarity": 0.221, "simple_Shear": 0.089, "simple_Stretch": 0.072, "simple_Buckle": -16.402, "simple_Propeller": 13.060, "bp_simpleParams": [ 0.089, 0.072, 0.434, -16.402, 13.060, -0.108 ], "bp_params": [ 0.089, 0.072, 0.434, -16.460, 12.986, -0.107 ], "frame": { "rmsd": null, "origin": [ 1.229, 1.295, -1.321 ], "x_axis": [ 0.966, 0.252, -0.061 ], "y_axis": [ -0.030, -0.125, -0.992 ], "z_axis": [ -0.258, 0.960, -0.113 ], "quaternion": [ 0.657, -0.742, -0.075, 0.108 ] } }, { "index": 6, "nt1": "///A/6", "nt2": "///A/31", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -106.507, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 54.149, "chi2": -108.922, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.294, "C1C1_dist": 10.808, "N1N9_dist": 9.069, "C6C8_dist": 9.935, "CNNC_torsion": -9.786, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.06],N1-N3(imino)[3.01]", "interBase_angle": 3.286, "planarity": 0.139, "simple_Shear": -0.035, "simple_Stretch": -0.036, "simple_Buckle": 0.987, "simple_Propeller": -3.134, "bp_simpleParams": [ -0.035, -0.036, 0.657, 0.987, -3.134, -1.744 ], "bp_params": [ -0.035, -0.036, 0.657, 0.980, -3.136, -1.744 ], "frame": { "rmsd": null, "origin": [ 0.194, 5.235, -1.412 ], "x_axis": [ 0.827, 0.249, -0.504 ], "y_axis": [ -0.483, -0.142, -0.864 ], "z_axis": [ -0.287, 0.958, 0.003 ], "quaternion": [ 0.650, -0.701, 0.083, 0.282 ] } }, { "index": 7, "nt1": "///A/7", "nt2": "///A/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -103.823, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.839, "chi2": -149.554, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 48.752, "C1C1_dist": 11.112, "N1N9_dist": 9.280, "C6C8_dist": 10.057, "CNNC_torsion": 18.007, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.04],N1(imino)-N3[3.13],N2(amino)-O2(carbonyl)[3.08]", "interBase_angle": 11.018, "planarity": 0.205, "simple_Shear": 0.425, "simple_Stretch": 0.078, "simple_Buckle": 6.234, "simple_Propeller": 9.084, "bp_simpleParams": [ 0.425, 0.078, -0.531, 6.234, 9.084, -4.442 ], "bp_params": [ 0.428, 0.057, -0.531, 6.663, 8.774, -4.448 ], "frame": { "rmsd": null, "origin": [ -0.070, 9.256, -1.635 ], "x_axis": [ 0.524, -0.095, -0.847 ], "y_axis": [ -0.845, -0.186, -0.502 ], "z_axis": [ -0.110, 0.978, -0.177 ], "quaternion": [ 0.538, -0.687, 0.342, 0.348 ] } }, { "index": 8, "nt1": "///A/8", "nt2": "///A/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -123.766, "conf1": "anti", "pucker1": "pucker-CHK", "lambda1": 54.538, "chi2": -114.730, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 53.013, "C1C1_dist": 10.940, "N1N9_dist": 9.162, "C6C8_dist": 9.967, "CNNC_torsion": -8.787, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.03],N3-N1(imino)[3.10],N4(amino)-O6(carbonyl)[3.02]", "interBase_angle": 10.354, "planarity": 0.194, "simple_Shear": 0.284, "simple_Stretch": 0.012, "simple_Buckle": 10.099, "simple_Propeller": -2.284, "bp_simpleParams": [ 0.284, 0.012, 0.303, 10.099, -2.284, -2.634 ], "bp_params": [ 0.284, 0.005, 0.303, 10.043, -2.518, -2.624 ], "frame": { "rmsd": null, "origin": [ -0.095, 13.680, -2.602 ], "x_axis": [ -0.068, -0.157, -0.985 ], "y_axis": [ -0.980, -0.174, 0.095 ], "z_axis": [ -0.187, 0.972, -0.142 ], "quaternion": [ -0.392, 0.559, -0.509, -0.525 ] } }, { "index": 9, "nt1": "///A/9", "nt2": "///A/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -104.954, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.540, "chi2": -110.439, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 56.315, "C1C1_dist": 10.760, "N1N9_dist": 9.093, "C6C8_dist": 9.990, "CNNC_torsion": -18.392, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.12],N1(imino)-N3[3.05],N2(amino)-O2(carbonyl)[2.82]", "interBase_angle": 15.816, "planarity": 0.213, "simple_Shear": 0.101, "simple_Stretch": 0.035, "simple_Buckle": 13.987, "simple_Propeller": -7.382, "bp_simpleParams": [ 0.101, 0.035, 0.773, 13.987, -7.382, 0.554 ], "bp_params": [ 0.101, 0.034, 0.773, 13.924, -7.501, 0.551 ], "frame": { "rmsd": null, "origin": [ -0.948, 18.314, -3.418 ], "x_axis": [ -0.596, 0.048, -0.801 ], "y_axis": [ -0.803, -0.032, 0.596 ], "z_axis": [ 0.003, 0.998, 0.057 ], "quaternion": [ 0.327, -0.307, 0.614, 0.649 ] } }, { "index": 10, "nt1": "///A/10", "nt2": "///A/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -105.494, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 56.406, "chi2": -107.116, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 54.228, "C1C1_dist": 11.023, "N1N9_dist": 9.301, "C6C8_dist": 10.141, "CNNC_torsion": -4.735, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.07],N1(imino)-N3[3.15],N2(amino)-O2(carbonyl)[3.03]", "interBase_angle": 9.276, "planarity": 0.104, "simple_Shear": 0.280, "simple_Stretch": 0.158, "simple_Buckle": -7.841, "simple_Propeller": -4.955, "bp_simpleParams": [ 0.280, 0.158, -0.230, -7.841, -4.955, -1.808 ], "bp_params": [ 0.285, 0.149, -0.230, -8.001, -4.692, -1.805 ], "frame": { "rmsd": null, "origin": [ -1.584, 23.208, -3.312 ], "x_axis": [ -0.919, -0.249, -0.305 ], "y_axis": [ -0.336, 0.095, 0.937 ], "z_axis": [ -0.204, 0.964, -0.171 ], "quaternion": [ 0.034, -0.198, 0.739, 0.643 ] } }, { "index": 11, "nt1": "///A/11", "nt2": "///A/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -137.087, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.893, "chi2": -102.556, "conf2": "anti", "pucker2": "----", "lambda2": 55.432, "C1C1_dist": 10.712, "N1N9_dist": 9.017, "C6C8_dist": 9.923, "CNNC_torsion": 3.481, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.80],N3-N1(imino)[3.00],N4(amino)-O6(carbonyl)[3.07]", "interBase_angle": 16.126, "planarity": 0.213, "simple_Shear": 0.115, "simple_Stretch": 0.022, "simple_Buckle": 15.598, "simple_Propeller": 4.092, "bp_simpleParams": [ 0.115, 0.022, -0.243, 15.598, 4.092, 1.431 ], "bp_params": [ 0.115, 0.020, -0.243, 15.645, 3.909, 1.419 ], "frame": { "rmsd": null, "origin": [ -2.765, 25.941, -3.440 ], "x_axis": [ -0.990, -0.139, 0.036 ], "y_axis": [ 0.013, 0.160, 0.987 ], "z_axis": [ -0.142, 0.977, -0.157 ], "quaternion": [ -0.059, -0.041, 0.759, 0.647 ] } }, { "index": 12, "nt1": "///A/18", "nt2": "///A/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -123.209, "conf1": "anti", "pucker1": "----", "lambda1": 55.294, "chi2": -135.396, "conf2": "anti", "pucker2": "pucker-CHK", "lambda2": 56.213, "C1C1_dist": 10.724, "N1N9_dist": 9.036, "C6C8_dist": 9.972, "CNNC_torsion": 8.546, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.09],N1(imino)-N3[2.98],N2(amino)-O2(carbonyl)[2.75]", "interBase_angle": 9.001, "planarity": 0.118, "simple_Shear": -0.131, "simple_Stretch": -0.017, "simple_Buckle": -3.716, "simple_Propeller": 8.198, "bp_simpleParams": [ -0.131, -0.017, -0.172, -3.716, 8.198, 2.184 ], "bp_params": [ -0.131, -0.018, -0.172, -3.799, 8.160, 2.188 ], "frame": { "rmsd": null, "origin": [ 15.849, 14.802, 7.490 ], "x_axis": [ 0.632, 0.173, -0.755 ], "y_axis": [ -0.744, 0.407, -0.529 ], "z_axis": [ 0.216, 0.897, 0.386 ], "quaternion": [ 0.779, -0.458, 0.312, 0.295 ] } }, { "index": 13, "nt1": "///A/19", "nt2": "///A/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -113.174, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 52.453, "chi2": -102.883, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 55.505, "C1C1_dist": 11.062, "N1N9_dist": 9.291, "C6C8_dist": 10.110, "CNNC_torsion": -6.592, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[3.05],N3-N1(imino)[3.15],N4(amino)-O6(carbonyl)[3.08]", "interBase_angle": 9.766, "planarity": 0.114, "simple_Shear": -0.232, "simple_Stretch": 0.139, "simple_Buckle": -9.303, "simple_Propeller": 2.972, "bp_simpleParams": [ -0.232, 0.139, 0.489, -9.303, 2.972, -1.913 ], "bp_params": [ -0.235, 0.133, 0.489, -9.383, 2.708, -1.907 ], "frame": { "rmsd": null, "origin": [ 16.786, 19.055, 9.062 ], "x_axis": [ 0.129, 0.060, -0.990 ], "y_axis": [ -0.937, 0.335, -0.102 ], "z_axis": [ 0.325, 0.940, 0.099 ], "quaternion": [ 0.625, -0.417, 0.526, 0.399 ] } }, { "index": 14, "nt1": "///A/20", "nt2": "///A/25", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -100.351, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 51.200, "chi2": -105.036, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 51.793, "C1C1_dist": 11.081, "N1N9_dist": 9.203, "C6C8_dist": 9.884, "CNNC_torsion": -14.922, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.78],N1-N3(imino)[3.05]", "interBase_angle": 6.533, "planarity": 0.147, "simple_Shear": 0.123, "simple_Stretch": -0.041, "simple_Buckle": 6.161, "simple_Propeller": -2.173, "bp_simpleParams": [ 0.123, -0.041, 0.718, 6.161, -2.173, -10.036 ], "bp_params": [ 0.123, -0.043, 0.718, 6.129, -2.264, -10.023 ], "frame": { "rmsd": null, "origin": [ 17.095, 22.742, 9.953 ], "x_axis": [ -0.401, 0.146, -0.904 ], "y_axis": [ -0.857, 0.288, 0.427 ], "z_axis": [ 0.323, 0.946, 0.010 ], "quaternion": [ 0.474, -0.274, 0.648, 0.530 ] } }, { "index": 15, "nt1": "///A/21", "nt2": "///A/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -130.212, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 58.825, "chi2": -87.089, "conf2": "--", "pucker2": "~C2'-endo", "lambda2": 57.486, "C1C1_dist": 10.396, "N1N9_dist": 8.805, "C6C8_dist": 9.777, "CNNC_torsion": -4.957, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.71],N3-N1(imino)[2.95],N4(amino)-O6(carbonyl)[3.09]", "interBase_angle": 16.554, "planarity": 0.320, "simple_Shear": 0.333, "simple_Stretch": -0.122, "simple_Buckle": 16.002, "simple_Propeller": 4.240, "bp_simpleParams": [ 0.333, -0.122, 0.538, 16.002, 4.240, 4.953 ], "bp_params": [ 0.329, -0.133, 0.538, 16.133, 3.710, 4.906 ], "frame": { "rmsd": null, "origin": [ 16.391, 26.792, 9.208 ], "x_axis": [ -0.782, 0.113, -0.613 ], "y_axis": [ -0.580, 0.229, 0.781 ], "z_axis": [ 0.229, 0.967, -0.114 ], "quaternion": [ 0.289, -0.160, 0.729, 0.600 ] } } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 2, "strand1": "CGTGCAGCGGC", "strand2": "GCACGTCGCCG", "bp_type": "|||||||||||", "helix_form": "....BBx.BB", "helical_rise": 4.409, "helical_rise_std": 0.392, "helical_radius": 9.661, "helical_radius_std": 1.510, "helical_axis": [ -0.228, 0.964, -0.139 ], "point1": [ 6.746, -16.334, 0.860 ], "point2": [ -3.293, 26.103, -5.273 ], "num_pairs": 11, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.598, -0.121, 0.665, 5.827, 14.142, 2.639 ], "step_params": [ -0.371, 0.080, 5.372, 7.375, -2.033, 27.731 ], "heli_params": [ 0.904, 3.444, 5.087, -4.142, -15.027, 28.747 ], "bp2_params": [ -0.176, 0.032, 0.171, -2.106, -7.217, -2.342 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 5.372, "simple_Twist": 32.145, "simple_hRise": 5.148, "simple_hTwist": 33.020 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.176, 0.032, 0.171, -2.106, -7.217, -2.342 ], "step_params": [ -0.600, 0.287, 4.226, 2.256, 1.972, 27.959 ], "heli_params": [ -0.004, 1.917, 4.175, 4.066, -4.651, 28.116 ], "bp2_params": [ -0.411, 0.060, -0.216, -2.154, -6.164, -11.462 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.226, "simple_Twist": 29.384, "simple_hRise": 4.179, "simple_hTwist": 29.533 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/34", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.411, 0.060, -0.216, -2.154, -6.164, -11.462 ], "step_params": [ 1.722, 0.668, 3.741, -0.067, 7.410, 34.174 ], "heli_params": [ -0.193, -2.880, 3.795, 12.429, 0.112, 34.945 ], "bp2_params": [ 0.130, 0.088, -0.200, 6.457, 1.586, -2.068 ], "groove_widths": [ 18.305, null, 19.818, null ], "simple_Rise": 3.741, "simple_Twist": 31.295, "simple_hRise": 3.792, "simple_hTwist": 32.139 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.130, 0.088, -0.200, 6.457, 1.586, -2.068 ], "step_params": [ -0.045, -0.364, 5.610, -5.024, 2.996, 32.473 ], "heli_params": [ -1.513, -1.382, 5.500, 5.304, 8.893, 32.982 ], "bp2_params": [ 0.089, 0.072, 0.434, -16.460, 12.986, -0.107 ], "groove_widths": [ 18.198, 17.297, 21.540, 21.516 ], "simple_Rise": 5.610, "simple_Twist": 32.777, "simple_hRise": 5.502, "simple_hTwist": 33.280 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.089, 0.072, 0.434, -16.460, 12.986, -0.107 ], "step_params": [ 0.039, -0.151, 4.072, 5.874, -3.494, 26.615 ], "heli_params": [ 0.757, 1.725, 3.976, -7.434, -12.500, 27.463 ], "bp2_params": [ -0.035, -0.036, 0.657, 0.980, -3.136, -1.744 ], "groove_widths": [ 18.491, 17.424, 20.758, 20.720 ], "simple_Rise": 4.072, "simple_Twist": 27.077, "simple_hRise": 3.979, "simple_hTwist": 27.911 }, { "index": 6, "nt1": "///A/6", "nt2": "///A/31", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.035, -0.036, 0.657, 0.980, -3.136, -1.744 ], "step_params": [ 0.297, -0.480, 3.996, -0.148, 14.558, 30.019 ], "heli_params": [ -3.737, -0.548, 3.407, 26.253, 0.267, 33.290 ], "bp2_params": [ 0.428, 0.057, -0.531, 6.663, 8.774, -4.448 ], "groove_widths": [ 18.512, 17.622, 21.078, 20.405 ], "simple_Rise": 3.996, "simple_Twist": 27.777, "simple_hRise": 3.336, "simple_hTwist": 31.295 }, { "index": 7, "nt1": "///A/7", "nt2": "///A/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.428, 0.057, -0.531, 6.663, 8.774, -4.448 ], "step_params": [ 0.388, -0.571, 4.475, -3.824, -2.981, 35.444 ], "heli_params": [ -0.342, -1.387, 4.443, -4.868, 6.245, 35.764 ], "bp2_params": [ 0.284, 0.005, 0.303, 10.043, -2.518, -2.624 ], "groove_widths": [ 16.887, 16.357, 22.079, 21.718 ], "simple_Rise": 4.475, "simple_Twist": 35.923, "simple_hRise": 4.444, "simple_hTwist": 36.238 }, { "index": 8, "nt1": "///A/8", "nt2": "///A/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.284, 0.005, 0.303, 10.043, -2.518, -2.624 ], "step_params": [ 0.724, 0.174, 4.723, 6.226, -14.589, 31.584 ], "heli_params": [ 3.451, 0.155, 4.299, -24.933, -10.641, 35.252 ], "bp2_params": [ 0.101, 0.034, 0.773, 13.924, -7.501, 0.551 ], "groove_widths": [ 17.369, null, 22.500, null ], "simple_Rise": 4.723, "simple_Twist": 32.896, "simple_hRise": 4.331, "simple_hTwist": 36.425 }, { "index": 9, "nt1": "///A/9", "nt2": "///A/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.101, 0.034, 0.773, 13.924, -7.501, 0.551 ], "step_params": [ -0.123, 0.394, 4.919, 3.513, 17.497, 34.645 ], "heli_params": [ -2.692, 0.844, 4.566, 27.259, -5.473, 38.846 ], "bp2_params": [ 0.285, 0.149, -0.230, -8.001, -4.692, -1.805 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.919, "simple_Twist": 33.088, "simple_hRise": 4.528, "simple_hTwist": 37.475 }, { "index": 10, "nt1": "///A/10", "nt2": "///A/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.285, 0.149, -0.230, -8.001, -4.692, -1.805 ], "step_params": [ 0.627, 0.440, 2.880, -0.317, -3.711, 20.704 ], "heli_params": [ 2.563, -1.832, 2.750, -10.218, 0.873, 21.032 ], "bp2_params": [ 0.115, 0.020, -0.243, 15.645, 3.909, 1.419 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.880, "simple_Twist": 21.571, "simple_hRise": 2.757, "simple_hTwist": 21.887 }, { "index": 11, "nt1": "///A/11", "nt2": "///A/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 1, "strand1": "GCAC", "strand2": "CGTG", "bp_type": "||||", "helix_form": "BBB", "helical_rise": 4.394, "helical_rise_std": 0.121, "helical_radius": 9.055, "helical_radius_std": 2.370, "helical_axis": [ 0.072, 0.995, 0.074 ], "point1": [ 17.717, 14.061, 7.883 ], "point2": [ 18.677, 27.316, 8.866 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/18", "nt2": "///A/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.131, -0.018, -0.172, -3.799, 8.160, 2.188 ], "step_params": [ -0.532, 0.127, 4.598, -0.899, 17.821, 27.774 ], "heli_params": [ -4.123, 0.719, 3.977, 33.146, 1.673, 32.917 ], "bp2_params": [ -0.235, 0.133, 0.489, -9.383, 2.708, -1.907 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.598, "simple_Twist": 28.079, "simple_hRise": 3.988, "simple_hTwist": 33.173 }, { "index": 2, "nt1": "///A/19", "nt2": "///A/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.235, 0.133, 0.489, -9.383, 2.708, -1.907 ], "step_params": [ -0.531, 1.008, 3.631, 0.626, 5.095, 31.119 ], "heli_params": [ 0.780, 1.110, 3.734, 9.416, -1.157, 31.529 ], "bp2_params": [ 0.123, -0.043, 0.718, 6.129, -2.264, -10.023 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.631, "simple_Twist": 29.247, "simple_hRise": 3.737, "simple_hTwist": 29.685 }, { "index": 3, "nt1": "///A/20", "nt2": "///A/25", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.123, -0.043, 0.718, 6.129, -2.264, -10.023 ], "step_params": [ 1.551, 1.064, 3.731, 0.108, 8.989, 26.329 ], "heli_params": [ -0.369, -3.198, 3.882, 19.041, -0.229, 27.795 ], "bp2_params": [ 0.329, -0.133, 0.538, 16.133, 3.710, 4.906 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.731, "simple_Twist": 24.781, "simple_hRise": 3.878, "simple_hTwist": 26.338 }, { "index": 4, "nt1": "///A/21", "nt2": "///A/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_stems": 3, "stems": [ { "index": 1, "helix_index": 1, "strand1": "CGTGCAG", "strand2": "GCACGTC", "bp_type": "|||||||", "helix_form": "....BB", "helical_rise": 4.533, "helical_rise_std": 0.310, "helical_radius": 9.835, "helical_radius_std": 1.042, "helical_axis": [ -0.266, 0.957, -0.119 ], "point1": [ 6.628, -16.553, -0.102 ], "point2": [ -0.619, 9.502, -3.336 ], "num_pairs": 7, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/36", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.598, -0.121, 0.665, 5.827, 14.142, 2.639 ], "step_params": [ -0.371, 0.080, 5.372, 7.375, -2.033, 27.731 ], "heli_params": [ 0.904, 3.444, 5.087, -4.142, -15.027, 28.747 ], "bp2_params": [ -0.176, 0.032, 0.171, -2.106, -7.217, -2.342 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 5.372, "simple_Twist": 32.145, "simple_hRise": 5.148, "simple_hTwist": 33.020 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.176, 0.032, 0.171, -2.106, -7.217, -2.342 ], "step_params": [ -0.600, 0.287, 4.226, 2.256, 1.972, 27.959 ], "heli_params": [ -0.004, 1.917, 4.175, 4.066, -4.651, 28.116 ], "bp2_params": [ -0.411, 0.060, -0.216, -2.154, -6.164, -11.462 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.226, "simple_Twist": 29.384, "simple_hRise": 4.179, "simple_hTwist": 29.533 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/34", "bp": "T-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.411, 0.060, -0.216, -2.154, -6.164, -11.462 ], "step_params": [ 1.722, 0.668, 3.741, -0.067, 7.410, 34.174 ], "heli_params": [ -0.193, -2.880, 3.795, 12.429, 0.112, 34.945 ], "bp2_params": [ 0.130, 0.088, -0.200, 6.457, 1.586, -2.068 ], "groove_widths": [ 18.305, null, 19.818, null ], "simple_Rise": 3.741, "simple_Twist": 31.295, "simple_hRise": 3.792, "simple_hTwist": 32.139 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/33", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.130, 0.088, -0.200, 6.457, 1.586, -2.068 ], "step_params": [ -0.045, -0.364, 5.610, -5.024, 2.996, 32.473 ], "heli_params": [ -1.513, -1.382, 5.500, 5.304, 8.893, 32.982 ], "bp2_params": [ 0.089, 0.072, 0.434, -16.460, 12.986, -0.107 ], "groove_widths": [ 18.198, null, 21.540, null ], "simple_Rise": 5.610, "simple_Twist": 32.777, "simple_hRise": 5.502, "simple_hTwist": 33.280 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/32", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.089, 0.072, 0.434, -16.460, 12.986, -0.107 ], "step_params": [ 0.039, -0.151, 4.072, 5.874, -3.494, 26.615 ], "heli_params": [ 0.757, 1.725, 3.976, -7.434, -12.500, 27.463 ], "bp2_params": [ -0.035, -0.036, 0.657, 0.980, -3.136, -1.744 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.072, "simple_Twist": 27.077, "simple_hRise": 3.979, "simple_hTwist": 27.911 }, { "index": 6, "nt1": "///A/6", "nt2": "///A/31", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.035, -0.036, 0.657, 0.980, -3.136, -1.744 ], "step_params": [ 0.297, -0.480, 3.996, -0.148, 14.558, 30.019 ], "heli_params": [ -3.737, -0.548, 3.407, 26.253, 0.267, 33.290 ], "bp2_params": [ 0.428, 0.057, -0.531, 6.663, 8.774, -4.448 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.996, "simple_Twist": 27.777, "simple_hRise": 3.336, "simple_hTwist": 31.295 }, { "index": 7, "nt1": "///A/7", "nt2": "///A/30", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "CGGC", "strand2": "GCCG", "bp_type": "||||", "helix_form": ".BB", "helical_rise": 4.229, "helical_rise_std": 0.490, "helical_radius": 9.043, "helical_radius_std": 2.246, "helical_axis": [ -0.176, 0.973, -0.152 ], "point1": [ 0.988, 14.383, -2.786 ], "point2": [ -1.236, 26.709, -4.718 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/8", "nt2": "///A/17", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.284, 0.005, 0.303, 10.043, -2.518, -2.624 ], "step_params": [ 0.724, 0.174, 4.723, 6.226, -14.589, 31.584 ], "heli_params": [ 3.451, 0.155, 4.299, -24.933, -10.641, 35.252 ], "bp2_params": [ 0.101, 0.034, 0.773, 13.924, -7.501, 0.551 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.723, "simple_Twist": 32.896, "simple_hRise": 4.331, "simple_hTwist": 36.425 }, { "index": 2, "nt1": "///A/9", "nt2": "///A/16", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.101, 0.034, 0.773, 13.924, -7.501, 0.551 ], "step_params": [ -0.123, 0.394, 4.919, 3.513, 17.497, 34.645 ], "heli_params": [ -2.692, 0.844, 4.566, 27.259, -5.473, 38.846 ], "bp2_params": [ 0.285, 0.149, -0.230, -8.001, -4.692, -1.805 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.919, "simple_Twist": 33.088, "simple_hRise": 4.528, "simple_hTwist": 37.475 }, { "index": 3, "nt1": "///A/10", "nt2": "///A/15", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.285, 0.149, -0.230, -8.001, -4.692, -1.805 ], "step_params": [ 0.627, 0.440, 2.880, -0.317, -3.711, 20.704 ], "heli_params": [ 2.563, -1.832, 2.750, -10.218, 0.873, 21.032 ], "bp2_params": [ 0.115, 0.020, -0.243, 15.645, 3.909, 1.419 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.880, "simple_Twist": 21.571, "simple_hRise": 2.757, "simple_hTwist": 21.887 }, { "index": 4, "nt1": "///A/11", "nt2": "///A/14", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "GCAC", "strand2": "CGTG", "bp_type": "||||", "helix_form": "BBB", "helical_rise": 4.394, "helical_rise_std": 0.121, "helical_radius": 9.055, "helical_radius_std": 2.370, "helical_axis": [ 0.072, 0.995, 0.074 ], "point1": [ 17.717, 14.061, 7.883 ], "point2": [ 18.677, 27.316, 8.866 ], "num_pairs": 4, "pairs": [ { "index": 1, "nt1": "///A/18", "nt2": "///A/27", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.131, -0.018, -0.172, -3.799, 8.160, 2.188 ], "step_params": [ -0.532, 0.127, 4.598, -0.899, 17.821, 27.774 ], "heli_params": [ -4.123, 0.719, 3.977, 33.146, 1.673, 32.917 ], "bp2_params": [ -0.235, 0.133, 0.489, -9.383, 2.708, -1.907 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.598, "simple_Twist": 28.079, "simple_hRise": 3.988, "simple_hTwist": 33.173 }, { "index": 2, "nt1": "///A/19", "nt2": "///A/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.235, 0.133, 0.489, -9.383, 2.708, -1.907 ], "step_params": [ -0.531, 1.008, 3.631, 0.626, 5.095, 31.119 ], "heli_params": [ 0.780, 1.110, 3.734, 9.416, -1.157, 31.529 ], "bp2_params": [ 0.123, -0.043, 0.718, 6.129, -2.264, -10.023 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.631, "simple_Twist": 29.247, "simple_hRise": 3.737, "simple_hTwist": 29.685 }, { "index": 3, "nt1": "///A/20", "nt2": "///A/25", "bp": "A-T", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.123, -0.043, 0.718, 6.129, -2.264, -10.023 ], "step_params": [ 1.551, 1.064, 3.731, 0.108, 8.989, 26.329 ], "heli_params": [ -0.369, -3.198, 3.882, 19.041, -0.229, 27.795 ], "bp2_params": [ 0.329, -0.133, 0.538, 16.133, 3.710, 4.906 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.731, "simple_Twist": 24.781, "simple_hRise": 3.878, "simple_hTwist": 26.338 }, { "index": 4, "nt1": "///A/21", "nt2": "///A/24", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 2 ] } ], "num_stacks": 4, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "CT", "nts_long": "///A/11,///A/13" }, { "index": 2, "num_nts": 2, "nts_short": "GC", "nts_long": "///A/17,///A/30" }, { "index": 3, "num_nts": 2, "nts_short": "GT", "nts_long": "///A/18,///A/29" }, { "index": 4, "num_nts": 2, "nts_short": "CT", "nts_long": "///A/21,///A/23" } ], "nonStack": { "num_nts": 8, "nts_short": "CCCTTTCG", "nts_long": "///A/1,///A/5,///A/8,///A/12,///A/22,///A/28,///A/33,///A/36" }, "num_atom2bases": 2, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///A/13/O4'", "nt": "///A/14", "vert_dist": 3.000 }, { "index": 2, "type": "sugar", "atom": "///A/23/O4'", "nt": "///A/24", "vert_dist": 2.864 } ], "num_hairpins": 2, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 2 ], "stem_indices": [ 2 ], "summary": "[1] 2 [A.11 A.14] 4", "num_nts": 4, "nts_short": "CTTG", "nts_long": "///A/11,///A/12,///A/13,///A/14", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "TT", "nts_long": "///A/12,///A/13" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 2 ], "stem_indices": [ 3 ], "summary": "[1] 2 [A.21 A.24] 4", "num_nts": 4, "nts_short": "CTTG", "nts_long": "///A/21,///A/22,///A/23,///A/24", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "TT", "nts_long": "///A/22,///A/23" } ] } ], "num_junctions": 1, "junctions": [ { "index": 1, "type": "3-way junction", "bridging_nts": [ 0, 0, 2 ], "stem_indices": [ 1, 2, 3 ], "summary": "[3] 0 0 2 [A.7 A.30 A.8 A.17 A.18 A.27] 7 4 4", "num_nts": 8, "nts_short": "GCGGCTTC", "nts_long": "///A/7,///A/8,///A/17,///A/18,///A/27,///A/28,///A/29,///A/30", "num_stems": 3, "bridges": [ { "index": 1, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 2, "num_nts": 0, "nts_short": "", "nts_long": "" }, { "index": 3, "num_nts": 2, "nts_short": "TT", "nts_long": "///A/28,///A/29" } ] } ], "num_splayUnits": 4, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "TT", "nts_long": "///A/12,///A/13" }, { "index": 2, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/17,///A/18" }, { "index": 3, "num_nts": 2, "nts_short": "TT", "nts_long": "///A/22,///A/23" }, { "index": 4, "num_nts": 2, "nts_short": "TC", "nts_long": "///A/29,///A/30" } ], "dbn": { "all_chains": { "num_nts": 36, "num_chars": 36, "bseq": "CGTGCAGCGGCTTGCCGGCACTTGTGCTTCTGCACG", "sstr": "(((((((((((..))))((((..))))..)))))))", "form": ".BB..B..BB...B....BB....BB....B..B.-" }, "m1_chain_A": { "num_nts": 36, "num_chars": 36, "bseq": "CGTGCAGCGGCTTGCCGGCACTTGTGCTTCTGCACG", "sstr": "(((((((((((..))))((((..))))..)))))))", "form": ".BB..B..BB...B....BB....BB....B..B.-" } }, "chains": { "m1_chain_A": { "num_nts": 36, "bseq": "CGTGCAGCGGCTTGCCGGCACTTGTGCTTCTGCACG", "sstr": "(((((((((((..))))((((..))))..)))))))", "form": ".BB..B..BB...B....BB....BB....B..B.-", "helical_rise": 0.023, "helical_rise_std": 2.646, "helical_axis": [ -0.577, -0.171, 0.799 ], "point1": [ 8.484, 10.323, 4.518 ], "point2": [ 7.942, 10.163, 5.269 ], "num_chars": 106, "suite": "C!!G!!T!!G!!C!!A!!G!!C!!G!!G!!C2zT!!T!!G!!C!!C!!G!!G!!C!!A!!C2zT!!T!!G!!T!!G!!C!!T!!T!!C!!T!!G!!C!!A!!C!!G" } }, "num_nts": 36, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 1, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/1", "linked_nts": [ null, "///A/2" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 51.808, "delta": 127.603, "epsilon": -167.536, "zeta": -104.383, "epsilon_zeta": -63.152, "bb_type": "BI", "chi": -122.645, "glyco_bond": "anti", "C5prime_xyz": [ -1.454, 8.515, -1.102 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 2.735, "Dp": 2.890, "splay_angle": 30.552, "splay_distance": 5.177, "splay_ratio": 0.265, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -1.691, "v1": 7.307, "v2": -9.726, "v3": 8.951, "v4": -4.568, "amplitude": 9.836, "phase_angle": 188.587, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.013, "origin": [ 5.615, -16.734, 0.872 ], "x_axis": [ -0.436, -0.154, 0.887 ], "y_axis": [ 0.819, 0.340, 0.462 ], "z_axis": [ -0.373, 0.928, -0.022 ], "quaternion": [ -0.470, 0.248, 0.671, 0.518 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.178, "beta": 177.478, "gamma": 52.772, "delta": 126.426, "epsilon": -173.386, "zeta": -98.876, "epsilon_zeta": -74.510, "bb_type": "BI", "chi": -103.536, "glyco_bond": "anti", "C5prime_xyz": [ -2.219, 8.258, -2.150 ], "P_xyz": [ 0.299, 9.131, -2.362 ], "form": "B", "ssZp": 2.139, "Dp": 2.687, "splay_angle": 23.619, "splay_distance": 4.109, "splay_ratio": 0.205, "d22": null, "d64": null, "eta": -174.546, "theta": -145.634, "eta_prime": -154.233, "theta_prime": -156.266, "eta_base": -131.980, "theta_base": -136.062, "v0": -14.024, "v1": 18.518, "v2": -15.676, "v3": 7.660, "v4": 4.066, "amplitude": 18.281, "phase_angle": 149.036, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 4.319, -11.914, -0.505 ], "x_axis": [ -0.117, 0.204, 0.972 ], "y_axis": [ 0.927, 0.373, 0.034 ], "z_axis": [ -0.356, 0.905, -0.233 ], "quaternion": [ 0.506, -0.431, -0.656, -0.357 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 3, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.948, "beta": -179.584, "gamma": 49.440, "delta": 121.266, "epsilon": -169.835, "zeta": -93.263, "epsilon_zeta": -76.572, "bb_type": "BI", "chi": -102.803, "glyco_bond": "anti", "C5prime_xyz": [ -2.756, 8.236, -2.118 ], "P_xyz": [ -0.524, 9.585, -2.651 ], "form": "B", "ssZp": 2.426, "Dp": 2.694, "splay_angle": 24.775, "splay_distance": 4.280, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 174.225, "theta": -143.878, "eta_prime": -169.475, "theta_prime": -148.088, "eta_base": -144.490, "theta_base": -102.457, "v0": -17.954, "v1": 20.417, "v2": -15.037, "v3": 4.762, "v4": 8.414, "amplitude": 20.311, "phase_angle": 137.759, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.025, "origin": [ 2.826, -8.336, -1.865 ], "x_axis": [ 0.268, 0.313, 0.911 ], "y_axis": [ 0.871, 0.326, -0.368 ], "z_axis": [ -0.412, 0.892, -0.185 ], "quaternion": [ 0.593, -0.531, -0.558, -0.235 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 4, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.237, "beta": 168.496, "gamma": 55.285, "delta": 127.679, "epsilon": -171.144, "zeta": -111.695, "epsilon_zeta": -59.449, "bb_type": "BI", "chi": -105.547, "glyco_bond": "anti", "C5prime_xyz": [ -2.796, 8.389, -1.963 ], "P_xyz": [ -0.457, 9.526, -2.536 ], "form": ".", "ssZp": 2.556, "Dp": 2.658, "splay_angle": 35.069, "splay_distance": 5.931, "splay_ratio": 0.301, "d22": null, "d64": null, "eta": 170.063, "theta": -155.458, "eta_prime": -160.164, "theta_prime": -164.167, "eta_base": -110.123, "theta_base": -133.308, "v0": -23.911, "v1": 28.672, "v2": -22.058, "v3": 8.230, "v4": 9.914, "amplitude": 28.239, "phase_angle": 141.362, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 3.102, -4.111, -1.244 ], "x_axis": [ 0.820, 0.288, 0.495 ], "y_axis": [ 0.460, 0.183, -0.869 ], "z_axis": [ -0.341, 0.940, 0.017 ], "quaternion": [ 0.711, -0.636, -0.294, -0.060 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 5, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,non-stack,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.202, "beta": -175.674, "gamma": 59.892, "delta": 119.528, "epsilon": -171.992, "zeta": -93.567, "epsilon_zeta": -78.425, "bb_type": "BI", "chi": -128.097, "glyco_bond": "anti", "C5prime_xyz": [ -1.973, 8.856, -0.946 ], "P_xyz": [ 0.514, 9.813, -0.720 ], "form": ".", "ssZp": 3.036, "Dp": 2.954, "splay_angle": 24.383, "splay_distance": 4.191, "splay_ratio": 0.212, "d22": null, "d64": null, "eta": 179.379, "theta": -147.702, "eta_prime": -169.461, "theta_prime": -153.649, "eta_base": -134.251, "theta_base": -133.880, "v0": -15.241, "v1": 16.960, "v2": -12.154, "v3": 3.369, "v4": 7.601, "amplitude": 16.967, "phase_angle": 135.756, "puckering": "C1'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.010, "origin": [ 1.215, 1.510, -1.384 ], "x_axis": [ 0.989, 0.144, -0.039 ], "y_axis": [ -0.000, -0.262, -0.965 ], "z_axis": [ -0.149, 0.954, -0.259 ], "quaternion": [ 0.606, -0.792, -0.045, 0.059 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 6, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.920, "beta": -179.249, "gamma": 61.912, "delta": 120.144, "epsilon": -174.192, "zeta": -85.297, "epsilon_zeta": -88.896, "bb_type": "BI", "chi": -106.507, "glyco_bond": "anti", "C5prime_xyz": [ -2.721, 8.381, -2.061 ], "P_xyz": [ -0.466, 9.655, -2.667 ], "form": "B", "ssZp": 2.454, "Dp": 2.718, "splay_angle": 19.549, "splay_distance": 3.447, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": -177.181, "theta": -140.785, "eta_prime": -156.817, "theta_prime": -149.713, "eta_base": -132.792, "theta_base": -120.522, "v0": -22.045, "v1": 24.173, "v2": -17.043, "v3": 4.364, "v4": 11.182, "amplitude": 24.237, "phase_angle": 134.683, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.019, "origin": [ 0.094, 5.548, -1.387 ], "x_axis": [ 0.826, 0.278, -0.490 ], "y_axis": [ -0.473, -0.130, -0.871 ], "z_axis": [ -0.305, 0.952, 0.024 ], "quaternion": [ 0.656, -0.695, 0.070, 0.286 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 7, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -78.860, "beta": -175.099, "gamma": 49.897, "delta": 127.954, "epsilon": -176.923, "zeta": -118.028, "epsilon_zeta": -58.895, "bb_type": "BI", "chi": -103.823, "glyco_bond": "anti", "C5prime_xyz": [ -2.912, 8.372, -1.982 ], "P_xyz": [ -0.798, 9.980, -2.349 ], "form": ".", "ssZp": 2.640, "Dp": 2.621, "splay_angle": 29.649, "splay_distance": 4.935, "splay_ratio": 0.256, "d22": null, "d64": null, "eta": 157.056, "theta": -167.526, "eta_prime": -177.657, "theta_prime": -173.401, "eta_base": -140.648, "theta_base": -135.969, "v0": -23.897, "v1": 29.436, "v2": -23.303, "v3": 9.581, "v4": 9.097, "amplitude": 28.947, "phase_angle": 143.615, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 0.047, 8.971, -1.784 ], "x_axis": [ 0.561, -0.164, -0.811 ], "y_axis": [ -0.828, -0.136, -0.545 ], "z_axis": [ -0.021, 0.977, -0.212 ], "quaternion": [ 0.551, -0.691, 0.359, 0.301 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 8, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,non-stack,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -62.859, "beta": 172.665, "gamma": 66.611, "delta": 117.361, "epsilon": -165.510, "zeta": -98.653, "epsilon_zeta": -66.857, "bb_type": "BI", "chi": -123.766, "glyco_bond": "anti", "C5prime_xyz": [ -1.947, 8.751, -1.248 ], "P_xyz": [ 0.618, 9.405, -1.586 ], "form": ".", "ssZp": 2.882, "Dp": 3.030, "splay_angle": 29.578, "splay_distance": 5.014, "splay_ratio": 0.256, "d22": null, "d64": null, "eta": -173.358, "theta": -148.329, "eta_prime": -162.847, "theta_prime": -154.373, "eta_base": -124.534, "theta_base": -123.960, "v0": -12.487, "v1": 12.964, "v2": -8.572, "v3": 1.383, "v4": 7.053, "amplitude": 13.257, "phase_angle": 130.289, "puckering": "C1'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.009, "origin": [ -0.135, 13.805, -2.763 ], "x_axis": [ -0.048, -0.133, -0.990 ], "y_axis": [ -0.994, -0.092, 0.061 ], "z_axis": [ -0.099, 0.987, -0.128 ], "quaternion": [ -0.428, 0.541, -0.521, -0.503 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 9, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.788, "beta": 171.364, "gamma": 67.131, "delta": 119.849, "epsilon": -168.626, "zeta": -92.225, "epsilon_zeta": -76.401, "bb_type": "BI", "chi": -104.954, "glyco_bond": "anti", "C5prime_xyz": [ -2.495, 8.291, -2.213 ], "P_xyz": [ -0.071, 9.049, -3.027 ], "form": "B", "ssZp": 2.154, "Dp": 2.758, "splay_angle": 25.629, "splay_distance": 4.430, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": -170.444, "theta": -143.748, "eta_prime": -147.593, "theta_prime": -152.440, "eta_base": -116.205, "theta_base": -119.887, "v0": -16.678, "v1": 18.070, "v2": -12.670, "v3": 3.163, "v4": 8.590, "amplitude": 18.191, "phase_angle": 134.145, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ -0.991, 18.701, -3.427 ], "x_axis": [ -0.596, 0.113, -0.795 ], "y_axis": [ -0.791, 0.089, 0.605 ], "z_axis": [ 0.139, 0.990, 0.037 ], "quaternion": [ 0.364, -0.264, 0.642, 0.621 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 10, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.857, "beta": -176.251, "gamma": 52.768, "delta": 124.816, "epsilon": -157.450, "zeta": -51.365, "epsilon_zeta": -106.086, "bb_type": "BI", "chi": -105.494, "glyco_bond": "anti", "C5prime_xyz": [ -2.237, 8.318, -2.118 ], "P_xyz": [ 0.190, 9.438, -2.251 ], "form": "B", "ssZp": 1.933, "Dp": 2.635, "splay_angle": 16.577, "splay_distance": 2.958, "splay_ratio": 0.144, "d22": null, "d64": null, "eta": 173.086, "theta": -123.826, "eta_prime": -167.535, "theta_prime": -146.563, "eta_base": -131.554, "theta_base": -117.153, "v0": -14.933, "v1": 18.479, "v2": -14.853, "v3": 6.371, "v4": 5.460, "amplitude": 18.224, "phase_angle": 144.588, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ -1.716, 23.069, -3.266 ], "x_axis": [ -0.922, -0.210, -0.325 ], "y_axis": [ -0.337, 0.024, 0.941 ], "z_axis": [ -0.190, 0.977, -0.093 ], "quaternion": [ 0.047, -0.192, 0.714, 0.672 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 11, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop", "alpha": -121.118, "beta": 75.381, "gamma": 166.069, "delta": 137.578, "epsilon": -171.908, "zeta": -88.370, "epsilon_zeta": -83.538, "bb_type": "BI", "chi": -137.087, "glyco_bond": "anti", "C5prime_xyz": [ -1.770, 8.838, -0.315 ], "P_xyz": [ -1.747, 9.593, -2.895 ], "form": ".", "ssZp": 2.411, "Dp": 2.463, "splay_angle": 47.739, "splay_distance": 7.493, "splay_ratio": 0.405, "d22": 7.332, "d64": 8.592, "eta": -131.380, "theta": 147.374, "eta_prime": -152.815, "theta_prime": 145.048, "eta_base": -122.461, "theta_base": 80.181, "v0": -18.259, "v1": 28.607, "v2": -27.211, "v3": 16.908, "v4": 0.850, "amplitude": 28.994, "phase_angle": 159.802, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.011, "origin": [ -2.804, 25.816, -3.409 ], "x_axis": [ -0.984, -0.168, 0.055 ], "y_axis": [ 0.004, 0.294, 0.956 ], "z_axis": [ -0.177, 0.941, -0.288 ], "quaternion": [ -0.072, -0.051, 0.801, 0.592 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 12, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart", "alpha": -175.775, "beta": 173.610, "gamma": 53.288, "delta": 133.848, "epsilon": -112.401, "zeta": -115.486, "epsilon_zeta": 3.085, "bb_type": "--", "chi": -149.917, "glyco_bond": "anti", "C5prime_xyz": [ -1.645, 8.723, 0.434 ], "P_xyz": [ 0.733, 8.894, 1.643 ], "form": ".", "ssZp": 2.256, "Dp": 2.274, "splay_angle": 86.214, "splay_distance": 13.265, "splay_ratio": 0.685, "d22": 8.706, "d64": 10.441, "eta": 72.154, "theta": -113.837, "eta_prime": 92.320, "theta_prime": -114.352, "eta_base": 42.375, "theta_base": -89.266, "v0": -10.192, "v1": 18.326, "v2": -19.011, "v3": 13.353, "v4": -1.938, "amplitude": 19.491, "phase_angle": 167.261, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2z", "suiteness": 0.067, "filter_rmsd": 0.101, "frame": { "rmsd": 0.024, "origin": [ 3.899, 23.052, -1.518 ], "x_axis": [ 0.267, -0.300, 0.916 ], "y_axis": [ -0.009, 0.949, 0.314 ], "z_axis": [ -0.964, -0.092, 0.251 ], "quaternion": [ 0.785, 0.129, -0.598, -0.093 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 13, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,cap-donor,splayed-apart", "alpha": -39.598, "beta": 172.558, "gamma": 62.662, "delta": 134.448, "epsilon": -75.431, "zeta": 144.109, "epsilon_zeta": 140.460, "bb_type": "BII", "chi": -138.488, "glyco_bond": "anti", "C5prime_xyz": [ -1.721, 8.766, -0.233 ], "P_xyz": [ 0.862, 9.069, 0.408 ], "form": ".", "ssZp": 1.314, "Dp": 1.584, "splay_angle": 38.281, "splay_distance": 6.540, "splay_ratio": 0.368, "d22": null, "d64": null, "eta": -123.938, "theta": 117.357, "eta_prime": -101.614, "theta_prime": 97.617, "eta_base": -91.509, "theta_base": 77.126, "v0": -12.031, "v1": 20.102, "v2": -19.980, "v3": 13.233, "v4": -0.715, "amplitude": 20.835, "phase_angle": 163.526, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.023, "origin": [ -7.911, 29.055, -0.835 ], "x_axis": [ 0.240, 0.435, 0.868 ], "y_axis": [ 0.880, 0.281, -0.384 ], "z_axis": [ -0.411, 0.855, -0.316 ], "quaternion": [ 0.549, -0.564, -0.582, -0.202 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 14, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,cap-acceptor", "alpha": -172.892, "beta": 82.120, "gamma": 122.278, "delta": 128.471, "epsilon": 176.300, "zeta": -89.327, "epsilon_zeta": -94.373, "bb_type": "BI", "chi": -102.556, "glyco_bond": "anti", "C5prime_xyz": [ -1.346, 7.802, -2.222 ], "P_xyz": [ -1.102, 5.924, -4.134 ], "form": "B", "ssZp": 1.847, "Dp": 2.885, "splay_angle": 17.104, "splay_distance": 3.005, "splay_ratio": 0.150, "d22": null, "d64": null, "eta": 102.949, "theta": -126.789, "eta_prime": 170.228, "theta_prime": 158.940, "eta_base": 157.364, "theta_base": 177.564, "v0": 7.316, "v1": -0.038, "v2": -6.536, "v3": 10.952, "v4": -11.543, "amplitude": 11.695, "phase_angle": 236.025, "puckering": "C4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ -2.725, 26.066, -3.471 ], "x_axis": [ -0.994, -0.105, 0.020 ], "y_axis": [ -0.018, -0.024, -1.000 ], "z_axis": [ 0.106, -0.994, 0.022 ], "quaternion": [ -0.031, 0.044, -0.698, 0.714 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 15, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.393, "beta": 166.774, "gamma": 58.100, "delta": 117.883, "epsilon": -169.287, "zeta": -93.470, "epsilon_zeta": -75.817, "bb_type": "BI", "chi": -107.116, "glyco_bond": "anti", "C5prime_xyz": [ -2.740, 8.379, -1.996 ], "P_xyz": [ -0.400, 9.408, -2.706 ], "form": ".", "ssZp": 2.443, "Dp": 2.731, "splay_angle": 31.760, "splay_distance": 5.449, "splay_ratio": 0.274, "d22": 4.926, "d64": 4.387, "eta": 173.018, "theta": -147.021, "eta_prime": -165.642, "theta_prime": -153.459, "eta_base": -143.410, "theta_base": -119.764, "v0": -16.913, "v1": 18.050, "v2": -12.365, "v3": 2.660, "v4": 8.982, "amplitude": 18.244, "phase_angle": 132.668, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.015, "origin": [ -1.451, 23.347, -3.358 ], "x_axis": [ -0.916, -0.286, -0.282 ], "y_axis": [ 0.337, -0.166, -0.927 ], "z_axis": [ 0.218, -0.944, 0.248 ], "quaternion": [ -0.204, -0.021, -0.613, 0.763 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 16, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -58.346, "beta": -170.846, "gamma": 44.474, "delta": 121.614, "epsilon": 168.865, "zeta": -99.478, "epsilon_zeta": -91.657, "bb_type": "BI", "chi": -110.439, "glyco_bond": "anti", "C5prime_xyz": [ -2.035, 8.405, -1.925 ], "P_xyz": [ 0.281, 9.691, -1.673 ], "form": ".", "ssZp": 2.169, "Dp": 2.538, "splay_angle": 26.797, "splay_distance": 4.557, "splay_ratio": 0.232, "d22": null, "d64": null, "eta": 176.070, "theta": -162.656, "eta_prime": -162.665, "theta_prime": -171.338, "eta_base": -125.426, "theta_base": -140.023, "v0": -11.415, "v1": 14.696, "v2": -12.247, "v3": 5.768, "v4": 3.574, "amplitude": 14.505, "phase_angle": 147.604, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.012, "origin": [ -0.905, 17.926, -3.410 ], "x_axis": [ -0.588, -0.017, -0.808 ], "y_axis": [ 0.798, 0.152, -0.584 ], "z_axis": [ 0.133, -0.988, -0.076 ], "quaternion": [ 0.349, 0.290, 0.674, -0.583 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 17, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart", "alpha": -35.440, "beta": 175.763, "gamma": 46.834, "delta": 128.621, "epsilon": 176.287, "zeta": -149.249, "epsilon_zeta": -34.463, "bb_type": "--", "chi": -114.730, "glyco_bond": "anti", "C5prime_xyz": [ -2.011, 8.583, -1.653 ], "P_xyz": [ 0.376, 9.714, -1.219 ], "form": ".", "ssZp": 1.933, "Dp": 2.307, "splay_angle": 170.489, "splay_distance": 18.751, "splay_ratio": 0.997, "d22": null, "d64": null, "eta": -171.309, "theta": 144.362, "eta_prime": -150.827, "theta_prime": 111.189, "eta_base": -118.741, "theta_base": -157.612, "v0": -17.170, "v1": 24.635, "v2": -22.353, "v3": 12.616, "v4": 2.991, "amplitude": 24.678, "phase_angle": 154.932, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ -0.054, 13.556, -2.440 ], "x_axis": [ -0.085, -0.184, -0.979 ], "y_axis": [ 0.958, 0.254, -0.131 ], "z_axis": [ 0.273, -0.949, 0.154 ], "quaternion": [ 0.575, 0.356, 0.544, -0.496 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 18, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,splayed-apart", "alpha": -43.448, "beta": -131.690, "gamma": 163.111, "delta": 112.919, "epsilon": -167.164, "zeta": -91.347, "epsilon_zeta": -75.817, "bb_type": "BI", "chi": -123.209, "glyco_bond": "anti", "C5prime_xyz": [ -2.023, 8.687, -1.365 ], "P_xyz": [ -0.276, 8.393, -3.371 ], "form": ".", "ssZp": 2.965, "Dp": 3.284, "splay_angle": 29.258, "splay_distance": 4.989, "splay_ratio": 0.253, "d22": null, "d64": null, "eta": -13.892, "theta": -155.710, "eta_prime": -2.595, "theta_prime": -168.781, "eta_base": -95.968, "theta_base": -148.925, "v0": -13.127, "v1": 8.936, "v2": -1.801, "v3": -5.893, "v4": 12.005, "amplitude": 13.108, "phase_angle": 97.896, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 15.795, 14.710, 7.512 ], "x_axis": [ 0.601, 0.116, -0.791 ], "y_axis": [ -0.764, 0.375, -0.526 ], "z_axis": [ 0.236, 0.920, 0.314 ], "quaternion": [ 0.757, -0.478, 0.339, 0.291 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 19, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -70.302, "beta": -169.792, "gamma": 55.182, "delta": 119.844, "epsilon": -167.405, "zeta": -99.432, "epsilon_zeta": -67.973, "bb_type": "BI", "chi": -113.174, "glyco_bond": "anti", "C5prime_xyz": [ -1.918, 8.491, -1.791 ], "P_xyz": [ 0.552, 9.491, -1.665 ], "form": "B", "ssZp": 2.315, "Dp": 2.850, "splay_angle": 22.319, "splay_distance": 3.870, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 178.818, "theta": -150.777, "eta_prime": -165.399, "theta_prime": -153.795, "eta_base": -142.195, "theta_base": -128.503, "v0": -10.211, "v1": 12.048, "v2": -9.259, "v3": 3.423, "v4": 4.320, "amplitude": 11.931, "phase_angle": 140.902, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.009, "origin": [ 16.788, 19.300, 9.196 ], "x_axis": [ 0.138, 0.033, -0.990 ], "y_axis": [ -0.958, 0.257, -0.125 ], "z_axis": [ 0.250, 0.966, 0.067 ], "quaternion": [ 0.605, -0.451, 0.513, 0.410 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 20, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.476, "beta": 176.019, "gamma": 56.655, "delta": 125.490, "epsilon": -153.810, "zeta": -54.862, "epsilon_zeta": -98.948, "bb_type": "BI", "chi": -100.351, "glyco_bond": "anti", "C5prime_xyz": [ -2.373, 8.093, -2.338 ], "P_xyz": [ 0.105, 8.946, -2.813 ], "form": "B", "ssZp": 1.752, "Dp": 2.576, "splay_angle": 23.551, "splay_distance": 4.152, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 179.456, "theta": -117.885, "eta_prime": -162.428, "theta_prime": -137.739, "eta_base": -135.475, "theta_base": -97.350, "v0": -16.089, "v1": 19.885, "v2": -15.920, "v3": 6.805, "v4": 5.953, "amplitude": 19.588, "phase_angle": 144.366, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.018, "origin": [ 17.205, 23.084, 9.892 ], "x_axis": [ -0.319, 0.135, -0.938 ], "y_axis": [ -0.870, 0.351, 0.346 ], "z_axis": [ 0.376, 0.927, 0.005 ], "quaternion": [ 0.509, -0.285, 0.645, 0.493 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 21, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "DNA", "dbn": "(", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop", "alpha": -128.893, "beta": 89.195, "gamma": 156.746, "delta": 141.580, "epsilon": -171.171, "zeta": -97.361, "epsilon_zeta": -73.809, "bb_type": "BI", "chi": -130.212, "glyco_bond": "anti", "C5prime_xyz": [ -1.594, 8.690, -0.688 ], "P_xyz": [ -1.036, 9.168, -3.275 ], "form": ".", "ssZp": 2.076, "Dp": 2.357, "splay_angle": 50.042, "splay_distance": 7.902, "splay_ratio": 0.424, "d22": 6.816, "d64": 8.215, "eta": -136.959, "theta": 147.249, "eta_prime": -149.152, "theta_prime": 144.086, "eta_base": -109.454, "theta_base": 82.578, "v0": -14.210, "v1": 26.757, "v2": -27.956, "v3": 20.141, "v4": -3.716, "amplitude": 28.503, "phase_angle": 168.752, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.010, "origin": [ 16.363, 27.056, 9.025 ], "x_axis": [ -0.812, 0.097, -0.575 ], "y_axis": [ -0.510, 0.359, 0.782 ], "z_axis": [ 0.282, 0.928, -0.242 ], "quaternion": [ 0.276, -0.133, 0.777, 0.550 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 22, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,BI,non-stack,hairpin-loop,splayed-apart", "alpha": -165.594, "beta": 176.961, "gamma": 52.139, "delta": 138.419, "epsilon": -161.803, "zeta": -67.252, "epsilon_zeta": -94.551, "bb_type": "BI", "chi": -130.328, "glyco_bond": "anti", "C5prime_xyz": [ -1.573, 8.639, -0.635 ], "P_xyz": [ 0.896, 9.014, 0.332 ], "form": ".", "ssZp": 2.294, "Dp": 2.461, "splay_angle": 88.322, "splay_distance": 13.202, "splay_ratio": 0.697, "d22": 7.663, "d64": 9.527, "eta": 64.351, "theta": -94.937, "eta_prime": 89.669, "theta_prime": -105.753, "eta_base": 46.610, "theta_base": -81.874, "v0": -8.643, "v1": 19.607, "v2": -22.379, "v3": 17.734, "v4": -5.661, "amplitude": 22.435, "phase_angle": 175.969, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "2z", "suiteness": 0.086, "filter_rmsd": 0.101, "frame": { "rmsd": 0.023, "origin": [ 19.649, 22.676, 14.721 ], "x_axis": [ -0.675, -0.274, 0.686 ], "y_axis": [ -0.107, 0.955, 0.276 ], "z_axis": [ -0.730, 0.113, -0.674 ], "quaternion": [ -0.389, -0.105, 0.909, 0.107 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 23, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "DNA", "dbn": ".", "summary": "turn,anti,BII,non-pair-contact,hairpin-loop,cap-donor,splayed-apart", "alpha": -91.466, "beta": -131.381, "gamma": 68.124, "delta": 114.767, "epsilon": -63.940, "zeta": 128.126, "epsilon_zeta": 167.934, "bb_type": "BII", "chi": -145.244, "glyco_bond": "anti", "C5prime_xyz": [ -1.583, 8.833, 0.108 ], "P_xyz": [ 0.907, 9.011, 1.123 ], "form": ".", "ssZp": 2.734, "Dp": 2.672, "splay_angle": 39.577, "splay_distance": 6.709, "splay_ratio": 0.369, "d22": null, "d64": null, "eta": -132.910, "theta": 121.991, "eta_prime": -113.423, "theta_prime": 109.386, "eta_base": -94.065, "theta_base": 84.528, "v0": -8.276, "v1": 6.100, "v2": -1.851, "v3": -3.026, "v4": 7.139, "amplitude": 8.186, "phase_angle": 103.067, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.024, "origin": [ 12.251, 31.722, 8.579 ], "x_axis": [ -0.181, 0.544, 0.820 ], "y_axis": [ 0.942, -0.142, 0.303 ], "z_axis": [ 0.281, 0.827, -0.487 ], "quaternion": [ -0.218, 0.602, 0.617, 0.457 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 24, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "DNA", "dbn": ")", "summary": "~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,cap-acceptor", "alpha": -166.981, "beta": 98.171, "gamma": 119.129, "delta": 128.971, "epsilon": -177.951, "zeta": -113.765, "epsilon_zeta": -64.186, "bb_type": "BI", "chi": -87.089, "glyco_bond": "--", "C5prime_xyz": [ -2.608, 7.609, -2.773 ], "P_xyz": [ -2.009, 5.783, -4.656 ], "form": ".", "ssZp": 1.756, "Dp": 2.553, "splay_angle": 24.372, "splay_distance": 4.214, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 146.154, "theta": -179.344, "eta_prime": 175.740, "theta_prime": 150.402, "eta_base": 161.573, "theta_base": 172.326, "v0": -8.972, "v1": 15.563, "v2": -15.749, "v3": 10.815, "v4": -1.072, "amplitude": 16.277, "phase_angle": 165.376, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 16.420, 26.529, 9.392 ], "x_axis": [ -0.748, 0.140, -0.648 ], "y_axis": [ 0.641, -0.098, -0.761 ], "z_axis": [ -0.170, -0.985, -0.017 ], "quaternion": [ -0.185, -0.303, -0.646, 0.676 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 25, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/25", "linked_nts": [ "///A/24", "///A/26" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -69.088, "beta": 170.433, "gamma": 65.527, "delta": 117.087, "epsilon": -168.813, "zeta": -98.578, "epsilon_zeta": -70.234, "bb_type": "BI", "chi": -105.036, "glyco_bond": "anti", "C5prime_xyz": [ -2.473, 8.227, -2.242 ], "P_xyz": [ -0.037, 8.981, -3.013 ], "form": "B", "ssZp": 2.080, "Dp": 2.777, "splay_angle": 21.618, "splay_distance": 3.756, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 176.889, "theta": -151.554, "eta_prime": -172.199, "theta_prime": -159.611, "eta_base": -154.201, "theta_base": -119.161, "v0": -13.671, "v1": 14.244, "v2": -9.498, "v3": 1.665, "v4": 7.600, "amplitude": 14.532, "phase_angle": 130.814, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.026, "origin": [ 16.986, 22.399, 10.015 ], "x_axis": [ -0.481, 0.148, -0.864 ], "y_axis": [ 0.834, -0.225, -0.503 ], "z_axis": [ -0.268, -0.963, -0.015 ], "quaternion": [ -0.264, -0.435, -0.564, 0.650 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 26, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/26", "linked_nts": [ "///A/25", "///A/27" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.858, "beta": 170.705, "gamma": 58.131, "delta": 122.567, "epsilon": -168.625, "zeta": -100.681, "epsilon_zeta": -67.944, "bb_type": "BI", "chi": -102.883, "glyco_bond": "anti", "C5prime_xyz": [ -2.337, 8.231, -2.227 ], "P_xyz": [ 0.173, 8.925, -2.802 ], "form": "B", "ssZp": 2.113, "Dp": 2.749, "splay_angle": 24.227, "splay_distance": 4.271, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 171.455, "theta": -120.719, "eta_prime": -166.113, "theta_prime": -144.279, "eta_base": -122.724, "theta_base": -118.351, "v0": -14.326, "v1": 16.875, "v2": -12.940, "v3": 4.739, "v4": 6.086, "amplitude": 16.711, "phase_angle": 140.741, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 16.783, 18.810, 8.928 ], "x_axis": [ 0.122, 0.089, -0.989 ], "y_axis": [ 0.909, -0.409, 0.076 ], "z_axis": [ -0.398, -0.908, -0.131 ], "quaternion": [ 0.382, 0.645, 0.387, -0.538 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 27, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/27", "linked_nts": [ "///A/26", "///A/28" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop", "alpha": 149.589, "beta": -171.672, "gamma": 175.643, "delta": 119.250, "epsilon": -179.106, "zeta": -77.316, "epsilon_zeta": -101.790, "bb_type": "BI", "chi": -135.396, "glyco_bond": "anti", "C5prime_xyz": [ -1.663, 8.824, -0.654 ], "P_xyz": [ -0.157, 9.767, -2.664 ], "form": ".", "ssZp": 2.928, "Dp": 2.992, "splay_angle": 40.240, "splay_distance": 6.514, "splay_ratio": 0.345, "d22": 7.021, "d64": 7.752, "eta": 168.142, "theta": -166.941, "eta_prime": -175.500, "theta_prime": 157.543, "eta_base": -140.663, "theta_base": 81.286, "v0": -10.791, "v1": 10.836, "v2": -6.867, "v3": 0.632, "v4": 6.451, "amplitude": 11.255, "phase_angle": 127.598, "puckering": "C1'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.010, "origin": [ 15.902, 14.894, 7.469 ], "x_axis": [ 0.660, 0.228, -0.715 ], "y_axis": [ 0.725, -0.441, 0.529 ], "z_axis": [ -0.195, -0.868, -0.456 ], "quaternion": [ 0.437, 0.800, 0.298, -0.285 ] } }, { "index": 28, "index_chain": 28, "chain_name": "A", "nt_resnum": 28, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/28", "linked_nts": [ "///A/27", "///A/29" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,non-stack,non-pair-contact,junction-loop", "alpha": -161.460, "beta": 167.384, "gamma": 59.717, "delta": 125.201, "epsilon": -128.597, "zeta": -110.901, "epsilon_zeta": -17.696, "bb_type": "--", "chi": -169.146, "glyco_bond": "anti", "C5prime_xyz": [ -2.061, 8.640, 1.302 ], "P_xyz": [ 0.220, 8.782, 2.689 ], "form": ".", "ssZp": 2.544, "Dp": 2.676, "splay_angle": 69.962, "splay_distance": 10.879, "splay_ratio": 0.574, "d22": 8.592, "d64": 9.932, "eta": 86.186, "theta": -132.307, "eta_prime": 99.405, "theta_prime": -130.251, "eta_base": 46.590, "theta_base": -106.622, "v0": -14.123, "v1": 17.129, "v2": -13.539, "v3": 5.435, "v4": 5.557, "amplitude": 16.947, "phase_angle": 143.022, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.024, "origin": [ 14.376, 16.376, 13.626 ], "x_axis": [ 0.620, 0.227, 0.751 ], "y_axis": [ 0.117, -0.973, 0.198 ], "z_axis": [ 0.776, -0.035, -0.630 ], "quaternion": [ 0.065, 0.898, 0.096, 0.425 ] } }, { "index": 29, "index_chain": 29, "chain_name": "A", "nt_resnum": 29, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/29", "linked_nts": [ "///A/28", "///A/30" ], "nt_type": "DNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,junction-loop,splayed-apart", "alpha": -47.453, "beta": -171.786, "gamma": 60.232, "delta": 131.870, "epsilon": -78.419, "zeta": -174.715, "epsilon_zeta": 96.296, "bb_type": "BII", "chi": -132.822, "glyco_bond": "anti", "C5prime_xyz": [ -1.521, 8.679, -0.604 ], "P_xyz": [ 0.977, 9.047, 0.287 ], "form": ".", "ssZp": 1.187, "Dp": 1.988, "splay_angle": 130.400, "splay_distance": 19.462, "splay_ratio": 0.908, "d22": 13.114, "d64": 16.362, "eta": -121.998, "theta": 145.700, "eta_prime": -109.597, "theta_prime": 162.582, "eta_base": -100.602, "theta_base": -163.903, "v0": -8.140, "v1": 15.355, "v2": -16.259, "v3": 11.752, "v4": -2.232, "amplitude": 16.550, "phase_angle": 169.237, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.023, "origin": [ 18.070, 13.822, 3.717 ], "x_axis": [ 0.783, -0.381, 0.491 ], "y_axis": [ -0.615, -0.590, 0.523 ], "z_axis": [ 0.091, -0.712, -0.696 ], "quaternion": [ 0.352, 0.876, -0.284, 0.166 ] } }, { "index": 30, "index_chain": 30, "chain_name": "A", "nt_resnum": 30, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/30", "linked_nts": [ "///A/29", "///A/31" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart", "alpha": -88.923, "beta": -99.323, "gamma": 3.753, "delta": 119.547, "epsilon": -154.074, "zeta": -78.155, "epsilon_zeta": -75.920, "bb_type": "BI", "chi": -149.554, "glyco_bond": "anti", "C5prime_xyz": [ -1.606, 8.922, 0.315 ], "P_xyz": [ -1.629, 10.387, 2.580 ], "form": ".", "ssZp": 3.396, "Dp": 3.088, "splay_angle": 27.254, "splay_distance": 4.645, "splay_ratio": 0.236, "d22": 5.430, "d64": 4.972, "eta": -111.228, "theta": -145.752, "eta_prime": -146.333, "theta_prime": -132.524, "eta_base": -168.335, "theta_base": -102.998, "v0": -12.312, "v1": 14.364, "v2": -10.906, "v3": 3.736, "v4": 5.447, "amplitude": 14.283, "phase_angle": 139.777, "puckering": "C1'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.010, "origin": [ -0.188, 9.542, -1.487 ], "x_axis": [ 0.479, -0.029, -0.877 ], "y_axis": [ 0.855, 0.242, 0.459 ], "z_axis": [ 0.199, -0.970, 0.141 ], "quaternion": [ 0.682, 0.523, 0.394, -0.324 ] } }, { "index": 31, "index_chain": 31, "chain_name": "A", "nt_resnum": 31, "nt_name": "DT", "nt_code": "T", "nt_id": "///A/31", "linked_nts": [ "///A/30", "///A/32" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -82.785, "beta": -163.107, "gamma": 50.752, "delta": 119.874, "epsilon": -170.596, "zeta": -100.954, "epsilon_zeta": -69.642, "bb_type": "BI", "chi": -108.922, "glyco_bond": "anti", "C5prime_xyz": [ -2.342, 8.369, -1.942 ], "P_xyz": [ -0.072, 9.769, -1.895 ], "form": "B", "ssZp": 2.417, "Dp": 2.805, "splay_angle": 22.952, "splay_distance": 3.962, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 163.838, "theta": -155.461, "eta_prime": -169.407, "theta_prime": -158.653, "eta_base": -139.102, "theta_base": -131.784, "v0": -14.132, "v1": 15.755, "v2": -11.340, "v3": 3.259, "v4": 6.929, "amplitude": 15.731, "phase_angle": 136.123, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.100, "frame": { "rmsd": 0.024, "origin": [ 0.294, 4.922, -1.437 ], "x_axis": [ 0.827, 0.221, -0.517 ], "y_axis": [ 0.494, 0.154, 0.856 ], "z_axis": [ 0.268, -0.963, 0.018 ], "quaternion": [ 0.707, 0.643, 0.278, -0.096 ] } }, { "index": 32, "index_chain": 32, "chain_name": "A", "nt_resnum": 32, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/32", "linked_nts": [ "///A/31", "///A/33" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.526, "beta": 173.610, "gamma": 54.173, "delta": 122.486, "epsilon": -169.141, "zeta": -106.674, "epsilon_zeta": -62.466, "bb_type": "BI", "chi": -112.164, "glyco_bond": "anti", "C5prime_xyz": [ -2.407, 8.525, -1.750 ], "P_xyz": [ 0.020, 9.586, -2.027 ], "form": ".", "ssZp": 2.535, "Dp": 2.736, "splay_angle": 31.138, "splay_distance": 5.314, "splay_ratio": 0.269, "d22": null, "d64": null, "eta": 172.814, "theta": -154.664, "eta_prime": -168.705, "theta_prime": -160.784, "eta_base": -137.816, "theta_base": -131.190, "v0": -16.976, "v1": 19.631, "v2": -14.727, "v3": 5.034, "v4": 7.555, "amplitude": 19.455, "phase_angle": 139.196, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 1.243, 1.080, -1.258 ], "x_axis": [ 0.931, 0.360, -0.067 ], "y_axis": [ 0.076, -0.011, 0.997 ], "z_axis": [ 0.358, -0.933, -0.038 ], "quaternion": [ 0.686, 0.704, 0.155, 0.104 ] } }, { "index": 33, "index_chain": 33, "chain_name": "A", "nt_resnum": 33, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/33", "linked_nts": [ "///A/32", "///A/34" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.502, "beta": 175.909, "gamma": 58.885, "delta": 123.330, "epsilon": -164.279, "zeta": -118.065, "epsilon_zeta": -46.213, "bb_type": "BI", "chi": -120.305, "glyco_bond": "anti", "C5prime_xyz": [ -2.182, 8.718, -1.349 ], "P_xyz": [ 0.309, 9.656, -1.429 ], "form": ".", "ssZp": 2.753, "Dp": 2.769, "splay_angle": 24.133, "splay_distance": 4.075, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": -178.390, "theta": -163.327, "eta_prime": -162.175, "theta_prime": -166.655, "eta_base": -129.489, "theta_base": -144.324, "v0": -18.586, "v1": 21.467, "v2": -16.033, "v3": 5.416, "v4": 8.451, "amplitude": 21.285, "phase_angle": 138.872, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.009, "origin": [ 2.889, -3.973, -1.237 ], "x_axis": [ 0.828, 0.319, 0.462 ], "y_axis": [ -0.467, -0.065, 0.882 ], "z_axis": [ 0.311, -0.946, 0.095 ], "quaternion": [ 0.681, 0.671, -0.055, 0.288 ] } }, { "index": 34, "index_chain": 34, "chain_name": "A", "nt_resnum": 34, "nt_name": "DA", "nt_code": "A", "nt_id": "///A/34", "linked_nts": [ "///A/33", "///A/35" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.571, "beta": -178.697, "gamma": 56.802, "delta": 122.616, "epsilon": -172.534, "zeta": -88.420, "epsilon_zeta": -84.114, "bb_type": "BI", "chi": -113.099, "glyco_bond": "anti", "C5prime_xyz": [ -1.587, 8.306, -1.757 ], "P_xyz": [ 1.060, 8.668, -1.833 ], "form": "B", "ssZp": 2.466, "Dp": 3.051, "splay_angle": 25.958, "splay_distance": 4.452, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 173.092, "theta": -138.080, "eta_prime": -175.383, "theta_prime": -147.156, "eta_base": -149.609, "theta_base": -115.758, "v0": -4.605, "v1": 7.940, "v2": -8.040, "v3": 5.441, "v4": -0.517, "amplitude": 8.320, "phase_angle": 165.094, "puckering": "C2'-endo", "sugar_class": "pucker-CHK", "bin": "22p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.019, "origin": [ 2.842, -8.039, -1.504 ], "x_axis": [ 0.478, 0.278, 0.833 ], "y_axis": [ -0.781, -0.301, 0.548 ], "z_axis": [ 0.403, -0.912, 0.074 ], "quaternion": [ 0.559, 0.653, -0.192, 0.474 ] } }, { "index": 35, "index_chain": 35, "chain_name": "A", "nt_resnum": 35, "nt_name": "DC", "nt_code": "C", "nt_id": "///A/35", "linked_nts": [ "///A/34", "///A/36" ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.414, "beta": 172.657, "gamma": 60.045, "delta": 118.996, "epsilon": -166.565, "zeta": -93.173, "epsilon_zeta": -73.393, "bb_type": "BI", "chi": -117.408, "glyco_bond": "anti", "C5prime_xyz": [ -2.138, 8.627, -1.587 ], "P_xyz": [ 0.375, 9.453, -1.844 ], "form": ".", "ssZp": 2.562, "Dp": 2.859, "splay_angle": 32.615, "splay_distance": 5.624, "splay_ratio": 0.281, "d22": null, "d64": null, "eta": 177.897, "theta": -144.100, "eta_prime": -157.492, "theta_prime": -149.575, "eta_base": -119.335, "theta_base": -123.795, "v0": -15.258, "v1": 16.535, "v2": -11.568, "v3": 2.878, "v4": 7.917, "amplitude": 16.645, "phase_angle": 134.028, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.067, "frame": { "rmsd": 0.011, "origin": [ 4.341, -12.055, -0.303 ], "x_axis": [ -0.032, 0.106, 0.994 ], "y_axis": [ -0.916, -0.400, 0.013 ], "z_axis": [ 0.399, -0.910, 0.110 ], "quaternion": [ 0.412, 0.561, -0.361, 0.621 ] } }, { "index": 36, "index_chain": 36, "chain_name": "A", "nt_resnum": 36, "nt_name": "DG", "nt_code": "G", "nt_id": "///A/36", "linked_nts": [ "///A/35", null ], "nt_type": "DNA", "dbn": ")", "summary": "anti,~C2'-endo,non-stack,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -61.942, "beta": -171.864, "gamma": 48.679, "delta": 124.310, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -114.169, "glyco_bond": "anti", "C5prime_xyz": [ -2.157, 8.571, -1.683 ], "P_xyz": [ 0.173, 9.844, -1.428 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -15.343, "v1": 18.309, "v2": -14.329, "v3": 5.631, "v4": 6.127, "amplitude": 18.123, "phase_angle": 142.248, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.021, "frame": { "rmsd": 0.021, "origin": [ 6.192, -17.308, 0.482 ], "x_axis": [ -0.541, 0.068, 0.838 ], "y_axis": [ -0.824, -0.241, -0.513 ], "z_axis": [ 0.168, -0.968, 0.186 ], "quaternion": [ 0.318, 0.358, -0.528, 0.702 ] } } ], "num_hbonds": 45, "hbonds": [ { "index": 1, "atom1_serNum": 11, "atom2_serNum": 1124, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/1/O2", "atom2_id": "///A/36/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 12, "atom2_serNum": 1122, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/1/N3", "atom2_id": "///A/36/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 14, "atom2_serNum": 1121, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/1/N4", "atom2_id": "///A/36/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 44, "atom2_serNum": 1091, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/2/O6", "atom2_id": "///A/35/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 45, "atom2_serNum": 1089, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/2/N1", "atom2_id": "///A/35/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 47, "atom2_serNum": 1088, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/2/N2", "atom2_id": "///A/35/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 75, "atom2_serNum": 1060, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///A/3/N3", "atom2_id": "///A/34/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 77, "atom2_serNum": 1059, "donAcc_type": "standard", "distance": 2.748, "atom1_id": "///A/3/O4", "atom2_id": "///A/34/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 109, "atom2_serNum": 1029, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/4/O6", "atom2_id": "///A/33/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 110, "atom2_serNum": 1027, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/4/N1", "atom2_id": "///A/33/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 112, "atom2_serNum": 1026, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/4/N2", "atom2_id": "///A/33/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 139, "atom2_serNum": 999, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/5/O2", "atom2_id": "///A/32/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 140, "atom2_serNum": 997, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/5/N3", "atom2_id": "///A/32/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 142, "atom2_serNum": 996, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/5/N4", "atom2_id": "///A/32/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 172, "atom2_serNum": 964, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/6/N6", "atom2_id": "///A/31/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 173, "atom2_serNum": 962, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/6/N1", "atom2_id": "///A/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 204, "atom2_serNum": 934, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/7/O6", "atom2_id": "///A/30/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 205, "atom2_serNum": 932, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///A/7/N1", "atom2_id": "///A/30/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 207, "atom2_serNum": 931, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/7/N2", "atom2_id": "///A/30/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 234, "atom2_serNum": 523, "donAcc_type": "standard", "distance": 3.031, "atom1_id": "///A/8/O2", "atom2_id": "///A/17/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 235, "atom2_serNum": 521, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/8/N3", "atom2_id": "///A/17/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 237, "atom2_serNum": 520, "donAcc_type": "standard", "distance": 3.023, "atom1_id": "///A/8/N4", "atom2_id": "///A/17/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 267, "atom2_serNum": 490, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///A/9/O6", "atom2_id": "///A/16/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 268, "atom2_serNum": 488, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/9/N1", "atom2_id": "///A/16/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 270, "atom2_serNum": 487, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/9/N2", "atom2_id": "///A/16/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 300, "atom2_serNum": 460, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/10/O6", "atom2_id": "///A/15/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 301, "atom2_serNum": 458, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/10/N1", "atom2_id": "///A/15/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 303, "atom2_serNum": 360, "donAcc_type": "standard", "distance": 3.526, "atom1_id": "///A/10/N2", "atom2_id": "///A/12/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 303, "atom2_serNum": 457, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/10/N2", "atom2_id": "///A/15/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 330, "atom2_serNum": 430, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/11/O2", "atom2_id": "///A/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 331, "atom2_serNum": 428, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/11/N3", "atom2_id": "///A/14/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 333, "atom2_serNum": 427, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///A/11/N4", "atom2_id": "///A/14/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 360, "atom2_serNum": 430, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/12/O2", "atom2_id": "///A/14/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 553, "atom2_serNum": 840, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/18/O6", "atom2_id": "///A/27/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 554, "atom2_serNum": 838, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/18/N1", "atom2_id": "///A/27/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 556, "atom2_serNum": 837, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/18/N2", "atom2_id": "///A/27/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 556, "atom2_serNum": 867, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/18/N2", "atom2_id": "///A/28/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 583, "atom2_serNum": 810, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/19/O2", "atom2_id": "///A/26/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 584, "atom2_serNum": 808, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///A/19/N3", "atom2_id": "///A/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 586, "atom2_serNum": 807, "donAcc_type": "standard", "distance": 3.080, "atom1_id": "///A/19/N4", "atom2_id": "///A/26/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 616, "atom2_serNum": 775, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/20/N6", "atom2_id": "///A/25/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 617, "atom2_serNum": 773, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/20/N1", "atom2_id": "///A/25/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 645, "atom2_serNum": 745, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/21/O2", "atom2_id": "///A/24/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 646, "atom2_serNum": 743, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/21/N3", "atom2_id": "///A/24/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 648, "atom2_serNum": 742, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/21/N4", "atom2_id": "///A/24/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1snj", "num_naChains": 1, "naChains": "A=36", "num_atoms": 1137, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 16, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 3, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 4, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 5, "name": "dssr-junctions.pdb", "desc": "an ensemble of junctions (multi-branch)" }, { "index": 6, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 7, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 8, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 9, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 10, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 11, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 12, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 13, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 14, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 15, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }