{ "num_pairs": 33, "pairs": [ { "index": 1, "nt1": "///B/902", "nt2": "///B/971", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 176.284, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.844, "chi2": -151.839, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.171, "C1C1_dist": 10.935, "N1N9_dist": 9.053, "C6C8_dist": 9.788, "CNNC_torsion": -1.736, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.64],N1(imino)-N3[2.98],N2(amino)-O2(carbonyl)[3.19]", "interBase_angle": 11.690, "planarity": 0.161, "simple_Shear": -0.338, "simple_Stretch": -0.156, "simple_Buckle": -11.657, "simple_Propeller": 0.871, "bp_simpleParams": [ -0.338, -0.156, -0.030, -11.657, 0.871, -8.751 ], "bp_params": [ -0.333, -0.167, -0.030, -11.679, 0.509, -8.706 ], "frame": { "rmsd": null, "origin": [ 43.322, 41.106, 33.841 ], "x_axis": [ -0.202, -0.772, 0.603 ], "y_axis": [ -0.227, 0.636, 0.738 ], "z_axis": [ -0.953, 0.012, -0.304 ], "quaternion": [ 0.532, 0.341, -0.732, -0.256 ] } }, { "index": 2, "nt1": "///B/903", "nt2": "///B/970", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.374, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.524, "chi2": -161.704, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.829, "C1C1_dist": 10.434, "N1N9_dist": 8.826, "C6C8_dist": 9.845, "CNNC_torsion": -1.884, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.81],N2(amino)-O2(carbonyl)[2.56]", "interBase_angle": 5.853, "planarity": 0.081, "simple_Shear": -0.206, "simple_Stretch": -0.183, "simple_Buckle": -1.172, "simple_Propeller": -5.734, "bp_simpleParams": [ -0.206, -0.183, 0.155, -1.172, -5.734, 3.226 ], "bp_params": [ -0.204, -0.186, 0.155, -1.081, -5.752, 3.230 ], "frame": { "rmsd": null, "origin": [ 40.490, 39.405, 32.638 ], "x_axis": [ -0.183, -0.270, 0.945 ], "y_axis": [ -0.079, 0.962, 0.260 ], "z_axis": [ -0.980, -0.028, -0.197 ], "quaternion": [ 0.629, 0.114, -0.765, -0.076 ] } }, { "index": 3, "nt1": "///B/904", "nt2": "///B/969", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.692, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.976, "chi2": -164.034, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.943, "C1C1_dist": 10.517, "N1N9_dist": 8.883, "C6C8_dist": 9.882, "CNNC_torsion": -15.017, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.96],N1(imino)-N3[2.84],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 20.145, "planarity": 0.236, "simple_Shear": 0.008, "simple_Stretch": -0.119, "simple_Buckle": -8.895, "simple_Propeller": -18.075, "bp_simpleParams": [ 0.008, -0.119, 0.046, -8.895, -18.075, 2.546 ], "bp_params": [ 0.007, -0.119, 0.046, -9.051, -17.998, 2.570 ], "frame": { "rmsd": null, "origin": [ 37.106, 37.526, 32.504 ], "x_axis": [ -0.154, 0.328, 0.932 ], "y_axis": [ -0.027, 0.942, -0.336 ], "z_axis": [ -0.988, -0.077, -0.136 ], "quaternion": [ 0.643, -0.101, -0.747, 0.138 ] } }, { "index": 4, "nt1": "///B/905", "nt2": "///B/968", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.528, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.094, "chi2": -149.045, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.716, "C1C1_dist": 10.561, "N1N9_dist": 8.892, "C6C8_dist": 9.823, "CNNC_torsion": -6.948, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.95],N1(imino)-N3[2.92],N2(amino)-O2(carbonyl)[2.85]", "interBase_angle": 28.527, "planarity": 0.301, "simple_Shear": -0.042, "simple_Stretch": -0.041, "simple_Buckle": -22.574, "simple_Propeller": -17.441, "bp_simpleParams": [ -0.042, -0.041, -0.737, -22.574, -17.441, 2.688 ], "bp_params": [ -0.042, -0.041, -0.737, -22.889, -17.025, 2.666 ], "frame": { "rmsd": null, "origin": [ 33.656, 35.930, 34.317 ], "x_axis": [ 0.032, 0.757, 0.653 ], "y_axis": [ -0.181, 0.647, -0.741 ], "z_axis": [ -0.983, -0.094, 0.158 ], "quaternion": [ 0.678, -0.239, -0.603, 0.346 ] } }, { "index": 5, "nt1": "///B/906", "nt2": "///B/967", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.080, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.416, "chi2": -150.255, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.715, "C1C1_dist": 10.405, "N1N9_dist": 8.833, "C6C8_dist": 9.900, "CNNC_torsion": -11.696, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.92],O4(carbonyl)-N6(amino)[3.23]", "interBase_angle": 20.370, "planarity": 0.242, "simple_Shear": -0.119, "simple_Stretch": 0.073, "simple_Buckle": -17.348, "simple_Propeller": -10.676, "bp_simpleParams": [ -0.119, 0.073, 0.254, -17.348, -10.676, 6.064 ], "bp_params": [ -0.120, 0.071, 0.254, -17.257, -10.823, 6.023 ], "frame": { "rmsd": null, "origin": [ 30.693, 35.325, 35.945 ], "x_axis": [ 0.060, 0.982, 0.178 ], "y_axis": [ -0.136, 0.184, -0.973 ], "z_axis": [ -0.989, 0.035, 0.145 ], "quaternion": [ 0.589, -0.428, -0.495, 0.474 ] } }, { "index": 6, "nt1": "///B/907", "nt2": "///B/966", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -143.259, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 55.467, "chi2": -169.027, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.763, "C1C1_dist": 10.529, "N1N9_dist": 8.875, "C6C8_dist": 9.858, "CNNC_torsion": -7.705, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.01],N1-N3(imino)[2.86]", "interBase_angle": 10.867, "planarity": 0.129, "simple_Shear": 0.039, "simple_Stretch": -0.062, "simple_Buckle": 8.865, "simple_Propeller": -6.286, "bp_simpleParams": [ 0.039, -0.062, 0.233, 8.865, -6.286, 1.554 ], "bp_params": [ 0.038, -0.063, 0.233, 8.827, -6.339, 1.551 ], "frame": { "rmsd": null, "origin": [ 28.314, 36.111, 37.747 ], "x_axis": [ 0.022, 0.932, -0.362 ], "y_axis": [ -0.233, -0.348, -0.908 ], "z_axis": [ -0.972, 0.104, 0.209 ], "quaternion": [ 0.470, -0.539, -0.325, 0.619 ] } }, { "index": 7, "nt1": "///B/908", "nt2": "///B/914", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -159.965, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 35.123, "chi2": -174.873, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 17.868, "C1C1_dist": 9.569, "N1N9_dist": 7.094, "C6C8_dist": 6.201, "CNNC_torsion": -172.716, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.75],N3(imino)-N7[2.82]", "interBase_angle": 8.163, "planarity": 0.145, "simple_Shear": 4.679, "simple_Stretch": 1.150, "simple_Buckle": -5.572, "simple_Propeller": 5.966, "bp_simpleParams": [ 4.679, 1.150, 0.979, -5.572, 5.966, -92.591 ], "bp_params": [ 4.181, -2.395, 0.979, 0.081, 8.163, -92.736 ], "frame": { "rmsd": null, "origin": [ 16.833, 26.364, 26.272 ], "x_axis": [ 0.947, 0.261, 0.188 ], "y_axis": [ -0.214, 0.072, 0.974 ], "z_axis": [ 0.240, -0.963, 0.124 ], "quaternion": [ 0.732, 0.662, 0.018, 0.162 ] } }, { "index": 8, "nt1": "///B/908", "nt2": "///B/921", "bp": "U+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -159.965, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 101.211, "chi2": -143.984, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.675, "C1C1_dist": 8.089, "N1N9_dist": 8.126, "C6C8_dist": 10.488, "CNNC_torsion": 150.981, "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-N1[2.59]", "interBase_angle": 30.695, "planarity": 0.368, "simple_Shear": 7.138, "simple_Stretch": 4.532, "simple_Buckle": 3.540, "simple_Propeller": -30.490, "bp_simpleParams": [ 7.138, 4.532, 0.980, 3.540, -30.490, -144.567 ], "bp_params": [ -2.679, -8.020, 0.980, -21.924, 21.482, -144.524 ], "frame": { "rmsd": null, "origin": [ 17.948, 25.967, 29.614 ], "x_axis": [ 0.796, 0.148, 0.587 ], "y_axis": [ -0.541, -0.262, 0.799 ], "z_axis": [ 0.272, -0.954, -0.128 ], "quaternion": [ 0.593, 0.739, -0.133, 0.291 ] } }, { "index": 9, "nt1": "///B/909", "nt2": "///B/923", "bp": "C+G", "name": "--", "Saenger": "--", "LW": "tHH", "DSSR": "tM+M", "intra_chain": true, "chi1": -79.232, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 16.109, "chi2": -176.411, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 14.033, "C1C1_dist": 12.684, "N1N9_dist": 9.861, "C6C8_dist": 8.349, "CNNC_torsion": 71.335, "hbonds_num": 1, "hbonds_desc": "N4(amino)-O6(carbonyl)[3.26]", "interBase_angle": 34.852, "planarity": 0.407, "simple_Shear": -7.439, "simple_Stretch": 1.691, "simple_Buckle": 20.542, "simple_Propeller": 28.155, "bp_simpleParams": [ -7.439, 1.691, 0.340, 20.542, 28.155, 171.524 ], "bp_params": [ 4.475, -6.178, 0.340, -33.975, -7.770, 171.157 ], "frame": { "rmsd": null, "origin": [ 17.828, 19.606, 27.542 ], "x_axis": [ -0.952, -0.111, -0.286 ], "y_axis": [ 0.282, 0.045, -0.958 ], "z_axis": [ 0.119, -0.993, -0.011 ], "quaternion": [ 0.143, 0.060, 0.708, -0.689 ] } }, { "index": 10, "nt1": "///B/910", "nt2": "///B/925", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 179.902, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.458, "chi2": -163.394, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.308, "C1C1_dist": 10.380, "N1N9_dist": 8.788, "C6C8_dist": 9.816, "CNNC_torsion": -0.596, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.10],N1(imino)-N3[2.94],N2(amino)-O2(carbonyl)[2.67]", "interBase_angle": 10.136, "planarity": 0.121, "simple_Shear": -0.847, "simple_Stretch": -0.157, "simple_Buckle": -8.503, "simple_Propeller": -5.518, "bp_simpleParams": [ -0.847, -0.157, -0.496, -8.503, -5.518, 4.916 ], "bp_params": [ -0.832, -0.223, -0.496, -8.052, -6.157, 4.911 ], "frame": { "rmsd": null, "origin": [ 22.358, 14.608, 29.385 ], "x_axis": [ -0.997, 0.079, -0.017 ], "y_axis": [ 0.004, 0.262, 0.965 ], "z_axis": [ 0.081, 0.962, -0.262 ], "quaternion": [ 0.031, 0.026, 0.794, 0.607 ] } }, { "index": 11, "nt1": "///B/911", "nt2": "///B/924", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.569, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.905, "chi2": -170.442, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.341, "C1C1_dist": 10.452, "N1N9_dist": 8.843, "C6C8_dist": 9.873, "CNNC_torsion": -4.933, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.56],N3-N1(imino)[2.82],N4(amino)-O6(carbonyl)[2.94]", "interBase_angle": 5.992, "planarity": 0.094, "simple_Shear": -0.248, "simple_Stretch": -0.132, "simple_Buckle": -5.391, "simple_Propeller": -2.615, "bp_simpleParams": [ -0.248, -0.132, -0.018, -5.391, -2.615, 3.731 ], "bp_params": [ -0.244, -0.139, -0.018, -5.314, -2.768, 3.728 ], "frame": { "rmsd": null, "origin": [ 22.487, 17.307, 27.038 ], "x_axis": [ -0.784, 0.204, 0.587 ], "y_axis": [ 0.616, 0.126, 0.778 ], "z_axis": [ 0.085, 0.971, -0.224 ], "quaternion": [ -0.172, 0.280, 0.730, 0.599 ] } }, { "index": 12, "nt1": "///B/912", "nt2": "///B/923", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -171.127, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.328, "chi2": -176.411, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.861, "C1C1_dist": 10.807, "N1N9_dist": 9.050, "C6C8_dist": 9.935, "CNNC_torsion": 9.727, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.98],N3-N1(imino)[3.00],N4(amino)-O6(carbonyl)[2.91]", "interBase_angle": 5.610, "planarity": 0.082, "simple_Shear": 0.302, "simple_Stretch": -0.083, "simple_Buckle": 2.161, "simple_Propeller": 5.177, "bp_simpleParams": [ 0.302, -0.083, -0.218, 2.161, 5.177, -2.452 ], "bp_params": [ 0.299, -0.091, -0.218, 2.296, 5.119, -2.454 ], "frame": { "rmsd": null, "origin": [ 20.711, 20.080, 25.365 ], "x_axis": [ -0.389, 0.199, 0.900 ], "y_axis": [ 0.921, 0.088, 0.379 ], "z_axis": [ -0.004, 0.976, -0.218 ], "quaternion": [ -0.347, 0.431, 0.651, 0.520 ] } }, { "index": 13, "nt1": "///B/913", "nt2": "///B/922", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -155.773, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 91.472, "chi2": -171.738, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 8.075, "C1C1_dist": 9.356, "N1N9_dist": 8.045, "C6C8_dist": 8.397, "CNNC_torsion": 120.872, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[2.91],N3-N6(amino)[2.64]", "interBase_angle": 4.137, "planarity": 0.071, "simple_Shear": 7.257, "simple_Stretch": 1.894, "simple_Buckle": 3.792, "simple_Propeller": 1.653, "bp_simpleParams": [ 7.257, 1.894, -0.273, 3.792, 1.653, -10.894 ], "bp_params": [ 6.252, -4.142, -0.273, 3.761, -1.723, -10.889 ], "frame": { "rmsd": null, "origin": [ 19.073, 23.366, 24.681 ], "x_axis": [ 0.540, 0.179, 0.822 ], "y_axis": [ 0.834, 0.012, -0.551 ], "z_axis": [ -0.109, 0.984, -0.143 ], "quaternion": [ 0.594, -0.646, -0.392, -0.276 ] } }, { "index": 14, "nt1": "///B/913", "nt2": "///B/945", "bp": "A+A", "name": "--", "Saenger": "--", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -155.773, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 30.449, "chi2": -102.840, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.695, "C1C1_dist": 14.058, "N1N9_dist": 11.812, "C6C8_dist": 12.259, "CNNC_torsion": 138.563, "hbonds_num": 1, "hbonds_desc": "N6(amino)-N1[3.85]", "interBase_angle": 26.235, "planarity": 0.366, "simple_Shear": -0.477, "simple_Stretch": 2.601, "simple_Buckle": -16.547, "simple_Propeller": -20.359, "bp_simpleParams": [ -0.477, 2.601, -0.043, -16.547, -20.359, 169.948 ], "bp_params": [ -2.585, -0.560, -0.043, 20.909, -15.847, 169.873 ], "frame": { "rmsd": null, "origin": [ 18.152, 23.556, 29.361 ], "x_axis": [ -0.813, -0.182, 0.553 ], "y_axis": [ 0.561, 0.014, 0.828 ], "z_axis": [ -0.158, 0.983, 0.091 ], "quaternion": [ -0.270, 0.144, 0.659, 0.687 ] } }, { "index": 15, "nt1": "///B/914", "nt2": "///B/921", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": true, "chi1": -174.873, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 31.996, "chi2": -143.984, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 118.646, "C1C1_dist": 9.711, "N1N9_dist": 9.210, "C6C8_dist": 10.414, "CNNC_torsion": -41.079, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N3[3.31],N1-O2'(hydroxyl)[2.77]", "interBase_angle": 29.128, "planarity": 0.362, "simple_Shear": -5.969, "simple_Stretch": 3.817, "simple_Buckle": -24.112, "simple_Propeller": -16.342, "bp_simpleParams": [ -5.969, 3.817, 0.277, -24.112, -16.342, 48.421 ], "bp_params": [ -6.993, -1.137, 0.277, -7.178, -28.230, 49.666 ], "frame": { "rmsd": null, "origin": [ 15.595, 25.980, 30.326 ], "x_axis": [ 0.154, -0.111, 0.982 ], "y_axis": [ 0.967, 0.219, -0.127 ], "z_axis": [ -0.201, 0.969, 0.141 ], "quaternion": [ 0.615, -0.445, -0.481, -0.438 ] } }, { "index": 16, "nt1": "///B/915", "nt2": "///B/948", "bp": "G+C", "name": "rWC", "Saenger": "22-XXII", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -114.160, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 45.229, "chi2": -151.275, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 57.756, "C1C1_dist": 10.528, "N1N9_dist": 9.005, "C6C8_dist": 10.629, "CNNC_torsion": -163.128, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O2(carbonyl)[3.02],N2(amino)-N3[2.74]", "interBase_angle": 7.671, "planarity": 0.153, "simple_Shear": 3.866, "simple_Stretch": 1.473, "simple_Buckle": -0.550, "simple_Propeller": 7.652, "bp_simpleParams": [ 3.866, 1.473, -0.374, -0.550, 7.652, 164.405 ], "bp_params": [ 0.143, 4.135, -0.374, -7.265, 2.463, 164.378 ], "frame": { "rmsd": null, "origin": [ 15.911, 29.491, 29.725 ], "x_axis": [ 0.107, -0.197, 0.975 ], "y_axis": [ 0.993, 0.068, -0.095 ], "z_axis": [ -0.048, 0.978, 0.203 ], "quaternion": [ 0.587, -0.457, -0.435, -0.507 ] } }, { "index": 17, "nt1": "///B/918", "nt2": "///B/955", "bp": "G+U", "name": "--", "Saenger": "--", "LW": "tWS", "DSSR": "tW+m", "intra_chain": true, "chi1": -104.025, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 30.865, "chi2": -148.889, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 111.428, "C1C1_dist": 8.762, "N1N9_dist": 8.270, "C6C8_dist": 9.697, "CNNC_torsion": -133.550, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O2(carbonyl)[3.03],N2(amino)-O2(carbonyl)[2.96]", "interBase_angle": 26.177, "planarity": 0.435, "simple_Shear": 4.353, "simple_Stretch": 4.012, "simple_Buckle": -21.131, "simple_Propeller": 15.451, "bp_simpleParams": [ 4.353, 4.012, -0.495, -21.131, 15.451, 90.380 ], "bp_params": [ -0.519, 5.897, -0.495, -25.120, -7.362, 89.111 ], "frame": { "rmsd": null, "origin": [ 7.331, 40.875, 35.198 ], "x_axis": [ -0.080, 0.733, 0.675 ], "y_axis": [ -0.027, 0.676, -0.737 ], "z_axis": [ -0.996, -0.077, -0.034 ], "quaternion": [ 0.625, -0.264, -0.669, 0.304 ] } }, { "index": 18, "nt1": "///B/919", "nt2": "///B/920", "bp": "G+U", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -94.025, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 148.492, "chi2": -148.234, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 45.172, "C1C1_dist": 5.702, "N1N9_dist": 5.939, "C6C8_dist": 5.965, "CNNC_torsion": 28.266, "hbonds_num": 1, "hbonds_desc": "N2(amino)-O4(carbonyl)[2.71]", "interBase_angle": 25.406, "planarity": 0.383, "simple_Shear": 0.028, "simple_Stretch": 7.011, "simple_Buckle": -24.213, "simple_Propeller": 7.696, "bp_simpleParams": [ 0.028, 7.011, -1.482, -24.213, 7.696, 13.578 ], "bp_params": [ 6.971, 0.749, -1.482, 4.868, 24.936, 13.891 ], "frame": { "rmsd": null, "origin": [ 1.213, 37.604, 31.021 ], "x_axis": [ -0.188, 0.766, -0.614 ], "y_axis": [ 0.529, -0.448, -0.721 ], "z_axis": [ -0.828, -0.460, -0.321 ], "quaternion": [ -0.104, 0.629, 0.515, -0.573 ] } }, { "index": 19, "nt1": "///B/919", "nt2": "///B/956", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -94.025, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 57.414, "chi2": -170.285, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.529, "C1C1_dist": 10.674, "N1N9_dist": 8.957, "C6C8_dist": 9.864, "CNNC_torsion": -16.231, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.92],N1(imino)-N3[2.90],N2(amino)-O2(carbonyl)[2.83]", "interBase_angle": 25.317, "planarity": 0.297, "simple_Shear": 0.338, "simple_Stretch": -0.030, "simple_Buckle": -17.990, "simple_Propeller": -17.814, "bp_simpleParams": [ 0.338, -0.030, -0.029, -17.990, -17.814, -0.796 ], "bp_params": [ 0.336, -0.047, -0.029, -18.871, -16.878, -0.794 ], "frame": { "rmsd": null, "origin": [ 1.331, 40.298, 28.919 ], "x_axis": [ 0.193, 0.803, -0.564 ], "y_axis": [ 0.341, -0.594, -0.729 ], "z_axis": [ -0.920, -0.052, -0.388 ], "quaternion": [ -0.229, 0.737, 0.388, -0.503 ] } }, { "index": 20, "nt1": "///B/926", "nt2": "///B/944", "bp": "A-C", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.491, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 41.890, "chi2": -143.769, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 64.068, "C1C1_dist": 11.020, "N1N9_dist": 9.300, "C6C8_dist": 10.117, "CNNC_torsion": 5.426, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N3[3.13],N1*O2(carbonyl)[3.27]", "unusual_base2base_hbonds": 1, "interBase_angle": 5.671, "planarity": 0.108, "simple_Shear": -2.245, "simple_Stretch": 0.411, "simple_Buckle": 3.157, "simple_Propeller": -4.711, "bp_simpleParams": [ -2.245, 0.411, -0.249, 3.157, -4.711, -3.271 ], "bp_params": [ -2.280, -0.098, -0.249, 4.124, -3.892, -3.271 ], "frame": { "rmsd": null, "origin": [ 17.499, 11.901, 29.304 ], "x_axis": [ -0.571, 0.014, -0.821 ], "y_axis": [ 0.796, -0.232, -0.559 ], "z_axis": [ -0.199, -0.973, 0.121 ], "quaternion": [ -0.282, -0.367, -0.552, 0.694 ] } }, { "index": 21, "nt1": "///B/927", "nt2": "///B/943", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.681, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.980, "chi2": -156.444, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.423, "C1C1_dist": 10.611, "N1N9_dist": 8.961, "C6C8_dist": 9.956, "CNNC_torsion": -8.475, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.69],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[3.02]", "interBase_angle": 15.486, "planarity": 0.171, "simple_Shear": -0.150, "simple_Stretch": -0.043, "simple_Buckle": 9.335, "simple_Propeller": -12.356, "bp_simpleParams": [ -0.150, -0.043, -0.184, 9.335, -12.356, 3.168 ], "bp_params": [ -0.149, -0.046, -0.184, 9.622, -12.134, 3.174 ], "frame": { "rmsd": null, "origin": [ 15.539, 9.007, 29.744 ], "x_axis": [ 0.046, -0.040, -0.998 ], "y_axis": [ 0.988, -0.147, 0.051 ], "z_axis": [ -0.149, -0.988, 0.033 ], "quaternion": [ 0.482, 0.539, 0.440, -0.533 ] } }, { "index": 22, "nt1": "///B/928", "nt2": "///B/942", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -155.518, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.308, "chi2": -175.595, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 65.135, "C1C1_dist": 10.565, "N1N9_dist": 9.101, "C6C8_dist": 10.246, "CNNC_torsion": 1.442, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.77],N3-N1(imino)[3.21],N3-N2(amino)[2.90]", "interBase_angle": 14.332, "planarity": 0.151, "simple_Shear": -0.815, "simple_Stretch": 0.333, "simple_Buckle": 11.988, "simple_Propeller": -7.855, "bp_simpleParams": [ -0.815, 0.333, -0.437, 11.988, -7.855, 9.740 ], "bp_params": [ -0.841, 0.258, -0.437, 12.654, -6.728, 9.698 ], "frame": { "rmsd": null, "origin": [ 13.090, 6.142, 28.910 ], "x_axis": [ 0.547, 0.054, -0.836 ], "y_axis": [ 0.836, -0.083, 0.542 ], "z_axis": [ -0.040, -0.995, -0.091 ], "quaternion": [ 0.586, 0.656, 0.339, -0.334 ] } }, { "index": 23, "nt1": "///B/929", "nt2": "///B/941", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 176.577, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.417, "chi2": -174.818, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.791, "C1C1_dist": 10.785, "N1N9_dist": 8.985, "C6C8_dist": 9.838, "CNNC_torsion": 5.085, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.74],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[2.89]", "interBase_angle": 7.641, "planarity": 0.110, "simple_Shear": -0.028, "simple_Stretch": -0.187, "simple_Buckle": -6.766, "simple_Propeller": -3.551, "bp_simpleParams": [ -0.028, -0.187, -0.543, -6.766, -3.551, -3.458 ], "bp_params": [ -0.028, -0.187, -0.543, -6.775, -3.533, -3.454 ], "frame": { "rmsd": null, "origin": [ 11.625, 2.755, 26.995 ], "x_axis": [ 0.913, 0.171, -0.371 ], "y_axis": [ 0.399, -0.179, 0.899 ], "z_axis": [ 0.087, -0.969, -0.231 ], "quaternion": [ 0.613, 0.762, 0.187, -0.093 ] } }, { "index": 24, "nt1": "///B/930", "nt2": "///B/940", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -172.919, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.745, "chi2": -174.986, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 83.438, "C1C1_dist": 10.059, "N1N9_dist": 9.032, "C6C8_dist": 10.507, "CNNC_torsion": -7.131, "hbonds_num": 2, "hbonds_desc": "N1(imino)-O2(carbonyl)[2.87],N2(amino)-O2(carbonyl)[3.01]", "interBase_angle": 12.588, "planarity": 0.163, "simple_Shear": -2.527, "simple_Stretch": 1.128, "simple_Buckle": -1.300, "simple_Propeller": -12.520, "bp_simpleParams": [ -2.527, 1.128, 0.388, -1.300, -12.520, 28.969 ], "bp_params": [ -2.731, 0.449, 0.388, 1.929, -12.439, 29.130 ], "frame": { "rmsd": null, "origin": [ 13.636, 1.061, 24.765 ], "x_axis": [ 0.942, 0.325, 0.088 ], "y_axis": [ -0.038, -0.158, 0.987 ], "z_axis": [ 0.334, -0.933, -0.136 ], "quaternion": [ 0.642, 0.748, 0.096, 0.141 ] } }, { "index": 25, "nt1": "///B/931", "nt2": "///B/939", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.488, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.752, "chi2": -155.823, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.929, "C1C1_dist": 10.867, "N1N9_dist": 9.159, "C6C8_dist": 9.996, "CNNC_torsion": 5.132, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.21],N1-N3(imino)[3.34]", "interBase_angle": 21.290, "planarity": 0.289, "simple_Shear": -0.490, "simple_Stretch": 0.063, "simple_Buckle": -17.715, "simple_Propeller": -11.810, "bp_simpleParams": [ -0.490, 0.063, -1.493, -17.715, -11.810, -1.493 ], "bp_params": [ -0.492, 0.045, -1.493, -17.296, -12.415, -1.485 ], "frame": { "rmsd": null, "origin": [ 13.775, -2.430, 21.591 ], "x_axis": [ 0.715, 0.110, 0.690 ], "y_axis": [ -0.558, -0.505, 0.658 ], "z_axis": [ 0.421, -0.856, -0.300 ], "quaternion": [ 0.477, 0.794, -0.141, 0.350 ] } }, { "index": 26, "nt1": "///B/932", "nt2": "///B/938", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 174.225, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.945, "chi2": -174.805, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 23.820, "C1C1_dist": 10.918, "N1N9_dist": 8.774, "C6C8_dist": 9.148, "CNNC_torsion": 27.878, "hbonds_num": 1, "hbonds_desc": "N3(imino)-O4(carbonyl)[2.96]", "interBase_angle": 19.086, "planarity": 0.228, "simple_Shear": 3.449, "simple_Stretch": 0.028, "simple_Buckle": -13.491, "simple_Propeller": 13.500, "bp_simpleParams": [ 3.449, 0.028, 0.225, -13.491, 13.500, -29.982 ], "bp_params": [ 3.242, -1.177, 0.225, -7.935, 17.358, -30.246 ], "frame": { "rmsd": null, "origin": [ 15.905, -4.583, 19.119 ], "x_axis": [ 0.079, -0.112, 0.991 ], "y_axis": [ -0.927, -0.373, 0.032 ], "z_axis": [ 0.365, -0.921, -0.134 ], "quaternion": [ 0.379, 0.630, -0.413, 0.538 ] } }, { "index": 27, "nt1": "///B/933", "nt2": "///B/937", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -156.192, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 80.444, "chi2": -173.553, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 4.251, "C1C1_dist": 9.311, "N1N9_dist": 7.759, "C6C8_dist": 7.933, "CNNC_torsion": 163.701, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.76]", "interBase_angle": 23.709, "planarity": 0.288, "simple_Shear": 7.399, "simple_Stretch": 1.806, "simple_Buckle": -12.945, "simple_Propeller": 19.863, "bp_simpleParams": [ 7.399, 1.806, -0.338, -12.945, 19.863, -30.032 ], "bp_params": [ 6.069, -4.602, -0.338, 7.309, 22.554, -30.539 ], "frame": { "rmsd": null, "origin": [ 19.242, -6.494, 19.585 ], "x_axis": [ -0.647, -0.414, 0.640 ], "y_axis": [ -0.562, -0.309, -0.768 ], "z_axis": [ 0.516, -0.856, -0.033 ], "quaternion": [ 0.053, 0.417, -0.585, 0.693 ] } }, { "index": 28, "nt1": "///B/949", "nt2": "///B/965", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.567, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.142, "chi2": 177.760, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.787, "C1C1_dist": 10.591, "N1N9_dist": 8.845, "C6C8_dist": 9.758, "CNNC_torsion": -6.480, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.65],N3-N1(imino)[2.73],N4(amino)-O6(carbonyl)[2.71]", "interBase_angle": 11.769, "planarity": 0.137, "simple_Shear": -0.125, "simple_Stretch": -0.262, "simple_Buckle": 5.723, "simple_Propeller": -10.284, "bp_simpleParams": [ -0.125, -0.262, 0.019, 5.723, -10.284, -0.940 ], "bp_params": [ -0.120, -0.264, 0.019, 5.911, -10.178, -0.942 ], "frame": { "rmsd": null, "origin": [ 25.538, 37.257, 40.041 ], "x_axis": [ -0.121, 0.525, -0.843 ], "y_axis": [ -0.231, -0.840, -0.490 ], "z_axis": [ -0.965, 0.136, 0.223 ], "quaternion": [ 0.256, -0.612, -0.120, 0.739 ] } }, { "index": 29, "nt1": "///B/950", "nt2": "///B/964", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.570, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.568, "chi2": -155.804, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.980, "C1C1_dist": 10.566, "N1N9_dist": 8.900, "C6C8_dist": 9.906, "CNNC_torsion": -12.028, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.97],N1(imino)-N3[2.83],N2(amino)-O2(carbonyl)[2.64]", "interBase_angle": 15.441, "planarity": 0.187, "simple_Shear": 0.140, "simple_Stretch": -0.119, "simple_Buckle": -2.967, "simple_Propeller": -15.153, "bp_simpleParams": [ 0.140, -0.119, -0.053, -2.967, -15.153, 3.436 ], "bp_params": [ 0.137, -0.122, -0.053, -3.262, -15.092, 3.465 ], "frame": { "rmsd": null, "origin": [ 22.602, 39.528, 41.496 ], "x_axis": [ -0.130, -0.011, -0.991 ], "y_axis": [ -0.200, -0.979, 0.037 ], "z_axis": [ -0.971, 0.203, 0.125 ], "quaternion": [ 0.063, -0.656, 0.080, 0.747 ] } }, { "index": 30, "nt1": "///B/951", "nt2": "///B/963", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -150.572, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.684, "chi2": -159.438, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.461, "C1C1_dist": 10.169, "N1N9_dist": 8.642, "C6C8_dist": 9.753, "CNNC_torsion": -2.235, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.07],N1-N3(imino)[2.73]", "interBase_angle": 6.062, "planarity": 0.086, "simple_Shear": -0.170, "simple_Stretch": -0.168, "simple_Buckle": 4.436, "simple_Propeller": -4.131, "bp_simpleParams": [ -0.170, -0.168, -0.084, 4.436, -4.131, 7.383 ], "bp_params": [ -0.168, -0.170, -0.084, 4.486, -4.076, 7.382 ], "frame": { "rmsd": null, "origin": [ 19.705, 41.038, 41.257 ], "x_axis": [ -0.142, -0.515, -0.846 ], "y_axis": [ -0.109, -0.841, 0.530 ], "z_axis": [ -0.984, 0.168, 0.063 ], "quaternion": [ -0.142, -0.639, 0.244, 0.715 ] } }, { "index": 31, "nt1": "///B/952", "nt2": "///B/962", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -175.991, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.768, "chi2": -166.261, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.729, "C1C1_dist": 10.500, "N1N9_dist": 8.844, "C6C8_dist": 9.807, "CNNC_torsion": -0.636, "hbonds_num": 4, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.18],N1(imino)-O2(carbonyl)[3.10],N1(imino)-N3[3.13],N2(amino)-O2(carbonyl)[3.00]", "interBase_angle": 8.211, "planarity": 0.138, "simple_Shear": -1.344, "simple_Stretch": -0.135, "simple_Buckle": -0.646, "simple_Propeller": -8.185, "bp_simpleParams": [ -1.344, -0.135, -0.319, -0.646, -8.185, 2.091 ], "bp_params": [ -1.315, -0.308, -0.319, 0.420, -8.200, 2.097 ], "frame": { "rmsd": null, "origin": [ 16.513, 42.392, 39.712 ], "x_axis": [ -0.059, -0.850, -0.523 ], "y_axis": [ -0.113, -0.515, 0.850 ], "z_axis": [ -0.992, 0.109, -0.065 ], "quaternion": [ 0.300, 0.617, -0.390, -0.614 ] } }, { "index": 32, "nt1": "///B/953", "nt2": "///B/961", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.008, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.493, "chi2": -171.747, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.828, "C1C1_dist": 10.493, "N1N9_dist": 8.947, "C6C8_dist": 10.010, "CNNC_torsion": -2.337, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.20],N1(imino)-N3[2.98],N2(amino)-O2(carbonyl)[2.62]", "interBase_angle": 15.729, "planarity": 0.178, "simple_Shear": 0.030, "simple_Stretch": 0.074, "simple_Buckle": -14.905, "simple_Propeller": -5.024, "bp_simpleParams": [ 0.030, 0.074, -0.207, -14.905, -5.024, 6.073 ], "bp_params": [ 0.031, 0.073, -0.207, -14.966, -4.839, 6.027 ], "frame": { "rmsd": null, "origin": [ 13.276, 42.018, 37.161 ], "x_axis": [ -0.009, -0.992, 0.129 ], "y_axis": [ -0.148, 0.129, 0.981 ], "z_axis": [ -0.989, -0.010, -0.148 ], "quaternion": [ -0.493, -0.502, 0.567, 0.428 ] } }, { "index": 33, "nt1": "///B/954", "nt2": "///B/958", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -159.306, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 38.281, "chi2": -76.840, "conf2": "anti", "pucker2": "~C2'-endo", "lambda2": 20.775, "C1C1_dist": 9.487, "N1N9_dist": 7.115, "C6C8_dist": 6.308, "CNNC_torsion": -178.608, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[3.17],N3(imino)-N7[3.05]", "interBase_angle": 14.445, "planarity": 0.157, "simple_Shear": 5.124, "simple_Stretch": 1.800, "simple_Buckle": -10.346, "simple_Propeller": 10.081, "bp_simpleParams": [ 5.124, 1.800, 0.775, -10.346, 10.081, -93.018 ], "bp_params": [ 4.702, -2.717, 0.775, 0.915, 14.416, -93.470 ], "frame": { "rmsd": null, "origin": [ 10.847, 41.643, 33.418 ], "x_axis": [ -0.169, 0.079, 0.982 ], "y_axis": [ 0.044, 0.996, -0.073 ], "z_axis": [ -0.985, 0.031, -0.172 ], "quaternion": [ 0.643, -0.040, -0.765, 0.014 ] } } ], "num_multiplets": 4, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "UAA", "nts_long": "///B/908,///B/914,///B/921", "planarity": 0.363 }, { "index": 2, "num_nts": 3, "nts_short": "CCG", "nts_long": "///B/909,///B/912,///B/923", "planarity": 0.380 }, { "index": 3, "num_nts": 3, "nts_short": "AAA", "nts_long": "///B/913,///B/922,///B/945", "planarity": 0.368 }, { "index": 4, "num_nts": 3, "nts_short": "GUC", "nts_long": "///B/919,///B/920,///B/956", "planarity": 0.499 } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GGGGUACGAGGUUC", "strand2": "CCCCAUGCUCCAGG", "bp_type": "|||||||||||..|", "helix_form": "AA.AAx.A..xx.", "helical_rise": 3.178, "helical_rise_std": 0.762, "helical_radius": 9.124, "helical_radius_std": 2.376, "helical_axis": [ -0.988, 0.154, 0.017 ], "point1": [ 43.379, 36.464, 36.517 ], "point2": [ 2.486, 42.818, 37.238 ], "num_pairs": 14, "pairs": [ { "index": 1, "nt1": "///B/902", "nt2": "///B/971", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.333, -0.167, -0.030, -11.679, 0.509, -8.706 ], "step_params": [ 0.536, -1.652, 3.056, -1.534, 6.521, 34.747 ], "heli_params": [ -3.572, -1.083, 2.686, 10.794, 2.539, 35.367 ], "bp2_params": [ -0.204, -0.186, 0.155, -1.081, -5.752, 3.230 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.056, "simple_Twist": 34.153, "simple_hRise": 2.679, "simple_hTwist": 34.785 }, { "index": 2, "nt1": "///B/903", "nt2": "///B/970", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.204, -0.186, 0.155, -1.081, -5.752, 3.230 ], "step_params": [ 0.381, -1.714, 3.452, 2.932, 3.455, 34.710 ], "heli_params": [ -3.389, -0.176, 3.292, 5.761, -4.888, 34.996 ], "bp2_params": [ 0.007, -0.119, 0.046, -9.051, -17.998, 2.570 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.452, "simple_Twist": 33.104, "simple_hRise": 3.282, "simple_hTwist": 33.404 }, { "index": 3, "nt1": "///B/904", "nt2": "///B/969", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.007, -0.119, 0.046, -9.051, -17.998, 2.570 ], "step_params": [ 0.738, -2.065, 3.595, 10.356, 13.387, 28.835 ], "heli_params": [ -5.845, 0.451, 2.533, 24.410, -18.883, 33.344 ], "bp2_params": [ -0.042, -0.041, -0.737, -22.889, -17.025, 2.666 ], "groove_widths": [ 16.431, null, 16.751, null ], "simple_Rise": 3.595, "simple_Twist": 28.586, "simple_hRise": 2.522, "simple_hTwist": 33.131 }, { "index": 4, "nt1": "///B/905", "nt2": "///B/968", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.042, -0.041, -0.737, -22.889, -17.025, 2.666 ], "step_params": [ 0.041, -1.266, 3.193, -3.922, 6.323, 29.900 ], "heli_params": [ -3.541, -0.794, 2.843, 12.021, 7.456, 30.791 ], "bp2_params": [ -0.120, 0.071, 0.254, -17.257, -10.823, 6.023 ], "groove_widths": [ 17.260, 15.602, 17.192, 14.715 ], "simple_Rise": 3.193, "simple_Twist": 30.938, "simple_hRise": 2.858, "simple_hTwist": 31.799 }, { "index": 5, "nt1": "///B/906", "nt2": "///B/967", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.120, 0.071, 0.254, -17.257, -10.823, 6.023 ], "step_params": [ 0.481, -1.398, 2.709, 4.142, 3.646, 31.353 ], "heli_params": [ -3.091, -0.261, 2.575, 6.683, -7.591, 31.823 ], "bp2_params": [ 0.038, -0.063, 0.233, 8.827, -6.339, 1.551 ], "groove_widths": [ 17.330, 15.800, 19.630, 18.778 ], "simple_Rise": 2.709, "simple_Twist": 30.779, "simple_hRise": 2.572, "simple_hTwist": 31.258 }, { "index": 6, "nt1": "///B/907", "nt2": "///B/966", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.038, -0.063, 0.233, 8.827, -6.339, 1.551 ], "step_params": [ -0.451, -1.743, 3.323, 1.794, 0.889, 37.659 ], "heli_params": [ -2.813, 0.932, 3.259, 1.376, -2.777, 37.710 ], "bp2_params": [ -0.120, -0.264, 0.019, 5.911, -10.178, -0.942 ], "groove_widths": [ 16.044, 14.729, 17.933, 17.156 ], "simple_Rise": 3.323, "simple_Twist": 38.540, "simple_hRise": 3.260, "simple_hTwist": 38.590 }, { "index": 7, "nt1": "///B/949", "nt2": "///B/965", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.120, -0.264, 0.019, 5.911, -10.178, -0.942 ], "step_params": [ -0.417, -1.887, 3.487, 2.289, 6.393, 31.677 ], "heli_params": [ -4.519, 1.154, 3.021, 11.545, -4.133, 32.378 ], "bp2_params": [ 0.137, -0.122, -0.053, -3.262, -15.092, 3.465 ], "groove_widths": [ 16.127, 14.849, 17.770, 17.190 ], "simple_Rise": 3.487, "simple_Twist": 30.147, "simple_hRise": 2.994, "simple_hTwist": 30.885 }, { "index": 8, "nt1": "///B/950", "nt2": "///B/964", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.137, -0.122, -0.053, -3.262, -15.092, 3.465 ], "step_params": [ 0.232, -1.059, 3.091, -1.001, 4.056, 30.135 ], "heli_params": [ -2.768, -0.628, 2.918, 7.754, 1.913, 30.417 ], "bp2_params": [ -0.168, -0.170, -0.084, 4.486, -4.076, 7.382 ], "groove_widths": [ 16.837, 15.673, 14.868, 11.213 ], "simple_Rise": 3.091, "simple_Twist": 31.931, "simple_hRise": 2.929, "simple_hTwist": 32.196 }, { "index": 9, "nt1": "///B/951", "nt2": "///B/963", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.168, -0.170, -0.084, 4.486, -4.076, 7.382 ], "step_params": [ 0.450, -1.726, 3.351, 2.856, 7.585, 26.309 ], "heli_params": [ -5.417, -0.274, 2.786, 16.182, -6.093, 27.508 ], "bp2_params": [ -1.315, -0.308, -0.319, 0.420, -8.200, 2.097 ], "groove_widths": [ 16.695, 15.413, 15.912, 12.616 ], "simple_Rise": 3.351, "simple_Twist": 32.644, "simple_hRise": 2.916, "simple_hTwist": 33.608 }, { "index": 10, "nt1": "///B/952", "nt2": "///B/962", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.315, -0.308, -0.319, 0.420, -8.200, 2.097 ], "step_params": [ 0.985, -2.031, 3.468, 3.241, 7.671, 38.356 ], "heli_params": [ -3.956, -1.074, 3.091, 11.510, -4.863, 39.216 ], "bp2_params": [ 0.031, 0.073, -0.207, -14.966, -4.839, 6.027 ], "groove_widths": [ 16.044, 14.220, 15.091, 8.604 ], "simple_Rise": 3.468, "simple_Twist": 30.864, "simple_hRise": 2.976, "simple_hTwist": 31.942 }, { "index": 11, "nt1": "///B/953", "nt2": "///B/961", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.031, 0.073, -0.207, -14.966, -4.839, 6.027 ], "step_params": [ -2.312, -2.397, 2.993, -0.933, -2.558, 87.140 ], "heli_params": [ -1.687, 1.658, 3.068, -1.856, 0.677, 87.174 ], "bp2_params": [ 4.702, -2.717, 0.775, 0.915, 14.416, -93.470 ], "groove_widths": [ 17.018, null, 25.260, null ], "simple_Rise": 2.993, "simple_Twist": 57.413, "simple_hRise": 3.122, "simple_hTwist": 57.472 }, { "index": 12, "nt1": "///B/954", "nt2": "///B/958", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.702, -2.717, 0.775, 0.915, 14.416, -93.470 ], "step_params": [ 1.621, -1.552, 3.330, 9.055, 4.453, 42.597 ], "heli_params": [ -2.530, -1.271, 3.418, 6.029, -12.259, 43.722 ], "bp2_params": [ 0.519, -5.897, 0.495, 25.120, 7.362, -89.111 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.330, "simple_Twist": -34.771, "simple_hRise": 2.998, "simple_hTwist": -36.162 }, { "index": 13, "nt1": "///B/955", "nt2": "///B/918", "bp": "U+G", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "bp1_params": [ 0.519, -5.897, 0.495, 25.120, 7.362, -89.111 ], "step_params": [ -4.829, -0.368, 7.232, -0.317, -20.913, -99.463 ], "heli_params": [ 0.947, -3.138, 7.081, 13.597, -0.206, -101.066 ], "bp2_params": [ -0.336, -0.047, -0.029, 18.871, -16.878, -0.794 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 7.232, "simple_Twist": 5.274, "simple_hRise": 2.207, "simple_hTwist": 21.563 }, { "index": 14, "nt1": "///B/956", "nt2": "///B/919", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 2, "strand1": "AUUCCGGCGCCAAG", "strand2": "UUAGGCCACGGAUC", "bp_type": "..|||||.|||...", "helix_form": ".......xAA.xx", "helical_rise": 2.782, "helical_rise_std": 0.719, "helical_radius": 9.395, "helical_radius_std": 2.689, "helical_axis": [ -0.049, 0.998, -0.036 ], "point1": [ 18.994, -6.166, 27.552 ], "point2": [ 17.208, 29.892, 26.262 ], "num_pairs": 14, "pairs": [ { "index": 1, "nt1": "///B/937", "nt2": "///B/933", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -6.069, -4.602, -0.338, -7.309, 22.554, -30.539 ], "step_params": [ 0.214, -2.252, 3.144, -10.950, 1.449, 51.244 ], "heli_params": [ -2.644, -0.927, 2.983, 1.653, 12.495, 52.343 ], "bp2_params": [ -3.242, -1.177, 0.225, 7.935, 17.358, -30.246 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.144, "simple_Twist": 26.902, "simple_hRise": 2.728, "simple_hTwist": 29.042 }, { "index": 2, "nt1": "///B/938", "nt2": "///B/932", "bp": "U-U", "name": "--", "Saenger": "16-XVI", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -3.242, -1.177, 0.225, 7.935, 17.358, -30.246 ], "step_params": [ 1.237, -1.689, 3.301, 7.870, 7.281, 42.768 ], "heli_params": [ -2.941, -0.907, 3.156, 9.801, -10.593, 44.030 ], "bp2_params": [ 0.492, 0.045, -1.493, 17.296, -12.415, -1.485 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.301, "simple_Twist": 23.470, "simple_hRise": 2.913, "simple_hTwist": 25.771 }, { "index": 3, "nt1": "///B/939", "nt2": "///B/931", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.492, 0.045, -1.493, 17.296, -12.415, -1.485 ], "step_params": [ 2.136, -1.617, 3.886, -11.384, 1.539, 39.858 ], "heli_params": [ -2.466, -4.352, 3.125, 2.203, 16.292, 41.416 ], "bp2_params": [ 2.731, 0.449, 0.388, -1.929, -12.439, 29.130 ], "groove_widths": [ 16.477, null, 15.560, null ], "simple_Rise": 3.886, "simple_Twist": 26.206, "simple_hRise": 2.648, "simple_hTwist": 28.572 }, { "index": 4, "nt1": "///B/940", "nt2": "///B/930", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.731, 0.449, 0.388, -1.929, -12.439, 29.130 ], "step_params": [ -1.845, -1.547, 2.467, 7.595, 13.311, 24.811 ], "heli_params": [ -4.725, 4.611, 0.939, 27.844, -15.886, 29.099 ], "bp2_params": [ 0.028, -0.187, -0.543, 6.775, -3.533, -3.454 ], "groove_widths": [ 16.580, 14.750, 16.564, 11.205 ], "simple_Rise": 2.467, "simple_Twist": 40.554, "simple_hRise": 1.554, "simple_hTwist": 43.239 }, { "index": 5, "nt1": "///B/941", "nt2": "///B/929", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.028, -0.187, -0.543, 6.775, -3.533, -3.454 ], "step_params": [ 0.322, -2.026, 3.617, -1.554, 10.909, 33.396 ], "heli_params": [ -5.006, -0.769, 2.819, 18.371, 2.617, 35.118 ], "bp2_params": [ 0.841, 0.258, -0.437, -12.654, -6.728, 9.698 ], "groove_widths": [ 16.500, 15.192, 16.783, 9.590 ], "simple_Rise": 3.617, "simple_Twist": 28.944, "simple_hRise": 2.675, "simple_hTwist": 30.928 }, { "index": 6, "nt1": "///B/942", "nt2": "///B/928", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.841, 0.258, -0.437, -12.654, -6.728, 9.698 ], "step_params": [ -0.045, -2.289, 3.108, 3.779, 8.648, 29.859 ], "heli_params": [ -5.642, 0.694, 2.346, 16.279, -7.114, 31.283 ], "bp2_params": [ 0.149, -0.046, -0.184, -9.622, -12.134, 3.174 ], "groove_widths": [ 17.685, 14.394, 17.071, 13.516 ], "simple_Rise": 3.108, "simple_Twist": 33.459, "simple_hRise": 2.439, "simple_hTwist": 34.727 }, { "index": 7, "nt1": "///B/943", "nt2": "///B/927", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.149, -0.046, -0.184, -9.622, -12.134, 3.174 ], "step_params": [ -0.199, -1.424, 3.216, 4.208, 4.096, 37.393 ], "heli_params": [ -2.700, 0.825, 3.010, 6.340, -6.514, 37.835 ], "bp2_params": [ 2.280, -0.098, -0.249, -4.124, -3.892, -3.271 ], "groove_widths": [ 17.944, 13.503, 15.765, 13.345 ], "simple_Rise": 3.216, "simple_Twist": 26.304, "simple_hRise": 2.898, "simple_hTwist": 26.940 }, { "index": 8, "nt1": "///B/944", "nt2": "///B/926", "bp": "C-A", "name": "~Wobble", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.280, -0.098, -0.249, -4.124, -3.892, -3.271 ], "step_params": [ -4.233, -1.472, 3.294, 4.065, 9.732, 53.424 ], "heli_params": [ -2.159, 4.861, 2.703, 10.708, -4.473, 54.380 ], "bp2_params": [ -0.832, -0.223, -0.496, -8.052, -6.157, 4.911 ], "groove_widths": [ 16.834, 14.162, 13.274, 12.200 ], "simple_Rise": 3.294, "simple_Twist": 70.052, "simple_hRise": 2.877, "simple_hTwist": 70.741 }, { "index": 9, "nt1": "///B/910", "nt2": "///B/925", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.832, -0.223, -0.496, -8.052, -6.157, 4.911 ], "step_params": [ -0.404, -1.573, 3.190, -2.161, 0.506, 38.112 ], "heli_params": [ -2.467, 0.352, 3.187, 0.774, 3.307, 38.174 ], "bp2_params": [ -0.244, -0.139, -0.018, -5.314, -2.768, 3.728 ], "groove_widths": [ 16.812, 15.029, 11.220, 11.136 ], "simple_Rise": 3.190, "simple_Twist": 34.829, "simple_hRise": 3.186, "simple_hTwist": 34.897 }, { "index": 10, "nt1": "///B/911", "nt2": "///B/924", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.244, -0.139, -0.018, -5.314, -2.768, 3.728 ], "step_params": [ 0.344, -2.128, 3.000, 3.765, 3.412, 29.000 ], "heli_params": [ -4.836, 0.038, 2.759, 6.749, -7.446, 29.433 ], "bp2_params": [ 0.299, -0.091, -0.218, 2.296, 5.119, -2.454 ], "groove_widths": [ 16.815, 15.361, 16.223, 11.387 ], "simple_Rise": 3.000, "simple_Twist": 26.050, "simple_hRise": 2.726, "simple_hTwist": 26.532 }, { "index": 11, "nt1": "///B/912", "nt2": "///B/923", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.299, -0.091, -0.218, 2.296, 5.119, -2.454 ], "step_params": [ -0.203, -1.434, 3.442, 6.380, 3.767, 55.548 ], "heli_params": [ -1.750, 0.594, 3.306, 4.022, -6.812, 56.001 ], "bp2_params": [ 6.252, -4.142, -0.273, 3.761, -1.723, -10.889 ], "groove_widths": [ 16.525, null, 8.936, null ], "simple_Rise": 3.442, "simple_Twist": 15.197, "simple_hRise": 2.704, "simple_hTwist": 16.897 }, { "index": 12, "nt1": "///B/913", "nt2": "///B/922", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "bp1_params": [ 6.252, -4.142, -0.273, 3.761, -1.723, -10.889 ], "step_params": [ -0.279, -2.613, 3.104, 5.145, -5.778, 44.203 ], "heli_params": [ -2.904, 0.830, 3.351, -7.608, -6.775, 44.841 ], "bp2_params": [ -4.181, -2.395, 0.979, -0.081, 8.163, -92.736 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.104, "simple_Twist": 112.204, "simple_hRise": 3.180, "simple_hTwist": 112.379 }, { "index": 13, "nt1": "///B/914", "nt2": "///B/908", "bp": "A-U", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.181, -2.395, 0.979, -0.081, 8.163, -92.736 ], "step_params": [ 2.171, -2.552, 3.366, 4.312, 21.461, -73.957 ], "heli_params": [ 1.357, 1.890, 3.771, -17.473, 3.511, -76.682 ], "bp2_params": [ 0.143, 4.135, -0.374, -7.265, 2.463, 164.378 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.366, "simple_Twist": -5.821, "simple_hRise": 2.874, "simple_hTwist": -22.641 }, { "index": 14, "nt1": "///B/915", "nt2": "///B/948", "bp": "G+C", "name": "rWC", "Saenger": "22-XXII", "LW": "tWW", "DSSR": "tW+W" } ] } ], "num_stems": 4, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGGGUA", "strand2": "CCCCAU", "bp_type": "||||||", "helix_form": "AA.AA", "helical_rise": 2.795, "helical_rise_std": 0.349, "helical_radius": 9.598, "helical_radius_std": 0.458, "helical_axis": [ -0.980, 0.164, -0.113 ], "point1": [ 42.962, 37.978, 37.374 ], "point2": [ 29.296, 40.258, 35.797 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///B/902", "nt2": "///B/971", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.333, -0.167, -0.030, -11.679, 0.509, -8.706 ], "step_params": [ 0.536, -1.652, 3.056, -1.534, 6.521, 34.747 ], "heli_params": [ -3.572, -1.083, 2.686, 10.794, 2.539, 35.367 ], "bp2_params": [ -0.204, -0.186, 0.155, -1.081, -5.752, 3.230 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.056, "simple_Twist": 34.153, "simple_hRise": 2.679, "simple_hTwist": 34.785 }, { "index": 2, "nt1": "///B/903", "nt2": "///B/970", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.204, -0.186, 0.155, -1.081, -5.752, 3.230 ], "step_params": [ 0.381, -1.714, 3.452, 2.932, 3.455, 34.710 ], "heli_params": [ -3.389, -0.176, 3.292, 5.761, -4.888, 34.996 ], "bp2_params": [ 0.007, -0.119, 0.046, -9.051, -17.998, 2.570 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.452, "simple_Twist": 33.104, "simple_hRise": 3.282, "simple_hTwist": 33.404 }, { "index": 3, "nt1": "///B/904", "nt2": "///B/969", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.007, -0.119, 0.046, -9.051, -17.998, 2.570 ], "step_params": [ 0.738, -2.065, 3.595, 10.356, 13.387, 28.835 ], "heli_params": [ -5.845, 0.451, 2.533, 24.410, -18.883, 33.344 ], "bp2_params": [ -0.042, -0.041, -0.737, -22.889, -17.025, 2.666 ], "groove_widths": [ 16.431, null, 16.751, null ], "simple_Rise": 3.595, "simple_Twist": 28.586, "simple_hRise": 2.522, "simple_hTwist": 33.131 }, { "index": 4, "nt1": "///B/905", "nt2": "///B/968", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.042, -0.041, -0.737, -22.889, -17.025, 2.666 ], "step_params": [ 0.041, -1.266, 3.193, -3.922, 6.323, 29.900 ], "heli_params": [ -3.541, -0.794, 2.843, 12.021, 7.456, 30.791 ], "bp2_params": [ -0.120, 0.071, 0.254, -17.257, -10.823, 6.023 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.193, "simple_Twist": 30.938, "simple_hRise": 2.858, "simple_hTwist": 31.799 }, { "index": 5, "nt1": "///B/906", "nt2": "///B/967", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.120, 0.071, 0.254, -17.257, -10.823, 6.023 ], "step_params": [ 0.481, -1.398, 2.709, 4.142, 3.646, 31.353 ], "heli_params": [ -3.091, -0.261, 2.575, 6.683, -7.591, 31.823 ], "bp2_params": [ 0.038, -0.063, 0.233, 8.827, -6.339, 1.551 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.709, "simple_Twist": 30.779, "simple_hRise": 2.572, "simple_hTwist": 31.258 }, { "index": 6, "nt1": "///B/907", "nt2": "///B/966", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "GCC", "strand2": "CGG", "bp_type": "|||", "helix_form": "AA", "helical_rise": 2.294, "helical_rise_std": 0.196, "helical_radius": 8.998, "helical_radius_std": 1.025, "helical_axis": [ 0.186, 0.979, 0.079 ], "point1": [ 18.011, 15.365, 29.453 ], "point2": [ 18.839, 19.728, 29.803 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///B/910", "nt2": "///B/925", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.832, -0.223, -0.496, -8.052, -6.157, 4.911 ], "step_params": [ -0.404, -1.573, 3.190, -2.161, 0.506, 38.112 ], "heli_params": [ -2.467, 0.352, 3.187, 0.774, 3.307, 38.174 ], "bp2_params": [ -0.244, -0.139, -0.018, -5.314, -2.768, 3.728 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.190, "simple_Twist": 34.829, "simple_hRise": 3.186, "simple_hTwist": 34.897 }, { "index": 2, "nt1": "///B/911", "nt2": "///B/924", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.244, -0.139, -0.018, -5.314, -2.768, 3.728 ], "step_params": [ 0.344, -2.128, 3.000, 3.765, 3.412, 29.000 ], "heli_params": [ -4.836, 0.038, 2.759, 6.749, -7.446, 29.433 ], "bp2_params": [ 0.299, -0.091, -0.218, 2.296, 5.119, -2.454 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.000, "simple_Twist": 26.050, "simple_hRise": 2.726, "simple_hTwist": 26.532 }, { "index": 3, "nt1": "///B/912", "nt2": "///B/923", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "CCGGA", "strand2": "GGCCU", "bp_type": "|||||", "helix_form": "....", "helical_rise": 2.155, "helical_rise_std": 0.391, "helical_radius": 9.435, "helical_radius_std": 0.575, "helical_axis": [ 0.206, -0.974, 0.098 ], "point1": [ 15.419, 7.866, 24.548 ], "point2": [ 17.152, -0.344, 25.372 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///B/927", "nt2": "///B/943", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.149, -0.046, -0.184, 9.622, -12.134, 3.174 ], "step_params": [ 0.045, -2.289, 3.108, -3.779, 8.648, 29.859 ], "heli_params": [ -5.642, -0.694, 2.346, 16.279, 7.114, 31.283 ], "bp2_params": [ -0.841, 0.258, -0.437, 12.654, -6.728, 9.698 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.108, "simple_Twist": 33.459, "simple_hRise": 2.439, "simple_hTwist": 34.727 }, { "index": 2, "nt1": "///B/928", "nt2": "///B/942", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.841, 0.258, -0.437, 12.654, -6.728, 9.698 ], "step_params": [ -0.322, -2.026, 3.617, 1.554, 10.909, 33.396 ], "heli_params": [ -5.006, 0.769, 2.819, 18.371, -2.617, 35.118 ], "bp2_params": [ -0.028, -0.187, -0.543, -6.775, -3.533, -3.454 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.617, "simple_Twist": 28.944, "simple_hRise": 2.675, "simple_hTwist": 30.928 }, { "index": 3, "nt1": "///B/929", "nt2": "///B/941", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.028, -0.187, -0.543, -6.775, -3.533, -3.454 ], "step_params": [ 1.845, -1.547, 2.467, -7.595, 13.311, 24.811 ], "heli_params": [ -4.725, -4.611, 0.939, 27.844, 15.886, 29.099 ], "bp2_params": [ -2.731, 0.449, 0.388, 1.929, -12.439, 29.130 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.467, "simple_Twist": 40.554, "simple_hRise": 1.554, "simple_hTwist": 43.239 }, { "index": 4, "nt1": "///B/930", "nt2": "///B/940", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.731, 0.449, 0.388, 1.929, -12.439, 29.130 ], "step_params": [ -2.136, -1.617, 3.886, 11.384, 1.539, 39.858 ], "heli_params": [ -2.466, 4.352, 3.125, 2.203, -16.292, 41.416 ], "bp2_params": [ -0.492, 0.045, -1.493, -17.296, -12.415, -1.485 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.886, "simple_Twist": 26.206, "simple_hRise": 2.648, "simple_hTwist": 28.572 }, { "index": 5, "nt1": "///B/931", "nt2": "///B/939", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 1, "strand1": "CGAGG", "strand2": "GCUCC", "bp_type": "|||||", "helix_form": ".A..", "helical_rise": 2.430, "helical_rise_std": 0.288, "helical_radius": 9.100, "helical_radius_std": 0.465, "helical_axis": [ -0.982, -0.136, 0.130 ], "point1": [ 24.391, 39.703, 37.128 ], "point2": [ 15.038, 38.404, 38.364 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///B/949", "nt2": "///B/965", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.120, -0.264, 0.019, 5.911, -10.178, -0.942 ], "step_params": [ -0.417, -1.887, 3.487, 2.289, 6.393, 31.677 ], "heli_params": [ -4.519, 1.154, 3.021, 11.545, -4.133, 32.378 ], "bp2_params": [ 0.137, -0.122, -0.053, -3.262, -15.092, 3.465 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.487, "simple_Twist": 30.147, "simple_hRise": 2.994, "simple_hTwist": 30.885 }, { "index": 2, "nt1": "///B/950", "nt2": "///B/964", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.137, -0.122, -0.053, -3.262, -15.092, 3.465 ], "step_params": [ 0.232, -1.059, 3.091, -1.001, 4.056, 30.135 ], "heli_params": [ -2.768, -0.628, 2.918, 7.754, 1.913, 30.417 ], "bp2_params": [ -0.168, -0.170, -0.084, 4.486, -4.076, 7.382 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.091, "simple_Twist": 31.931, "simple_hRise": 2.929, "simple_hTwist": 32.196 }, { "index": 3, "nt1": "///B/951", "nt2": "///B/963", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.168, -0.170, -0.084, 4.486, -4.076, 7.382 ], "step_params": [ 0.450, -1.726, 3.351, 2.856, 7.585, 26.309 ], "heli_params": [ -5.417, -0.274, 2.786, 16.182, -6.093, 27.508 ], "bp2_params": [ -1.315, -0.308, -0.319, 0.420, -8.200, 2.097 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.351, "simple_Twist": 32.644, "simple_hRise": 2.916, "simple_hTwist": 33.608 }, { "index": 4, "nt1": "///B/952", "nt2": "///B/962", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.315, -0.308, -0.319, 0.420, -8.200, 2.097 ], "step_params": [ 0.985, -2.031, 3.468, 3.241, 7.671, 38.356 ], "heli_params": [ -3.956, -1.074, 3.091, 11.510, -4.863, 39.216 ], "bp2_params": [ 0.031, 0.073, -0.207, -14.966, -4.839, 6.027 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.468, "simple_Twist": 30.864, "simple_hRise": 2.976, "simple_hTwist": 31.942 }, { "index": 5, "nt1": "///B/953", "nt2": "///B/961", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 1, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///B/919", "nt2": "///B/956", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 2, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 4 ] }, { "index": 2, "helix_index": 2, "num_stems": 2, "stem_indices": [ 3, 2 ] } ], "num_stacks": 15, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "AC", "nts_long": "///B/907,///B/949" }, { "index": 2, "num_nts": 2, "nts_short": "AG", "nts_long": "///B/922,///B/923" }, { "index": 3, "num_nts": 2, "nts_short": "CR", "nts_long": "///B/934,///A/410" }, { "index": 4, "num_nts": 2, "nts_short": "GC", "nts_long": "///B/943,///B/944" }, { "index": 5, "num_nts": 2, "nts_short": "GU", "nts_long": "///B/965,///B/966" }, { "index": 6, "num_nts": 3, "nts_short": "UAC", "nts_long": "///B/908,///B/913,///B/912" }, { "index": 7, "num_nts": 3, "nts_short": "CAC", "nts_long": "///B/925,///B/926,///B/927" }, { "index": 8, "num_nts": 3, "nts_short": "AUU", "nts_long": "///B/931,///B/932,///B/933" }, { "index": 9, "num_nts": 3, "nts_short": "GUU", "nts_long": "///B/953,///B/954,///B/955" }, { "index": 10, "num_nts": 3, "nts_short": "HaR", "nts_long": "///A/43,///A/998,///A/260" }, { "index": 11, "num_nts": 4, "nts_short": "CAAC", "nts_long": "///B/909,///B/945,///B/921,///B/948" }, { "index": 12, "num_nts": 4, "nts_short": "AGAU", "nts_long": "///B/914,///B/915,///B/959,///B/960" }, { "index": 13, "num_nts": 4, "nts_short": "UAUU", "nts_long": "///B/935,///B/937,///B/938,///B/939" }, { "index": 14, "num_nts": 4, "nts_short": "GCAY", "nts_long": "///B/973,///B/975,///B/976,///A/211" }, { "index": 15, "num_nts": 5, "nts_short": "GGGAC", "nts_long": "///B/919,///B/957,///B/918,///B/958,///B/961" } ], "nonStack": { "num_nts": 7, "nts_short": "CUGUUAC", "nts_long": "///B/916,///B/920,///B/936,///B/946,///B/947,///B/972,///B/974" }, "num_atom2bases": 2, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///B/959/O4'", "nt": "///B/948", "vert_dist": 2.775 }, { "index": 2, "type": "phosphate", "atom": "///B/957/OP2", "nt": "///B/955", "vert_dist": 2.760 } ], "num_hairpins": 3, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 9 ], "stem_indices": [ 2 ], "summary": "[1] 9 [B.912 B.923] 3", "num_nts": 11, "nts_short": "CAAGCGGUAAG", "nts_long": "///B/912,///B/913,///B/914,///B/915,///B/916,///B/918,///B/919,///B/920,///B/921,///B/922,///B/923", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 9, "nts_short": "AAGCGGUAA", "nts_long": "///B/913,///B/914,///B/915,///B/916,///B/918,///B/919,///B/920,///B/921,///B/922" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 3 ], "summary": "[1] 7 [B.931 B.939] 5", "num_nts": 9, "nts_short": "AUUCUGAUU", "nts_long": "///B/931,///B/932,///B/933,///B/934,///B/935,///B/936,///B/937,///B/938,///B/939", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUCUGAU", "nts_long": "///B/932,///B/933,///B/934,///B/935,///B/936,///B/937,///B/938" } ] }, { "index": 3, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 4 ], "summary": "[1] 7 [B.953 B.961] 5", "num_nts": 9, "nts_short": "GUUCGAAUC", "nts_long": "///B/953,///B/954,///B/955,///B/956,///B/957,///B/958,///B/959,///B/960,///B/961", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUCGAAU", "nts_long": "///B/954,///B/955,///B/956,///B/957,///B/958,///B/959,///B/960" } ] } ], "num_junctions": 1, "junctions": [ { "index": 1, "type": "4-way junction", "bridging_nts": [ 2, 1, 5, 0 ], "stem_indices": [ 1, 2, 3, 4 ], "summary": "[4] 2 1 5 0 [B.907 B.966 B.910 B.925 B.927 B.943 B.949 B.965] 6 3 5 5", "num_nts": 16, "nts_short": "AUCGCACGCAUUCCGU", "nts_long": "///B/907,///B/908,///B/909,///B/910,///B/925,///B/926,///B/927,///B/943,///B/944,///B/945,///B/946,///B/947,///B/948,///B/949,///B/965,///B/966", "num_stems": 4, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UC", "nts_long": "///B/908,///B/909" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///B/926" }, { "index": 3, "num_nts": 5, "nts_short": "CAUUC", "nts_long": "///B/944,///B/945,///B/946,///B/947,///B/948" }, { "index": 4, "num_nts": 0, "nts_short": "", "nts_long": "" } ] } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 5, "nts_short": "AGCCA", "nts_long": "///B/972,///B/973,///B/974,///B/975,///B/976" }, { "index": 2, "num_nts": 1, "nts_short": "a", "nts_long": "///A/998" } ], "num_kissingLoops": 1, "kissingLoops": [ { "index": 1, "stem_index": -1, "is_isoCanonPair": true, "hairpin_indices": [ 1, 3 ] } ], "num_splayUnits": 7, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "AU", "nts_long": "///B/907,///B/908" }, { "index": 2, "num_nts": 2, "nts_short": "CG", "nts_long": "///B/916,///B/918" }, { "index": 3, "num_nts": 2, "nts_short": "UA", "nts_long": "///B/920,///B/921" }, { "index": 4, "num_nts": 5, "nts_short": "UCUGA", "nts_long": "///B/933,///B/934,///B/935,///B/936,///B/937" }, { "index": 5, "num_nts": 2, "nts_short": "AU", "nts_long": "///B/945,///B/946" }, { "index": 6, "num_nts": 2, "nts_short": "CC", "nts_long": "///B/948,///B/949" }, { "index": 7, "num_nts": 4, "nts_short": "AGCC", "nts_long": "///B/972,///B/973,///B/974,///B/975" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 2, "nts_short": "GC", "nts_long": "///B/919,///B/956" } ], "dbn": { "all_chains": { "num_nts": 75, "num_chars": 76, "bseq": "GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA&a", "bseqUP": "GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA&A", "sstr": "((((((..(((.....[...))).(((((.......))))).....(((((..]....))))))))))).....&.", "form": "AA.AA...A...........AA.AAAAAA.........AAA.....AAA.A.......AAAAAAAAAA.....-&-" }, "chain_B": { "num_nts": 74, "num_chars": 74, "bseq": "GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA", "bseqUP": "GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA", "sstr": "((((((..(((.....[...))).(((((.......))))).....(((((..]....))))))))))).....", "form": "AA.AA...A...........AA.AAAAAA.........AAA.....AAA.A.......AAAAAAAAAA.....-" } }, "chains": { "chain_B": { "num_nts": 74, "bseq": "GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA", "sstr": "((((((..(((.....[...))).(((((.......))))).....(((((..]....))))))))))).....", "form": "AA.AA...A...........AA.AAAAAA.........AAA.....AAA.A.......AAAAAAAAAA.....-", "helical_rise": 0.134, "helical_rise_std": 3.245, "helical_axis": [ -0.130, 0.448, -0.885 ], "point1": [ 23.373, 26.514, 29.591 ], "point2": [ 22.127, 30.809, 21.103 ], "num_chars": 220, "suite": "G1aG1aG1cG1aU1tA2aU1[C2gG1aC1cC1aA1cA1bG2aC!!G4bG4bU!!A1fA1aG1aG1aC1aA1aC1aC1cG1aG1aA1cU1aU7pC!!U!!G!!A1aU1aU1aC!!C1aG1aG1aC7aA!!U3bU4bC6dC1aG1aA1cG1aG1aU1aU1gC1aG1[A4dA1tU2aC1aC1aU1aC1cG1aU1aA1aC1aC1aC1aC1aA5qG4pC6jC1aA" } }, "num_nts": 75, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "B", "nt_resnum": 902, "nt_name": "G", "nt_code": "G", "nt_id": "///B/902", "linked_nts": [ null, "///B/903" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": -176.734, "delta": 86.528, "epsilon": -134.972, "zeta": -75.517, "epsilon_zeta": -59.454, "bb_type": "BI", "chi": 176.284, "glyco_bond": "anti", "C5prime_xyz": [ -1.435, 8.244, 1.857 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.644, "Dp": 4.694, "splay_angle": 23.462, "splay_distance": 3.671, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 4.193, "v1": -24.658, "v2": 34.806, "v3": -33.357, "v4": 18.255, "amplitude": 35.583, "phase_angle": 11.996, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 43.389, 41.181, 33.683 ], "x_axis": [ -0.187, -0.817, 0.545 ], "y_axis": [ -0.143, 0.571, 0.808 ], "z_axis": [ -0.972, 0.073, -0.224 ], "quaternion": [ 0.538, 0.341, -0.704, -0.313 ] } }, { "index": 2, "index_chain": 2, "chain_name": "B", "nt_resnum": 903, "nt_name": "G", "nt_code": "G", "nt_id": "///B/903", "linked_nts": [ "///B/902", "///B/904" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -80.221, "beta": 176.953, "gamma": 60.652, "delta": 82.378, "epsilon": -159.858, "zeta": -71.386, "epsilon_zeta": -88.472, "bb_type": "BI", "chi": -167.374, "glyco_bond": "anti", "C5prime_xyz": [ -1.448, 8.660, 0.940 ], "P_xyz": [ 1.140, 9.100, 0.925 ], "form": "A", "ssZp": 4.650, "Dp": 4.613, "splay_angle": 24.937, "splay_distance": 3.842, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 155.978, "theta": -147.276, "eta_prime": 174.457, "theta_prime": -146.776, "eta_base": -133.395, "theta_base": -119.322, "v0": 2.219, "v1": -25.417, "v2": 37.581, "v3": -37.262, "v4": 22.100, "amplitude": 38.969, "phase_angle": 15.339, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.692, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 40.440, 39.341, 32.502 ], "x_axis": [ -0.233, -0.244, 0.941 ], "y_axis": [ -0.064, 0.970, 0.236 ], "z_axis": [ -0.970, -0.005, -0.242 ], "quaternion": [ 0.611, 0.098, -0.782, -0.074 ] } }, { "index": 3, "index_chain": 3, "chain_name": "B", "nt_resnum": 904, "nt_name": "G", "nt_code": "G", "nt_id": "///B/904", "linked_nts": [ "///B/903", "///B/905" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -47.614, "beta": 172.509, "gamma": 47.098, "delta": 82.873, "epsilon": -157.755, "zeta": -61.214, "epsilon_zeta": -96.541, "bb_type": "BI", "chi": -162.692, "glyco_bond": "anti", "C5prime_xyz": [ -1.410, 8.680, 0.677 ], "P_xyz": [ 1.152, 8.964, 1.103 ], "form": ".", "ssZp": 4.402, "Dp": 4.550, "splay_angle": 20.401, "splay_distance": 3.840, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 177.302, "theta": -116.170, "eta_prime": -166.789, "theta_prime": -128.136, "eta_base": -122.644, "theta_base": -108.317, "v0": 1.275, "v1": -23.858, "v2": 36.426, "v3": -36.699, "v4": 22.164, "amplitude": 38.039, "phase_angle": 16.745, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.677, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 37.085, 37.469, 32.524 ], "x_axis": [ -0.305, 0.339, 0.890 ], "y_axis": [ 0.056, 0.939, -0.338 ], "z_axis": [ -0.951, -0.053, -0.306 ], "quaternion": [ 0.576, -0.124, -0.798, 0.122 ] } }, { "index": 4, "index_chain": 4, "chain_name": "B", "nt_resnum": 905, "nt_name": "G", "nt_code": "G", "nt_id": "///B/905", "linked_nts": [ "///B/904", "///B/906" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": 162.963, "beta": 177.483, "gamma": 174.698, "delta": 83.714, "epsilon": -143.541, "zeta": -72.143, "epsilon_zeta": -71.398, "bb_type": "BI", "chi": -171.528, "glyco_bond": "anti", "C5prime_xyz": [ -1.299, 8.524, 1.211 ], "P_xyz": [ -0.039, 10.500, 0.044 ], "form": "A", "ssZp": 4.585, "Dp": 4.641, "splay_angle": 24.282, "splay_distance": 3.895, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 162.321, "theta": -172.256, "eta_prime": 177.879, "theta_prime": -164.926, "eta_base": -139.812, "theta_base": -136.343, "v0": 5.310, "v1": -26.319, "v2": 36.291, "v3": -34.361, "v4": 18.337, "amplitude": 36.931, "phase_angle": 10.683, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.789, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 34.022, 35.935, 34.260 ], "x_axis": [ -0.115, 0.760, 0.640 ], "y_axis": [ 0.020, 0.646, -0.763 ], "z_axis": [ -0.993, -0.075, -0.089 ], "quaternion": [ 0.600, -0.286, -0.680, 0.308 ] } }, { "index": 5, "index_chain": 5, "chain_name": "B", "nt_resnum": 906, "nt_name": "U", "nt_code": "U", "nt_id": "///B/906", "linked_nts": [ "///B/905", "///B/907" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate", "alpha": -59.157, "beta": 178.961, "gamma": 48.613, "delta": 82.323, "epsilon": -175.734, "zeta": -62.015, "epsilon_zeta": -113.719, "bb_type": "BI", "chi": -158.080, "glyco_bond": "anti", "C5prime_xyz": [ -1.513, 8.781, 0.358 ], "P_xyz": [ 0.999, 9.392, 0.710 ], "form": "A", "ssZp": 4.308, "Dp": 4.401, "splay_angle": 17.897, "splay_distance": 3.131, "splay_ratio": 0.168, "d22": null, "d64": null, "eta": 166.850, "theta": -138.066, "eta_prime": -175.785, "theta_prime": -139.265, "eta_base": -135.998, "theta_base": -118.408, "v0": 1.006, "v1": -23.812, "v2": 36.101, "v3": -36.544, "v4": 22.459, "amplitude": 37.771, "phase_angle": 17.102, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.923, "filter_rmsd": 0.102, "frame": { "rmsd": 0.006, "origin": [ 30.559, 35.277, 35.918 ], "x_axis": [ -0.033, 0.991, 0.132 ], "y_axis": [ 0.016, 0.132, -0.991 ], "z_axis": [ -0.999, -0.031, -0.020 ], "quaternion": [ 0.519, -0.462, -0.544, 0.469 ] } }, { "index": 6, "index_chain": 6, "chain_name": "B", "nt_resnum": 907, "nt_name": "A", "nt_code": "A", "nt_id": "///B/907", "linked_nts": [ "///B/906", "///B/908" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart", "alpha": -172.237, "beta": -178.362, "gamma": 172.611, "delta": 145.429, "epsilon": -88.345, "zeta": -46.381, "epsilon_zeta": -41.964, "bb_type": "--", "chi": -143.259, "glyco_bond": "anti", "C5prime_xyz": [ -1.675, 8.659, -0.020 ], "P_xyz": [ 0.274, 9.824, -1.346 ], "form": ".", "ssZp": 0.769, "Dp": 0.900, "splay_angle": 132.620, "splay_distance": 18.086, "splay_ratio": 0.916, "d22": null, "d64": null, "eta": -119.246, "theta": -80.619, "eta_prime": -121.811, "theta_prime": -71.569, "eta_base": -101.158, "theta_base": -42.151, "v0": -19.178, "v1": 32.431, "v2": -32.359, "v3": 22.339, "v4": -2.273, "amplitude": 33.527, "phase_angle": 164.832, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "1t", "suiteness": 0.761, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 28.209, 36.152, 37.793 ], "x_axis": [ -0.036, 0.932, -0.360 ], "y_axis": [ -0.306, -0.353, -0.884 ], "z_axis": [ -0.951, 0.079, 0.298 ], "quaternion": [ 0.477, -0.505, -0.310, 0.649 ] } }, { "index": 7, "index_chain": 7, "chain_name": "B", "nt_resnum": 908, "nt_name": "U", "nt_code": "U", "nt_id": "///B/908", "linked_nts": [ "///B/907", "///B/909" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate,splayed-apart", "alpha": -63.909, "beta": -152.436, "gamma": 53.620, "delta": 80.736, "epsilon": -140.257, "zeta": -122.917, "epsilon_zeta": -17.340, "bb_type": "--", "chi": -159.965, "glyco_bond": "anti", "C5prime_xyz": [ -1.638, 8.820, 0.563 ], "P_xyz": [ 0.726, 9.466, 1.498 ], "form": ".", "ssZp": 4.451, "Dp": 4.638, "splay_angle": 61.603, "splay_distance": 9.520, "splay_ratio": 0.513, "d22": 8.214, "d64": 9.347, "eta": 170.411, "theta": 159.870, "eta_prime": -150.349, "theta_prime": -166.465, "eta_base": -138.473, "theta_base": 175.736, "v0": -0.633, "v1": -22.662, "v2": 36.121, "v3": -37.277, "v4": 23.915, "amplitude": 38.297, "phase_angle": 19.407, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.524, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ 19.186, 26.351, 25.560 ], "x_axis": [ 0.794, 0.175, -0.582 ], "y_axis": [ 0.524, 0.287, 0.802 ], "z_axis": [ 0.307, -0.942, 0.136 ], "quaternion": [ 0.745, 0.585, 0.299, -0.117 ] } }, { "index": 8, "index_chain": 8, "chain_name": "B", "nt_resnum": 909, "nt_name": "C", "nt_code": "C", "nt_id": "///B/909", "linked_nts": [ "///B/908", "///B/910" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate", "alpha": -75.665, "beta": -150.849, "gamma": 55.070, "delta": 142.528, "epsilon": -101.001, "zeta": -92.454, "epsilon_zeta": -8.547, "bb_type": "--", "chi": -79.232, "glyco_bond": "anti", "C5prime_xyz": [ -2.993, 7.397, -2.809 ], "P_xyz": [ -0.903, 8.853, -3.497 ], "form": ".", "ssZp": 0.599, "Dp": 0.937, "splay_angle": 57.582, "splay_distance": 9.234, "splay_ratio": 0.488, "d22": null, "d64": null, "eta": -142.109, "theta": -50.549, "eta_prime": -162.214, "theta_prime": -110.514, "eta_base": 160.225, "theta_base": -104.098, "v0": -22.798, "v1": 35.502, "v2": -33.998, "v3": 21.868, "v4": 0.431, "amplitude": 36.046, "phase_angle": 160.593, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.010, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 14.847, 19.050, 29.862 ], "x_axis": [ 0.153, 0.317, -0.936 ], "y_axis": [ 0.954, 0.202, 0.224 ], "z_axis": [ 0.260, -0.927, -0.271 ], "quaternion": [ 0.520, 0.553, 0.575, -0.306 ] } }, { "index": 9, "index_chain": 9, "chain_name": "B", "nt_resnum": 910, "nt_name": "G", "nt_code": "G", "nt_id": "///B/910", "linked_nts": [ "///B/909", "///B/911" ], "nt_type": "RNA", "dbn": "(", "summary": "turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": 179.229, "beta": 177.534, "gamma": 55.342, "delta": 89.375, "epsilon": -149.147, "zeta": -70.133, "epsilon_zeta": -79.014, "bb_type": "BI", "chi": 179.902, "glyco_bond": "anti", "C5prime_xyz": [ -1.457, 8.289, 1.714 ], "P_xyz": [ 1.017, 8.143, 2.561 ], "form": "A", "ssZp": 4.515, "Dp": 4.537, "splay_angle": 24.566, "splay_distance": 3.837, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 36.476, "theta": -134.231, "eta_prime": 96.931, "theta_prime": -133.176, "eta_base": 132.706, "theta_base": -109.677, "v0": 3.256, "v1": -23.362, "v2": 33.519, "v3": -32.728, "v4": 18.520, "amplitude": 34.461, "phase_angle": 13.428, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2g", "suiteness": 0.671, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 22.752, 14.307, 29.350 ], "x_axis": [ -0.990, 0.139, 0.012 ], "y_axis": [ 0.039, 0.188, 0.981 ], "z_axis": [ 0.134, 0.972, -0.192 ], "quaternion": [ 0.039, 0.058, 0.770, 0.634 ] } }, { "index": 10, "index_chain": 10, "chain_name": "B", "nt_resnum": 911, "nt_name": "C", "nt_code": "C", "nt_id": "///B/911", "linked_nts": [ "///B/910", "///B/912" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.839, "beta": -172.237, "gamma": 48.749, "delta": 84.486, "epsilon": -160.219, "zeta": -68.107, "epsilon_zeta": -92.112, "bb_type": "BI", "chi": -158.569, "glyco_bond": "anti", "C5prime_xyz": [ -1.286, 8.719, 0.418 ], "P_xyz": [ 1.212, 9.074, 1.111 ], "form": ".", "ssZp": 4.272, "Dp": 4.498, "splay_angle": 19.828, "splay_distance": 3.631, "splay_ratio": 0.188, "d22": 4.177, "d64": 4.798, "eta": 168.908, "theta": -120.748, "eta_prime": -177.159, "theta_prime": -132.676, "eta_base": -137.011, "theta_base": -115.742, "v0": 2.373, "v1": -23.888, "v2": 35.153, "v3": -34.900, "v4": 20.454, "amplitude": 36.401, "phase_angle": 15.052, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.759, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 22.539, 17.265, 26.914 ], "x_axis": [ -0.761, 0.230, 0.607 ], "y_axis": [ 0.636, 0.074, 0.769 ], "z_axis": [ 0.132, 0.970, -0.202 ], "quaternion": [ -0.166, 0.303, 0.713, 0.609 ] } }, { "index": 11, "index_chain": 11, "chain_name": "B", "nt_resnum": 912, "nt_name": "C", "nt_code": "C", "nt_id": "///B/912", "linked_nts": [ "///B/911", "///B/913" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,kissing-loop,phosphate", "alpha": 149.644, "beta": -173.795, "gamma": 178.985, "delta": 84.762, "epsilon": -136.710, "zeta": -59.189, "epsilon_zeta": -77.521, "bb_type": "BI", "chi": -171.127, "glyco_bond": "anti", "C5prime_xyz": [ -1.104, 8.463, 1.274 ], "P_xyz": [ 0.182, 10.406, 0.061 ], "form": ".", "ssZp": 4.723, "Dp": 4.728, "splay_angle": 31.772, "splay_distance": 5.007, "splay_ratio": 0.277, "d22": null, "d64": null, "eta": 159.105, "theta": -151.802, "eta_prime": 172.936, "theta_prime": -141.790, "eta_base": -149.333, "theta_base": -95.297, "v0": 5.539, "v1": -26.841, "v2": 36.792, "v3": -34.697, "v4": 18.379, "amplitude": 37.401, "phase_angle": 10.358, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.924, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ 20.611, 19.999, 25.506 ], "x_axis": [ -0.407, 0.153, 0.900 ], "y_axis": [ 0.912, 0.111, 0.394 ], "z_axis": [ -0.039, 0.982, -0.185 ], "quaternion": [ -0.360, 0.408, 0.652, 0.527 ] } }, { "index": 12, "index_chain": 12, "chain_name": "B", "nt_resnum": 913, "nt_name": "A", "nt_code": "A", "nt_id": "///B/913", "linked_nts": [ "///B/912", "///B/914" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,phosphate", "alpha": -52.329, "beta": 172.543, "gamma": 49.589, "delta": 82.877, "epsilon": 179.786, "zeta": -79.019, "epsilon_zeta": -101.195, "bb_type": "BI", "chi": -155.773, "glyco_bond": "anti", "C5prime_xyz": [ -1.468, 8.791, 0.242 ], "P_xyz": [ 1.074, 9.356, 0.423 ], "form": ".", "ssZp": 4.183, "Dp": 4.280, "splay_angle": 31.947, "splay_distance": 5.453, "splay_ratio": 0.284, "d22": null, "d64": null, "eta": 168.521, "theta": -152.050, "eta_prime": -160.516, "theta_prime": -163.410, "eta_base": -95.223, "theta_base": -170.107, "v0": -0.265, "v1": -21.921, "v2": 34.426, "v3": -35.640, "v4": 22.645, "amplitude": 36.425, "phase_angle": 19.071, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.753, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 19.049, 23.766, 28.412 ], "x_axis": [ 0.457, 0.189, 0.869 ], "y_axis": [ 0.878, 0.063, -0.475 ], "z_axis": [ -0.144, 0.980, -0.137 ], "quaternion": [ 0.588, -0.619, -0.431, -0.293 ] } }, { "index": 13, "index_chain": 13, "chain_name": "B", "nt_resnum": 914, "nt_name": "A", "nt_code": "A", "nt_id": "///B/914", "linked_nts": [ "///B/913", "///B/915" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop", "alpha": 172.238, "beta": -178.087, "gamma": 171.899, "delta": 88.375, "epsilon": -125.469, "zeta": -52.428, "epsilon_zeta": -73.040, "bb_type": "--", "chi": -174.873, "glyco_bond": "anti", "C5prime_xyz": [ -1.437, 8.406, 1.404 ], "P_xyz": [ 0.047, 10.293, 0.382 ], "form": ".", "ssZp": 4.515, "Dp": 4.596, "splay_angle": 32.314, "splay_distance": 5.315, "splay_ratio": 0.281, "d22": null, "d64": null, "eta": -179.732, "theta": -132.940, "eta_prime": 178.902, "theta_prime": -115.834, "eta_base": -179.735, "theta_base": -64.363, "v0": 2.996, "v1": -23.008, "v2": 33.010, "v3": -32.551, "v4": 18.728, "amplitude": 34.016, "phase_angle": 13.970, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.545, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 14.480, 26.376, 26.984 ], "x_axis": [ 0.509, 0.185, 0.841 ], "y_axis": [ 0.843, 0.089, -0.530 ], "z_axis": [ -0.172, 0.979, -0.111 ], "quaternion": [ 0.610, -0.619, -0.415, -0.270 ] } }, { "index": 14, "index_chain": 14, "chain_name": "B", "nt_resnum": 915, "nt_name": "G", "nt_code": "G", "nt_id": "///B/915", "linked_nts": [ "///B/914", "///B/916" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,phosphate", "alpha": -45.707, "beta": 169.170, "gamma": 46.008, "delta": 146.155, "epsilon": -137.681, "zeta": -51.834, "epsilon_zeta": -85.847, "bb_type": "BI", "chi": -114.160, "glyco_bond": "anti", "C5prime_xyz": [ -2.765, 8.520, -1.093 ], "P_xyz": [ -0.510, 9.807, -0.847 ], "form": ".", "ssZp": 2.524, "Dp": 1.909, "splay_angle": 71.513, "splay_distance": 9.508, "splay_ratio": 0.615, "d22": null, "d64": null, "eta": 165.868, "theta": -45.443, "eta_prime": -140.746, "theta_prime": -69.462, "eta_base": -76.109, "theta_base": -12.665, "v0": -29.310, "v1": 41.574, "v2": -36.810, "v3": 21.175, "v4": 4.851, "amplitude": 40.856, "phase_angle": 154.284, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1b", "suiteness": 0.461, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 17.981, 29.436, 29.560 ], "x_axis": [ 0.999, -0.023, 0.025 ], "y_axis": [ 0.029, 0.217, -0.976 ], "z_axis": [ 0.017, 0.976, 0.218 ], "quaternion": [ 0.780, -0.625, -0.002, -0.017 ] } }, { "index": 15, "index_chain": 15, "chain_name": "B", "nt_resnum": 916, "nt_name": "C", "nt_code": "C", "nt_id": "///B/916", "linked_nts": [ "///B/915", "///B/918" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,non-stack,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": -115.193, "beta": -155.326, "gamma": 54.707, "delta": 83.207, "epsilon": 66.194, "zeta": -137.029, "epsilon_zeta": -156.777, "bb_type": "--", "chi": 20.616, "glyco_bond": "syn", "C5prime_xyz": [ -5.543, 3.725, -0.369 ], "P_xyz": [ -5.458, 1.460, -1.695 ], "form": ".", "ssZp": -1.836, "Dp": 2.102, "splay_angle": 133.032, "splay_distance": 19.228, "splay_ratio": 0.918, "d22": null, "d64": null, "eta": 158.238, "theta": 70.631, "eta_prime": -151.413, "theta_prime": 61.250, "eta_base": -111.098, "theta_base": 53.759, "v0": -0.713, "v1": -18.180, "v2": 29.134, "v3": -30.586, "v4": 19.691, "amplitude": 31.023, "phase_angle": 20.099, "puckering": "C3'-endo", "sugar_class": "pucker-CHK", "bin": "23p", "cluster": "2a", "suiteness": 0.010, "filter_rmsd": 0.063, "frame": { "rmsd": 0.011, "origin": [ 17.722, 32.135, 20.446 ], "x_axis": [ 0.745, 0.011, -0.667 ], "y_axis": [ 0.020, 0.999, 0.039 ], "z_axis": [ 0.667, -0.043, 0.744 ], "quaternion": [ 0.934, 0.022, 0.357, -0.003 ] } }, { "index": 16, "index_chain": 16, "chain_name": "B", "nt_resnum": 918, "nt_name": "G", "nt_code": "G", "nt_id": "///B/918", "linked_nts": [ "///B/916", "///B/919" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": 136.272, "beta": -145.109, "gamma": -53.634, "delta": 145.870, "epsilon": -124.147, "zeta": -163.418, "epsilon_zeta": 39.271, "bb_type": "BII", "chi": -104.025, "glyco_bond": "anti", "C5prime_xyz": [ -2.326, 8.228, -1.758 ], "P_xyz": [ -2.561, 10.695, -2.579 ], "form": ".", "ssZp": 1.712, "Dp": 1.577, "splay_angle": 47.564, "splay_distance": 7.679, "splay_ratio": 0.412, "d22": null, "d64": null, "eta": -84.247, "theta": 148.388, "eta_prime": -91.346, "theta_prime": 175.961, "eta_base": -76.229, "theta_base": -145.130, "v0": -21.024, "v1": 34.097, "v2": -33.373, "v3": 22.329, "v4": -0.964, "amplitude": 34.939, "phase_angle": 162.783, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 7.518, 42.697, 32.859 ], "x_axis": [ 0.031, 0.999, -0.021 ], "y_axis": [ 0.236, -0.028, -0.971 ], "z_axis": [ -0.971, 0.025, -0.236 ], "quaternion": [ -0.438, 0.569, 0.543, -0.436 ] } }, { "index": 17, "index_chain": 17, "chain_name": "B", "nt_resnum": 919, "nt_name": "G", "nt_code": "G", "nt_id": "///B/919", "linked_nts": [ "///B/918", "///B/920" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,kissing-loop", "alpha": -54.354, "beta": 159.595, "gamma": 58.273, "delta": 145.899, "epsilon": -138.295, "zeta": 138.376, "epsilon_zeta": 83.329, "bb_type": "--", "chi": -94.025, "glyco_bond": "anti", "C5prime_xyz": [ -2.134, 7.786, -2.462 ], "P_xyz": [ 0.469, 7.971, -2.733 ], "form": ".", "ssZp": 1.037, "Dp": 1.677, "splay_angle": 43.438, "splay_distance": 7.166, "splay_ratio": 0.377, "d22": null, "d64": null, "eta": -156.254, "theta": 137.652, "eta_prime": -140.653, "theta_prime": 118.148, "eta_base": -119.842, "theta_base": 139.535, "v0": -17.263, "v1": 31.220, "v2": -32.563, "v3": 23.556, "v4": -4.200, "amplitude": 33.252, "phase_angle": 168.315, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.251, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 1.369, 40.447, 28.847 ], "x_axis": [ 0.057, 0.783, -0.619 ], "y_axis": [ 0.489, -0.563, -0.666 ], "z_axis": [ -0.870, -0.265, -0.415 ], "quaternion": [ -0.141, 0.713, 0.446, -0.522 ] } }, { "index": 18, "index_chain": 18, "chain_name": "B", "nt_resnum": 920, "nt_name": "U", "nt_code": "U", "nt_id": "///B/920", "linked_nts": [ "///B/919", "///B/921" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-stack,non-canonical,multiplet,hairpin-loop,kissing-loop,splayed-apart", "alpha": -64.897, "beta": 133.093, "gamma": 48.339, "delta": 141.476, "epsilon": -120.943, "zeta": 109.726, "epsilon_zeta": 129.331, "bb_type": "--", "chi": -148.234, "glyco_bond": "anti", "C5prime_xyz": [ -2.103, 8.755, 0.255 ], "P_xyz": [ 0.271, 8.674, 1.345 ], "form": ".", "ssZp": 1.475, "Dp": 1.534, "splay_angle": 123.854, "splay_distance": 18.151, "splay_ratio": 0.883, "d22": null, "d64": null, "eta": 176.485, "theta": 104.603, "eta_prime": -167.620, "theta_prime": 84.919, "eta_base": -156.469, "theta_base": 113.312, "v0": -24.070, "v1": 35.721, "v2": -33.052, "v3": 20.161, "v4": 2.263, "amplitude": 35.745, "phase_angle": 157.617, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.232, "filter_rmsd": 0.103, "frame": { "rmsd": 0.004, "origin": [ 1.058, 34.760, 33.195 ], "x_axis": [ -0.425, 0.693, -0.582 ], "y_axis": [ 0.515, -0.344, -0.786 ], "z_axis": [ -0.745, -0.633, -0.211 ], "quaternion": [ 0.072, -0.531, -0.568, 0.624 ] } }, { "index": 19, "index_chain": 19, "chain_name": "B", "nt_resnum": 921, "nt_name": "A", "nt_code": "A", "nt_id": "///B/921", "linked_nts": [ "///B/920", "///B/922" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,splayed-apart", "alpha": -162.246, "beta": 151.092, "gamma": -179.254, "delta": 88.194, "epsilon": -155.784, "zeta": -114.252, "epsilon_zeta": -41.532, "bb_type": "BI", "chi": -143.984, "glyco_bond": "anti", "C5prime_xyz": [ -1.321, 8.702, -0.459 ], "P_xyz": [ -0.902, 10.470, -2.331 ], "form": ".", "ssZp": 3.580, "Dp": 4.314, "splay_angle": 79.760, "splay_distance": 13.201, "splay_ratio": 0.643, "d22": null, "d64": null, "eta": -114.906, "theta": 134.307, "eta_prime": -130.880, "theta_prime": 140.731, "eta_base": -157.429, "theta_base": 144.877, "v0": 1.384, "v1": -21.180, "v2": 31.642, "v3": -32.084, "v4": 19.445, "amplitude": 33.012, "phase_angle": 16.563, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.012, "origin": [ 16.711, 25.583, 33.668 ], "x_axis": [ -0.214, -0.427, 0.879 ], "y_axis": [ -0.952, -0.109, -0.285 ], "z_axis": [ 0.217, -0.898, -0.383 ], "quaternion": [ -0.271, -0.565, 0.610, -0.485 ] } }, { "index": 20, "index_chain": 20, "chain_name": "B", "nt_resnum": 922, "nt_name": "A", "nt_code": "A", "nt_id": "///B/922", "linked_nts": [ "///B/921", "///B/923" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop", "alpha": 160.625, "beta": 142.050, "gamma": 176.507, "delta": 86.202, "epsilon": -131.612, "zeta": -64.895, "epsilon_zeta": -66.717, "bb_type": "BI", "chi": -171.738, "glyco_bond": "anti", "C5prime_xyz": [ -1.303, 8.427, 1.315 ], "P_xyz": [ -0.800, 10.839, 0.434 ], "form": ".", "ssZp": 4.682, "Dp": 4.692, "splay_angle": 35.382, "splay_distance": 5.391, "splay_ratio": 0.304, "d22": null, "d64": null, "eta": 158.044, "theta": -166.838, "eta_prime": 138.885, "theta_prime": -150.617, "eta_base": 126.994, "theta_base": -92.928, "v0": 4.183, "v1": -24.662, "v2": 34.701, "v3": -33.383, "v4": 18.391, "amplitude": 35.492, "phase_angle": 12.117, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1f", "suiteness": 0.026, "filter_rmsd": 0.038, "frame": { "rmsd": 0.005, "origin": [ 19.098, 22.966, 20.950 ], "x_axis": [ 0.619, 0.162, 0.769 ], "y_axis": [ -0.782, 0.036, 0.622 ], "z_axis": [ 0.073, -0.986, 0.148 ], "quaternion": [ 0.671, 0.599, -0.259, 0.351 ] } }, { "index": 21, "index_chain": 21, "chain_name": "B", "nt_resnum": 923, "nt_name": "G", "nt_code": "G", "nt_id": "///B/923", "linked_nts": [ "///B/922", "///B/924" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,kissing-loop", "alpha": -56.451, "beta": 161.782, "gamma": 50.517, "delta": 81.918, "epsilon": -151.576, "zeta": -75.821, "epsilon_zeta": -75.756, "bb_type": "BI", "chi": -176.411, "glyco_bond": "anti", "C5prime_xyz": [ -1.429, 8.495, 1.485 ], "P_xyz": [ 1.160, 8.676, 1.850 ], "form": "A", "ssZp": 4.688, "Dp": 4.634, "splay_angle": 24.604, "splay_distance": 3.782, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 158.117, "theta": -146.299, "eta_prime": -172.038, "theta_prime": -145.717, "eta_base": -95.414, "theta_base": -123.949, "v0": 2.704, "v1": -24.580, "v2": 36.044, "v3": -35.493, "v4": 20.677, "amplitude": 37.246, "phase_angle": 14.595, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.751, "filter_rmsd": 0.005, "frame": { "rmsd": 0.005, "origin": [ 20.810, 20.161, 25.223 ], "x_axis": [ -0.368, 0.244, 0.897 ], "y_axis": [ -0.929, -0.063, -0.364 ], "z_axis": [ -0.032, -0.968, 0.250 ], "quaternion": [ 0.452, 0.334, -0.514, 0.648 ] } }, { "index": 22, "index_chain": 22, "chain_name": "B", "nt_resnum": 924, "nt_name": "G", "nt_code": "G", "nt_id": "///B/924", "linked_nts": [ "///B/923", "///B/925" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.822, "beta": 175.158, "gamma": 53.239, "delta": 83.121, "epsilon": -146.129, "zeta": -77.053, "epsilon_zeta": -69.076, "bb_type": "BI", "chi": -170.442, "glyco_bond": "anti", "C5prime_xyz": [ -1.428, 8.585, 1.071 ], "P_xyz": [ 1.113, 8.869, 1.593 ], "form": "A", "ssZp": 4.541, "Dp": 4.655, "splay_angle": 21.775, "splay_distance": 3.359, "splay_ratio": 0.190, "d22": null, "d64": null, "eta": 174.283, "theta": -143.587, "eta_prime": -174.183, "theta_prime": -141.732, "eta_base": -137.691, "theta_base": -106.904, "v0": 2.426, "v1": -24.762, "v2": 36.424, "v3": -36.168, "v4": 21.259, "amplitude": 37.726, "phase_angle": 15.096, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.956, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 22.435, 17.350, 27.161 ], "x_axis": [ -0.805, 0.175, 0.567 ], "y_axis": [ -0.592, -0.177, -0.786 ], "z_axis": [ -0.037, -0.969, 0.246 ], "quaternion": [ 0.257, 0.178, -0.588, 0.746 ] } }, { "index": 23, "index_chain": 23, "chain_name": "B", "nt_resnum": 925, "nt_name": "C", "nt_code": "C", "nt_id": "///B/925", "linked_nts": [ "///B/924", "///B/926" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -59.317, "beta": 167.918, "gamma": 50.065, "delta": 81.404, "epsilon": -137.712, "zeta": -60.653, "epsilon_zeta": -77.059, "bb_type": "BI", "chi": -163.394, "glyco_bond": "anti", "C5prime_xyz": [ -1.245, 8.669, 0.728 ], "P_xyz": [ 1.361, 8.886, 0.819 ], "form": ".", "ssZp": 4.518, "Dp": 4.735, "splay_angle": 30.689, "splay_distance": 4.868, "splay_ratio": 0.267, "d22": null, "d64": null, "eta": 166.819, "theta": -122.760, "eta_prime": -179.612, "theta_prime": -120.991, "eta_base": -129.091, "theta_base": -82.344, "v0": 2.418, "v1": -25.417, "v2": 37.579, "v3": -37.199, "v4": 21.851, "amplitude": 38.924, "phase_angle": 15.104, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.934, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 21.964, 14.908, 29.420 ], "x_axis": [ -0.999, 0.013, -0.042 ], "y_axis": [ 0.035, -0.330, -0.943 ], "z_axis": [ -0.027, -0.944, 0.329 ], "quaternion": [ -0.007, -0.021, -0.579, 0.815 ] } }, { "index": 24, "index_chain": 24, "chain_name": "B", "nt_resnum": 926, "nt_name": "A", "nt_code": "A", "nt_id": "///B/926", "linked_nts": [ "///B/925", "///B/927" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -61.626, "beta": 176.023, "gamma": 51.685, "delta": 80.328, "epsilon": -150.713, "zeta": -71.091, "epsilon_zeta": -79.622, "bb_type": "BI", "chi": -166.491, "glyco_bond": "anti", "C5prime_xyz": [ -1.492, 8.693, 0.958 ], "P_xyz": [ 1.019, 9.314, 1.302 ], "form": "A", "ssZp": 4.673, "Dp": 4.617, "splay_angle": 25.222, "splay_distance": 3.935, "splay_ratio": 0.220, "d22": null, "d64": null, "eta": 165.274, "theta": -145.902, "eta_prime": -172.254, "theta_prime": -142.768, "eta_base": -110.458, "theta_base": -104.634, "v0": -0.236, "v1": -22.509, "v2": 35.381, "v3": -36.562, "v4": 23.279, "amplitude": 37.427, "phase_angle": 19.034, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.875, "filter_rmsd": 0.038, "frame": { "rmsd": 0.009, "origin": [ 18.136, 12.017, 30.252 ], "x_axis": [ -0.601, -0.011, -0.800 ], "y_axis": [ 0.772, -0.267, -0.576 ], "z_axis": [ -0.208, -0.964, 0.169 ], "quaternion": [ -0.274, -0.353, -0.539, 0.714 ] } }, { "index": 25, "index_chain": 25, "chain_name": "B", "nt_resnum": 927, "nt_name": "C", "nt_code": "C", "nt_id": "///B/927", "linked_nts": [ "///B/926", "///B/928" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate", "alpha": -57.090, "beta": 169.895, "gamma": 50.290, "delta": 81.299, "epsilon": -154.462, "zeta": -68.955, "epsilon_zeta": -85.507, "bb_type": "BI", "chi": -166.681, "glyco_bond": "anti", "C5prime_xyz": [ -1.294, 8.702, 0.903 ], "P_xyz": [ 1.287, 9.031, 1.171 ], "form": "A", "ssZp": 4.580, "Dp": 4.628, "splay_angle": 23.873, "splay_distance": 3.799, "splay_ratio": 0.211, "d22": 4.555, "d64": 4.546, "eta": 167.352, "theta": -145.541, "eta_prime": -174.792, "theta_prime": -144.393, "eta_base": -119.171, "theta_base": -124.651, "v0": 2.189, "v1": -24.826, "v2": 36.807, "v3": -36.569, "v4": 21.652, "amplitude": 38.178, "phase_angle": 15.402, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.928, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 15.526, 9.105, 29.814 ], "x_axis": [ 0.052, -0.150, -0.987 ], "y_axis": [ 0.971, -0.225, 0.085 ], "z_axis": [ -0.235, -0.963, 0.134 ], "quaternion": [ -0.490, -0.535, -0.384, 0.572 ] } }, { "index": 26, "index_chain": 26, "chain_name": "B", "nt_resnum": 928, "nt_name": "C", "nt_code": "C", "nt_id": "///B/928", "linked_nts": [ "///B/927", "///B/929" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -68.990, "beta": -166.810, "gamma": 46.136, "delta": 82.897, "epsilon": -165.282, "zeta": -73.091, "epsilon_zeta": -92.191, "bb_type": "BI", "chi": -155.518, "glyco_bond": "anti", "C5prime_xyz": [ -1.236, 8.750, 0.266 ], "P_xyz": [ 1.246, 9.258, 0.923 ], "form": "A", "ssZp": 4.318, "Dp": 4.507, "splay_angle": 25.518, "splay_distance": 4.303, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": 169.340, "theta": -133.009, "eta_prime": 179.325, "theta_prime": -139.612, "eta_base": -148.989, "theta_base": -120.911, "v0": 1.428, "v1": -22.873, "v2": 34.317, "v3": -34.712, "v4": 20.972, "amplitude": 35.800, "phase_angle": 16.548, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.770, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 12.977, 6.327, 29.352 ], "x_axis": [ 0.609, -0.021, -0.793 ], "y_axis": [ 0.776, -0.192, 0.600 ], "z_axis": [ -0.164, -0.981, -0.101 ], "quaternion": [ 0.574, 0.689, 0.274, -0.347 ] } }, { "index": 27, "index_chain": 27, "chain_name": "B", "nt_resnum": 929, "nt_name": "G", "nt_code": "G", "nt_id": "///B/929", "linked_nts": [ "///B/928", "///B/930" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 164.068, "beta": -169.612, "gamma": 167.532, "delta": 85.201, "epsilon": -124.780, "zeta": -82.728, "epsilon_zeta": -42.052, "bb_type": "--", "chi": 176.577, "glyco_bond": "anti", "C5prime_xyz": [ -1.356, 8.167, 1.934 ], "P_xyz": [ 0.452, 9.902, 1.213 ], "form": "A", "ssZp": 4.775, "Dp": 4.730, "splay_angle": 22.697, "splay_distance": 3.497, "splay_ratio": 0.198, "d22": null, "d64": null, "eta": 164.682, "theta": -158.638, "eta_prime": 177.250, "theta_prime": -154.850, "eta_base": -147.686, "theta_base": -117.534, "v0": 4.709, "v1": -24.768, "v2": 34.371, "v3": -32.916, "v4": 17.766, "amplitude": 35.055, "phase_angle": 11.335, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.707, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 11.551, 3.033, 26.979 ], "x_axis": [ 0.903, 0.145, -0.405 ], "y_axis": [ 0.422, -0.117, 0.899 ], "z_axis": [ 0.083, -0.983, -0.166 ], "quaternion": [ 0.636, 0.739, 0.191, -0.109 ] } }, { "index": 28, "index_chain": 28, "chain_name": "B", "nt_resnum": 930, "nt_name": "G", "nt_code": "G", "nt_id": "///B/930", "linked_nts": [ "///B/929", "///B/931" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.919, "beta": 165.953, "gamma": 50.060, "delta": 82.063, "epsilon": -163.998, "zeta": -72.336, "epsilon_zeta": -91.661, "bb_type": "BI", "chi": -172.919, "glyco_bond": "anti", "C5prime_xyz": [ -1.344, 8.548, 1.375 ], "P_xyz": [ 1.256, 8.807, 1.593 ], "form": "A", "ssZp": 4.747, "Dp": 4.573, "splay_angle": 25.520, "splay_distance": 3.980, "splay_ratio": 0.228, "d22": null, "d64": null, "eta": 151.518, "theta": -154.052, "eta_prime": 169.975, "theta_prime": -154.171, "eta_base": -135.204, "theta_base": -145.461, "v0": 2.315, "v1": -24.514, "v2": 36.232, "v3": -35.912, "v4": 21.161, "amplitude": 37.541, "phase_angle": 15.175, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.635, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 12.406, 0.401, 24.841 ], "x_axis": [ 0.933, 0.171, 0.317 ], "y_axis": [ -0.276, -0.224, 0.935 ], "z_axis": [ 0.231, -0.959, -0.162 ], "quaternion": [ 0.622, 0.761, -0.035, 0.180 ] } }, { "index": 29, "index_chain": 29, "chain_name": "B", "nt_resnum": 931, "nt_name": "A", "nt_code": "A", "nt_id": "///B/931", "linked_nts": [ "///B/930", "///B/932" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -58.316, "beta": -169.905, "gamma": 45.796, "delta": 81.821, "epsilon": -158.336, "zeta": -82.800, "epsilon_zeta": -75.536, "bb_type": "BI", "chi": -156.488, "glyco_bond": "anti", "C5prime_xyz": [ -1.292, 8.678, 0.370 ], "P_xyz": [ 1.230, 9.108, 0.908 ], "form": "A", "ssZp": 4.414, "Dp": 4.598, "splay_angle": 27.034, "splay_distance": 4.484, "splay_ratio": 0.240, "d22": null, "d64": null, "eta": 178.971, "theta": -130.729, "eta_prime": -174.605, "theta_prime": -135.206, "eta_base": -156.905, "theta_base": -113.165, "v0": 2.541, "v1": -24.467, "v2": 36.045, "v3": -35.652, "v4": 20.830, "amplitude": 37.295, "phase_angle": 14.879, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.718, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 13.272, -1.829, 21.660 ], "x_axis": [ 0.759, 0.018, 0.650 ], "y_axis": [ -0.599, -0.370, 0.710 ], "z_axis": [ 0.253, -0.929, -0.270 ], "quaternion": [ 0.529, 0.774, -0.188, 0.292 ] } }, { "index": 30, "index_chain": 30, "chain_name": "B", "nt_resnum": 932, "nt_name": "U", "nt_code": "U", "nt_id": "///B/932", "linked_nts": [ "///B/931", "///B/933" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop", "alpha": 158.213, "beta": -155.314, "gamma": 172.877, "delta": 84.659, "epsilon": -123.629, "zeta": -70.172, "epsilon_zeta": -53.458, "bb_type": "--", "chi": 174.225, "glyco_bond": "anti", "C5prime_xyz": [ -1.489, 8.114, 2.020 ], "P_xyz": [ 0.373, 9.778, 1.254 ], "form": ".", "ssZp": 4.731, "Dp": 4.727, "splay_angle": 25.047, "splay_distance": 3.914, "splay_ratio": 0.220, "d22": 4.088, "d64": 3.770, "eta": 167.917, "theta": -142.753, "eta_prime": -178.034, "theta_prime": -139.398, "eta_base": -138.853, "theta_base": -88.817, "v0": 4.959, "v1": -25.519, "v2": 35.404, "v3": -33.648, "v4": 18.071, "amplitude": 36.070, "phase_angle": 11.031, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.792, "filter_rmsd": 0.104, "frame": { "rmsd": 0.004, "origin": [ 16.621, -4.650, 20.691 ], "x_axis": [ 0.275, 0.109, 0.955 ], "y_axis": [ -0.910, -0.289, 0.296 ], "z_axis": [ 0.308, -0.951, 0.020 ], "quaternion": [ 0.501, 0.621, -0.322, 0.508 ] } }, { "index": 31, "index_chain": 31, "chain_name": "B", "nt_resnum": 933, "nt_name": "U", "nt_code": "U", "nt_id": "///B/933", "linked_nts": [ "///B/932", "///B/934" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart", "alpha": -63.697, "beta": 172.155, "gamma": 48.365, "delta": 83.207, "epsilon": -104.230, "zeta": -123.338, "epsilon_zeta": 19.108, "bb_type": "--", "chi": -156.192, "glyco_bond": "anti", "C5prime_xyz": [ -1.342, 8.731, 0.348 ], "P_xyz": [ 1.248, 9.138, 0.500 ], "form": ".", "ssZp": 3.954, "Dp": 4.696, "splay_angle": 114.708, "splay_distance": 16.704, "splay_ratio": 0.842, "d22": 11.426, "d64": 14.847, "eta": 169.028, "theta": -134.575, "eta_prime": -172.778, "theta_prime": -168.940, "eta_base": -110.162, "theta_base": -176.417, "v0": 1.618, "v1": -23.577, "v2": 35.257, "v3": -35.421, "v4": 21.303, "amplitude": 36.715, "phase_angle": 16.202, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.636, "filter_rmsd": 0.106, "frame": { "rmsd": 0.004, "origin": [ 18.484, -6.895, 23.299 ], "x_axis": [ -0.573, -0.136, 0.808 ], "y_axis": [ -0.708, -0.416, -0.571 ], "z_axis": [ 0.414, -0.899, 0.142 ], "quaternion": [ 0.196, 0.419, -0.504, 0.730 ] } }, { "index": 32, "index_chain": 32, "chain_name": "B", "nt_resnum": 934, "nt_name": "C", "nt_code": "C", "nt_id": "///B/934", "linked_nts": [ "///B/933", "///B/935" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,BII,hairpin-loop,splayed-apart", "alpha": 76.599, "beta": -128.197, "gamma": 46.090, "delta": 142.580, "epsilon": -118.430, "zeta": 177.741, "epsilon_zeta": 63.829, "bb_type": "BII", "chi": -119.248, "glyco_bond": "anti", "C5prime_xyz": [ -2.326, 8.630, -1.281 ], "P_xyz": [ -1.038, 10.229, 0.353 ], "form": ".", "ssZp": 1.304, "Dp": 1.321, "splay_angle": 98.154, "splay_distance": 14.663, "splay_ratio": 0.756, "d22": 10.883, "d64": 13.251, "eta": -12.420, "theta": 170.860, "eta_prime": 5.855, "theta_prime": 175.043, "eta_base": -20.297, "theta_base": -151.525, "v0": -26.046, "v1": 38.159, "v2": -34.981, "v3": 21.050, "v4": 2.898, "amplitude": 38.047, "phase_angle": 156.841, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "7p", "suiteness": 0.420, "filter_rmsd": 0.061, "frame": { "rmsd": 0.003, "origin": [ 22.949, -19.412, 13.180 ], "x_axis": [ -0.610, -0.668, -0.427 ], "y_axis": [ -0.791, 0.477, 0.383 ], "z_axis": [ -0.052, 0.571, -0.819 ], "quaternion": [ 0.110, -0.428, 0.852, 0.280 ] } }, { "index": 33, "index_chain": 33, "chain_name": "B", "nt_resnum": 935, "nt_name": "U", "nt_code": "U", "nt_id": "///B/935", "linked_nts": [ "///B/934", "///B/936" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -22.334, "beta": -163.660, "gamma": 50.977, "delta": 144.083, "epsilon": -112.389, "zeta": -51.433, "epsilon_zeta": -60.957, "bb_type": "--", "chi": -110.855, "glyco_bond": "anti", "C5prime_xyz": [ -1.921, 8.253, -1.726 ], "P_xyz": [ 0.319, 9.356, -0.926 ], "form": ".", "ssZp": 0.852, "Dp": 1.348, "splay_angle": 150.584, "splay_distance": 17.670, "splay_ratio": 0.968, "d22": null, "d64": null, "eta": -82.824, "theta": -51.749, "eta_prime": -90.183, "theta_prime": -108.169, "eta_base": -103.532, "theta_base": -161.551, "v0": -18.715, "v1": 31.993, "v2": -32.345, "v3": 22.554, "v4": -2.600, "amplitude": 33.394, "phase_angle": 165.602, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.006, "origin": [ 27.151, -5.396, 14.136 ], "x_axis": [ -0.631, 0.242, -0.737 ], "y_axis": [ -0.728, -0.512, 0.455 ], "z_axis": [ -0.267, 0.824, 0.500 ], "quaternion": [ 0.299, -0.309, 0.393, 0.813 ] } }, { "index": 34, "index_chain": 34, "chain_name": "B", "nt_resnum": 936, "nt_name": "G", "nt_code": "G", "nt_id": "///B/936", "linked_nts": [ "///B/935", "///B/937" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,hairpin-loop,phosphate,splayed-apart", "alpha": -52.670, "beta": -134.249, "gamma": 151.463, "delta": 146.029, "epsilon": -131.185, "zeta": 15.049, "epsilon_zeta": 213.766, "bb_type": "--", "chi": -96.790, "glyco_bond": "anti", "C5prime_xyz": [ -2.187, 7.921, -2.281 ], "P_xyz": [ -0.031, 7.143, -3.532 ], "form": ".", "ssZp": 1.050, "Dp": 1.492, "splay_angle": 115.134, "splay_distance": 16.346, "splay_ratio": 0.845, "d22": null, "d64": null, "eta": -60.589, "theta": 3.201, "eta_prime": 21.497, "theta_prime": -26.304, "eta_base": 64.268, "theta_base": 16.692, "v0": -18.784, "v1": 33.079, "v2": -33.794, "v3": 24.057, "v4": -3.588, "amplitude": 34.698, "phase_angle": 166.893, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 24.761, -11.679, 30.477 ], "x_axis": [ 0.881, -0.457, -0.124 ], "y_axis": [ 0.155, 0.525, -0.837 ], "z_axis": [ 0.448, 0.718, 0.533 ], "quaternion": [ 0.857, -0.453, 0.167, -0.179 ] } }, { "index": 35, "index_chain": 35, "chain_name": "B", "nt_resnum": 937, "nt_name": "A", "nt_code": "A", "nt_id": "///B/937", "linked_nts": [ "///B/936", "///B/938" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart", "alpha": -92.959, "beta": -164.756, "gamma": 48.259, "delta": 83.257, "epsilon": -148.268, "zeta": -57.124, "epsilon_zeta": -91.144, "bb_type": "BI", "chi": -173.553, "glyco_bond": "anti", "C5prime_xyz": [ -1.439, 8.490, 1.309 ], "P_xyz": [ 0.901, 8.719, 2.465 ], "form": ".", "ssZp": 4.634, "Dp": 4.652, "splay_angle": 35.006, "splay_distance": 5.333, "splay_ratio": 0.303, "d22": null, "d64": null, "eta": 152.877, "theta": -129.764, "eta_prime": -163.771, "theta_prime": -123.452, "eta_base": -155.179, "theta_base": -84.656, "v0": 3.419, "v1": -25.431, "v2": 36.512, "v3": -35.583, "v4": 20.270, "amplitude": 37.551, "phase_angle": 13.512, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.002, "origin": [ 20.001, -6.093, 15.871 ], "x_axis": [ -0.676, -0.623, 0.395 ], "y_axis": [ 0.435, 0.096, 0.895 ], "z_axis": [ -0.596, 0.776, 0.206 ], "quaternion": [ -0.396, -0.075, 0.626, 0.668 ] } }, { "index": 36, "index_chain": 36, "chain_name": "B", "nt_resnum": 938, "nt_name": "U", "nt_code": "U", "nt_id": "///B/938", "linked_nts": [ "///B/937", "///B/939" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop", "alpha": -62.577, "beta": -178.986, "gamma": 52.461, "delta": 83.739, "epsilon": -140.344, "zeta": -65.595, "epsilon_zeta": -74.750, "bb_type": "BI", "chi": -174.805, "glyco_bond": "anti", "C5prime_xyz": [ -1.507, 8.489, 1.437 ], "P_xyz": [ 0.979, 8.826, 2.178 ], "form": ".", "ssZp": 4.747, "Dp": 4.677, "splay_angle": 28.617, "splay_distance": 4.340, "splay_ratio": 0.248, "d22": 3.924, "d64": 3.794, "eta": 174.341, "theta": -129.003, "eta_prime": -164.173, "theta_prime": -122.962, "eta_base": -106.380, "theta_base": -66.578, "v0": 2.461, "v1": -24.404, "v2": 35.729, "v3": -35.368, "v4": 20.806, "amplitude": 36.976, "phase_angle": 14.925, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.835, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ 15.189, -4.517, 17.548 ], "x_axis": [ -0.101, -0.353, 0.930 ], "y_axis": [ 0.905, 0.355, 0.233 ], "z_axis": [ -0.412, 0.866, 0.283 ], "quaternion": [ 0.620, -0.255, -0.541, -0.507 ] } }, { "index": 37, "index_chain": 37, "chain_name": "B", "nt_resnum": 939, "nt_name": "U", "nt_code": "U", "nt_id": "///B/939", "linked_nts": [ "///B/938", "///B/940" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -60.736, "beta": 168.468, "gamma": 52.542, "delta": 86.633, "epsilon": -152.998, "zeta": -57.444, "epsilon_zeta": -95.554, "bb_type": "BI", "chi": -155.823, "glyco_bond": "anti", "C5prime_xyz": [ -1.232, 8.668, 0.310 ], "P_xyz": [ 1.393, 8.805, 0.311 ], "form": ".", "ssZp": 4.308, "Dp": 4.570, "splay_angle": 37.635, "splay_distance": 5.741, "splay_ratio": 0.323, "d22": 3.353, "d64": 3.964, "eta": 164.173, "theta": -125.191, "eta_prime": -169.594, "theta_prime": -122.727, "eta_base": -92.270, "theta_base": -82.129, "v0": 4.031, "v1": -24.861, "v2": 35.052, "v3": -33.779, "v4": 18.739, "amplitude": 35.883, "phase_angle": 12.353, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.872, "filter_rmsd": 0.103, "frame": { "rmsd": 0.003, "origin": [ 14.278, -3.030, 21.522 ], "x_axis": [ 0.655, 0.189, 0.732 ], "y_axis": [ 0.491, 0.629, -0.602 ], "z_axis": [ -0.575, 0.754, 0.319 ], "quaternion": [ 0.807, -0.420, -0.405, -0.094 ] } }, { "index": 38, "index_chain": 38, "chain_name": "B", "nt_resnum": 940, "nt_name": "C", "nt_code": "C", "nt_id": "///B/940", "linked_nts": [ "///B/939", "///B/941" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.106, "beta": 171.212, "gamma": 55.060, "delta": 86.798, "epsilon": -110.882, "zeta": -147.929, "epsilon_zeta": 37.047, "bb_type": "--", "chi": -174.986, "glyco_bond": "anti", "C5prime_xyz": [ -1.249, 8.466, 1.452 ], "P_xyz": [ 1.339, 8.444, 1.986 ], "form": ".", "ssZp": 4.618, "Dp": 4.691, "splay_angle": 25.153, "splay_distance": 3.998, "splay_ratio": 0.218, "d22": 5.093, "d64": 4.959, "eta": -179.025, "theta": -145.333, "eta_prime": -156.307, "theta_prime": -151.744, "eta_base": -96.917, "theta_base": -168.682, "v0": 4.360, "v1": -24.284, "v2": 33.883, "v3": -32.415, "v4": 17.722, "amplitude": 34.595, "phase_angle": 11.647, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.774, "filter_rmsd": 0.064, "frame": { "rmsd": 0.006, "origin": [ 14.865, 1.721, 24.690 ], "x_axis": [ 0.882, 0.446, -0.151 ], "y_axis": [ -0.184, 0.031, -0.982 ], "z_axis": [ -0.433, 0.894, 0.110 ], "quaternion": [ 0.711, -0.660, -0.099, 0.221 ] } }, { "index": 39, "index_chain": 39, "chain_name": "B", "nt_resnum": 941, "nt_name": "C", "nt_code": "C", "nt_id": "///B/941", "linked_nts": [ "///B/940", "///B/942" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 116.095, "beta": -118.629, "gamma": 167.291, "delta": 83.769, "epsilon": -137.233, "zeta": -72.200, "epsilon_zeta": -65.033, "bb_type": "BI", "chi": -174.818, "glyco_bond": "anti", "C5prime_xyz": [ -1.357, 8.513, 1.483 ], "P_xyz": [ 0.572, 9.199, -0.133 ], "form": "A", "ssZp": 4.656, "Dp": 4.623, "splay_angle": 25.840, "splay_distance": 4.062, "splay_ratio": 0.225, "d22": null, "d64": null, "eta": 144.333, "theta": -141.436, "eta_prime": 157.282, "theta_prime": -149.860, "eta_base": 154.009, "theta_base": -119.550, "v0": 1.636, "v1": -22.280, "v2": 33.514, "v3": -33.618, "v4": 20.143, "amplitude": 34.889, "phase_angle": 16.138, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 11.699, 2.478, 27.011 ], "x_axis": [ 0.922, 0.193, -0.336 ], "y_axis": [ -0.377, 0.241, -0.894 ], "z_axis": [ -0.092, 0.951, 0.295 ], "quaternion": [ 0.784, -0.588, 0.078, 0.182 ] } }, { "index": 40, "index_chain": 40, "chain_name": "B", "nt_resnum": 942, "nt_name": "G", "nt_code": "G", "nt_id": "///B/942", "linked_nts": [ "///B/941", "///B/943" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.377, "beta": 172.087, "gamma": 44.590, "delta": 79.469, "epsilon": -148.588, "zeta": -76.852, "epsilon_zeta": -71.736, "bb_type": "BI", "chi": -175.595, "glyco_bond": "anti", "C5prime_xyz": [ -1.505, 8.522, 1.479 ], "P_xyz": [ 0.986, 8.935, 2.152 ], "form": "A", "ssZp": 4.788, "Dp": 4.688, "splay_angle": 24.005, "splay_distance": 3.960, "splay_ratio": 0.221, "d22": null, "d64": null, "eta": 157.783, "theta": -150.686, "eta_prime": 174.199, "theta_prime": -146.741, "eta_base": -131.375, "theta_base": -131.108, "v0": 1.178, "v1": -23.710, "v2": 35.915, "v3": -36.433, "v4": 22.217, "amplitude": 37.553, "phase_angle": 16.985, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.813, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 13.203, 5.958, 28.469 ], "x_axis": [ 0.473, 0.110, -0.874 ], "y_axis": [ -0.877, -0.036, -0.479 ], "z_axis": [ -0.084, 0.993, 0.079 ], "quaternion": [ 0.616, -0.598, 0.321, 0.401 ] } }, { "index": 41, "index_chain": 41, "chain_name": "B", "nt_resnum": 943, "nt_name": "G", "nt_code": "G", "nt_id": "///B/943", "linked_nts": [ "///B/942", "///B/944" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -54.784, "beta": 179.503, "gamma": 51.898, "delta": 82.373, "epsilon": -157.271, "zeta": -62.529, "epsilon_zeta": -94.742, "bb_type": "BI", "chi": -156.444, "glyco_bond": "anti", "C5prime_xyz": [ -1.589, 8.871, 0.233 ], "P_xyz": [ 0.897, 9.591, 0.600 ], "form": "A", "ssZp": 4.212, "Dp": 4.470, "splay_angle": 20.385, "splay_distance": 3.424, "splay_ratio": 0.181, "d22": null, "d64": null, "eta": 178.399, "theta": -141.787, "eta_prime": -170.832, "theta_prime": -141.212, "eta_base": -146.887, "theta_base": -109.621, "v0": -1.132, "v1": -21.378, "v2": 34.471, "v3": -36.176, "v4": 23.510, "amplitude": 36.776, "phase_angle": 20.393, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.884, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 15.552, 8.910, 29.675 ], "x_axis": [ 0.029, 0.067, -0.997 ], "y_axis": [ -0.998, 0.062, -0.025 ], "z_axis": [ 0.060, 0.996, 0.069 ], "quaternion": [ 0.538, -0.474, 0.491, 0.494 ] } }, { "index": 42, "index_chain": 42, "chain_name": "B", "nt_resnum": 944, "nt_name": "C", "nt_code": "C", "nt_id": "///B/944", "linked_nts": [ "///B/943", "///B/945" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -64.732, "beta": -178.474, "gamma": 48.712, "delta": 83.472, "epsilon": -128.192, "zeta": -121.649, "epsilon_zeta": -6.543, "bb_type": "--", "chi": -143.769, "glyco_bond": "anti", "C5prime_xyz": [ -1.617, 8.909, -0.409 ], "P_xyz": [ 0.856, 9.780, -0.415 ], "form": ".", "ssZp": 3.669, "Dp": 4.520, "splay_angle": 74.776, "splay_distance": 11.731, "splay_ratio": 0.607, "d22": null, "d64": null, "eta": 174.232, "theta": 174.598, "eta_prime": -172.850, "theta_prime": -163.583, "eta_base": -131.203, "theta_base": -142.384, "v0": -2.906, "v1": -19.501, "v2": 33.041, "v3": -35.797, "v4": 24.386, "amplitude": 35.948, "phase_angle": 23.202, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.873, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 16.862, 11.785, 28.356 ], "x_axis": [ -0.542, 0.042, -0.840 ], "y_axis": [ -0.819, 0.198, 0.538 ], "z_axis": [ 0.189, 0.979, -0.073 ], "quaternion": [ 0.382, -0.289, 0.673, 0.564 ] } }, { "index": 43, "index_chain": 43, "chain_name": "B", "nt_resnum": 945, "nt_name": "A", "nt_code": "A", "nt_id": "///B/945", "linked_nts": [ "///B/944", "///B/946" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart", "alpha": -42.373, "beta": -159.957, "gamma": 61.967, "delta": 86.551, "epsilon": 168.844, "zeta": 26.060, "epsilon_zeta": 142.784, "bb_type": "--", "chi": -102.840, "glyco_bond": "anti", "C5prime_xyz": [ -2.680, 7.896, -2.549 ], "P_xyz": [ -0.460, 8.831, -3.604 ], "form": ".", "ssZp": 1.945, "Dp": 3.552, "splay_angle": 126.448, "splay_distance": 18.765, "splay_ratio": 0.893, "d22": null, "d64": null, "eta": -126.907, "theta": -50.543, "eta_prime": -138.235, "theta_prime": -84.266, "eta_base": -153.853, "theta_base": -93.165, "v0": -8.510, "v1": -12.491, "v2": 27.339, "v3": -33.223, "v4": 26.270, "amplitude": 32.753, "phase_angle": 33.415, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "7a", "suiteness": 0.250, "filter_rmsd": 0.039, "frame": { "rmsd": 0.005, "origin": [ 17.256, 23.346, 30.310 ], "x_axis": [ -0.658, 0.134, -0.741 ], "y_axis": [ -0.735, -0.328, 0.593 ], "z_axis": [ -0.164, 0.935, 0.314 ], "quaternion": [ 0.287, -0.299, 0.504, 0.758 ] } }, { "index": 44, "index_chain": 44, "chain_name": "B", "nt_resnum": 946, "nt_name": "U", "nt_code": "U", "nt_id": "///B/946", "linked_nts": [ "///B/945", "///B/947" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-stack,non-pair-contact,junction-loop,phosphate,splayed-apart", "alpha": 106.629, "beta": 119.468, "gamma": -72.756, "delta": 82.330, "epsilon": -162.031, "zeta": -162.548, "epsilon_zeta": 0.517, "bb_type": "--", "chi": -174.921, "glyco_bond": "anti", "C5prime_xyz": [ -2.035, 8.718, 1.284 ], "P_xyz": [ -2.501, 10.010, 3.546 ], "form": ".", "ssZp": 4.159, "Dp": 4.210, "splay_angle": 69.684, "splay_distance": 9.678, "splay_ratio": 0.573, "d22": 7.205, "d64": 7.243, "eta": -154.816, "theta": 73.409, "eta_prime": -118.652, "theta_prime": 82.312, "eta_base": -92.424, "theta_base": 87.238, "v0": -4.688, "v1": -16.967, "v2": 30.809, "v3": -34.491, "v4": 24.760, "amplitude": 34.382, "phase_angle": 26.353, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33m", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.106, "frame": { "rmsd": 0.008, "origin": [ 2.163, 24.939, 41.347 ], "x_axis": [ -0.485, -0.858, 0.170 ], "y_axis": [ 0.708, -0.500, -0.499 ], "z_axis": [ 0.513, -0.121, 0.850 ], "quaternion": [ -0.465, 0.203, -0.184, 0.842 ] } }, { "index": 45, "index_chain": 45, "chain_name": "B", "nt_resnum": 947, "nt_name": "U", "nt_code": "U", "nt_id": "///B/947", "linked_nts": [ "///B/946", "///B/948" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,non-stack,non-pair-contact,junction-loop", "alpha": -83.706, "beta": 127.650, "gamma": 52.669, "delta": 140.835, "epsilon": -152.060, "zeta": 172.612, "epsilon_zeta": 35.329, "bb_type": "--", "chi": 158.169, "glyco_bond": "--", "C5prime_xyz": [ -2.927, 7.791, 2.494 ], "P_xyz": [ -1.347, 6.643, 4.247 ], "form": ".", "ssZp": -0.234, "Dp": 1.832, "splay_angle": 48.732, "splay_distance": 7.535, "splay_ratio": 0.413, "d22": 5.227, "d64": 5.637, "eta": 125.405, "theta": 178.693, "eta_prime": 151.494, "theta_prime": 153.797, "eta_base": 149.384, "theta_base": 139.608, "v0": -22.664, "v1": 34.602, "v2": -32.827, "v3": 20.717, "v4": 1.058, "amplitude": 35.028, "phase_angle": 159.583, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "3b", "suiteness": 0.037, "filter_rmsd": 0.106, "frame": { "rmsd": 0.009, "origin": [ 7.837, 28.330, 34.277 ], "x_axis": [ -0.477, -0.808, -0.346 ], "y_axis": [ 0.714, -0.586, 0.384 ], "z_axis": [ -0.513, -0.064, 0.856 ], "quaternion": [ -0.445, -0.251, 0.094, 0.854 ] } }, { "index": 46, "index_chain": 46, "chain_name": "B", "nt_resnum": 948, "nt_name": "C", "nt_code": "C", "nt_id": "///B/948", "linked_nts": [ "///B/947", "///B/949" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,cap-acceptor,phosphate,splayed-apart", "alpha": -34.682, "beta": 142.147, "gamma": 36.395, "delta": 141.042, "epsilon": -143.607, "zeta": 79.912, "epsilon_zeta": 136.480, "bb_type": "--", "chi": -151.275, "glyco_bond": "anti", "C5prime_xyz": [ -1.979, 8.803, 0.471 ], "P_xyz": [ 0.119, 8.866, 2.034 ], "form": ".", "ssZp": 1.860, "Dp": 2.014, "splay_angle": 145.070, "splay_distance": 17.426, "splay_ratio": 0.954, "d22": 11.312, "d64": 13.830, "eta": -175.919, "theta": 94.533, "eta_prime": -168.191, "theta_prime": 46.033, "eta_base": -179.406, "theta_base": -84.588, "v0": -24.240, "v1": 36.166, "v2": -33.554, "v3": 20.536, "v4": 2.161, "amplitude": 36.227, "phase_angle": 157.853, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4b", "suiteness": 0.067, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 13.841, 29.547, 29.889 ], "x_axis": [ -0.965, -0.153, 0.215 ], "y_axis": [ 0.238, -0.157, 0.958 ], "z_axis": [ -0.113, 0.976, 0.188 ], "quaternion": [ -0.129, 0.033, 0.636, 0.760 ] } }, { "index": 47, "index_chain": 47, "chain_name": "B", "nt_resnum": 949, "nt_name": "C", "nt_code": "C", "nt_id": "///B/949", "linked_nts": [ "///B/948", "///B/950" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart", "alpha": 47.804, "beta": 171.925, "gamma": 49.049, "delta": 86.828, "epsilon": -147.819, "zeta": -70.935, "epsilon_zeta": -76.884, "bb_type": "BI", "chi": -169.567, "glyco_bond": "anti", "C5prime_xyz": [ -1.255, 8.539, 1.145 ], "P_xyz": [ 1.283, 8.507, 1.776 ], "form": "A", "ssZp": 4.567, "Dp": 4.586, "splay_angle": 24.323, "splay_distance": 3.905, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": -50.690, "theta": -135.537, "eta_prime": -29.371, "theta_prime": -135.201, "eta_base": 104.718, "theta_base": -113.712, "v0": 3.461, "v1": -23.988, "v2": 34.148, "v3": -33.232, "v4": 18.831, "amplitude": 35.072, "phase_angle": 13.181, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "6d", "suiteness": 0.548, "filter_rmsd": 0.063, "frame": { "rmsd": 0.002, "origin": [ 25.567, 37.338, 40.159 ], "x_axis": [ -0.203, 0.544, -0.815 ], "y_axis": [ -0.282, -0.829, -0.483 ], "z_axis": [ -0.938, 0.132, 0.321 ], "quaternion": [ 0.269, -0.571, -0.115, 0.767 ] } }, { "index": 48, "index_chain": 48, "chain_name": "B", "nt_resnum": 950, "nt_name": "G", "nt_code": "G", "nt_id": "///B/950", "linked_nts": [ "///B/949", "///B/951" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.152, "beta": -179.678, "gamma": 46.126, "delta": 81.748, "epsilon": -158.232, "zeta": -68.341, "epsilon_zeta": -89.891, "bb_type": "BI", "chi": -156.570, "glyco_bond": "anti", "C5prime_xyz": [ -1.361, 8.808, 0.306 ], "P_xyz": [ 1.160, 9.361, 0.774 ], "form": "A", "ssZp": 4.305, "Dp": 4.530, "splay_angle": 20.452, "splay_distance": 3.266, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 168.331, "theta": -148.665, "eta_prime": -177.347, "theta_prime": -146.446, "eta_base": -139.307, "theta_base": -119.147, "v0": 1.053, "v1": -22.927, "v2": 34.868, "v3": -35.306, "v4": 21.592, "amplitude": 36.472, "phase_angle": 17.053, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.839, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 22.631, 39.581, 41.423 ], "x_axis": [ -0.262, -0.016, -0.965 ], "y_axis": [ -0.165, -0.984, 0.061 ], "z_axis": [ -0.951, 0.175, 0.256 ], "quaternion": [ 0.047, -0.606, 0.075, 0.791 ] } }, { "index": 49, "index_chain": 49, "chain_name": "B", "nt_resnum": 951, "nt_name": "A", "nt_code": "A", "nt_id": "///B/951", "linked_nts": [ "///B/950", "///B/952" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.922, "beta": -178.461, "gamma": 46.427, "delta": 83.422, "epsilon": -169.211, "zeta": -77.615, "epsilon_zeta": -91.596, "bb_type": "BI", "chi": -150.572, "glyco_bond": "anti", "C5prime_xyz": [ -1.336, 8.730, -0.030 ], "P_xyz": [ 1.223, 9.234, 0.222 ], "form": "A", "ssZp": 4.170, "Dp": 4.446, "splay_angle": 22.545, "splay_distance": 3.813, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 165.967, "theta": -135.647, "eta_prime": -179.572, "theta_prime": -145.578, "eta_base": -139.176, "theta_base": -131.157, "v0": 1.472, "v1": -23.119, "v2": 34.834, "v3": -35.037, "v4": 21.120, "amplitude": 36.313, "phase_angle": 16.406, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.853, "filter_rmsd": 0.038, "frame": { "rmsd": 0.003, "origin": [ 19.768, 41.146, 41.280 ], "x_axis": [ -0.186, -0.560, -0.807 ], "y_axis": [ -0.136, -0.799, 0.586 ], "z_axis": [ -0.973, 0.219, 0.072 ], "quaternion": [ -0.148, -0.621, 0.280, 0.717 ] } }, { "index": 50, "index_chain": 50, "chain_name": "B", "nt_resnum": 952, "nt_name": "G", "nt_code": "G", "nt_id": "///B/952", "linked_nts": [ "///B/951", "///B/953" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 158.094, "beta": -165.520, "gamma": 167.847, "delta": 82.714, "epsilon": -135.667, "zeta": -69.026, "epsilon_zeta": -66.641, "bb_type": "BI", "chi": -175.991, "glyco_bond": "anti", "C5prime_xyz": [ -1.071, 8.283, 1.543 ], "P_xyz": [ 0.560, 9.909, 0.319 ], "form": ".", "ssZp": 4.855, "Dp": 4.785, "splay_angle": 28.156, "splay_distance": 4.435, "splay_ratio": 0.251, "d22": null, "d64": null, "eta": 156.751, "theta": -151.159, "eta_prime": 170.165, "theta_prime": -147.819, "eta_base": -155.336, "theta_base": -113.937, "v0": 6.348, "v1": -26.998, "v2": 36.510, "v3": -34.000, "v4": 17.338, "amplitude": 36.975, "phase_angle": 9.097, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.736, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 16.727, 43.013, 39.935 ], "x_axis": [ -0.132, -0.849, -0.511 ], "y_axis": [ -0.114, -0.499, 0.859 ], "z_axis": [ -0.985, 0.172, -0.031 ], "quaternion": [ -0.291, -0.591, 0.407, 0.632 ] } }, { "index": 51, "index_chain": 51, "chain_name": "B", "nt_resnum": 953, "nt_name": "G", "nt_code": "G", "nt_id": "///B/953", "linked_nts": [ "///B/952", "///B/954" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop", "alpha": -53.840, "beta": 174.364, "gamma": 50.008, "delta": 81.556, "epsilon": -157.791, "zeta": -66.673, "epsilon_zeta": -91.118, "bb_type": "BI", "chi": -170.008, "glyco_bond": "anti", "C5prime_xyz": [ -1.627, 8.680, 1.094 ], "P_xyz": [ 0.886, 9.215, 1.619 ], "form": "A", "ssZp": 4.605, "Dp": 4.589, "splay_angle": 25.155, "splay_distance": 3.968, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 168.769, "theta": -145.249, "eta_prime": -170.860, "theta_prime": -142.984, "eta_base": -118.217, "theta_base": -112.523, "v0": 0.533, "v1": -23.187, "v2": 35.691, "v3": -36.388, "v4": 22.599, "amplitude": 37.485, "phase_angle": 17.800, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.826, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 13.373, 42.008, 37.214 ], "x_axis": [ -0.052, -0.983, 0.177 ], "y_axis": [ -0.015, 0.178, 0.984 ], "z_axis": [ -0.999, 0.049, -0.025 ], "quaternion": [ 0.525, 0.446, -0.560, -0.461 ] } }, { "index": 52, "index_chain": 52, "chain_name": "B", "nt_resnum": 954, "nt_name": "U", "nt_code": "U", "nt_id": "///B/954", "linked_nts": [ "///B/953", "///B/955" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop", "alpha": -61.769, "beta": -175.840, "gamma": 51.610, "delta": 84.528, "epsilon": -144.536, "zeta": -66.690, "epsilon_zeta": -77.846, "bb_type": "BI", "chi": -159.306, "glyco_bond": "anti", "C5prime_xyz": [ -1.422, 8.731, 0.499 ], "P_xyz": [ 1.108, 9.212, 1.029 ], "form": ".", "ssZp": 4.346, "Dp": 4.572, "splay_angle": 23.177, "splay_distance": 3.664, "splay_ratio": 0.201, "d22": 3.865, "d64": 3.332, "eta": 178.218, "theta": -133.416, "eta_prime": -168.938, "theta_prime": -130.067, "eta_base": -126.756, "theta_base": -83.911, "v0": 1.672, "v1": -22.642, "v2": 33.882, "v3": -33.959, "v4": 20.313, "amplitude": 35.253, "phase_angle": 16.029, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.885, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 10.008, 40.488, 35.760 ], "x_axis": [ -0.057, -0.674, 0.736 ], "y_axis": [ -0.008, 0.738, 0.675 ], "z_axis": [ -0.998, 0.033, -0.047 ], "quaternion": [ 0.639, 0.251, -0.679, -0.261 ] } }, { "index": 53, "index_chain": 53, "chain_name": "B", "nt_resnum": 955, "nt_name": "U", "nt_code": "U", "nt_id": "///B/955", "linked_nts": [ "///B/954", "///B/956" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,cap-acceptor", "alpha": -72.476, "beta": 178.372, "gamma": 51.438, "delta": 85.523, "epsilon": -146.064, "zeta": -52.108, "epsilon_zeta": -93.957, "bb_type": "BI", "chi": -148.889, "glyco_bond": "anti", "C5prime_xyz": [ -1.322, 8.718, -0.092 ], "P_xyz": [ 1.277, 9.071, -0.117 ], "form": ".", "ssZp": 4.119, "Dp": 4.625, "splay_angle": 70.434, "splay_distance": 10.415, "splay_ratio": 0.577, "d22": 7.952, "d64": 10.142, "eta": 160.986, "theta": -104.742, "eta_prime": 179.696, "theta_prime": -151.094, "eta_base": -119.681, "theta_base": 143.924, "v0": 1.583, "v1": -22.956, "v2": 34.288, "v3": -34.431, "v4": 20.719, "amplitude": 35.701, "phase_angle": 16.177, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.891, "filter_rmsd": 0.103, "frame": { "rmsd": 0.004, "origin": [ 7.144, 39.054, 37.537 ], "x_axis": [ 0.159, 0.074, 0.984 ], "y_axis": [ -0.185, 0.982, -0.044 ], "z_axis": [ -0.970, -0.175, 0.170 ], "quaternion": [ 0.760, 0.043, -0.643, 0.085 ] } }, { "index": 54, "index_chain": 54, "chain_name": "B", "nt_resnum": 956, "nt_name": "C", "nt_code": "C", "nt_id": "///B/956", "linked_nts": [ "///B/955", "///B/957" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,turn,u-turn,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,kissing-loop", "alpha": 169.419, "beta": 150.605, "gamma": 49.708, "delta": 83.729, "epsilon": -140.820, "zeta": -63.759, "epsilon_zeta": -77.061, "bb_type": "BI", "chi": -170.285, "glyco_bond": "anti", "C5prime_xyz": [ -1.428, 8.627, 1.107 ], "P_xyz": [ 1.175, 8.634, 1.336 ], "form": ".", "ssZp": 4.503, "Dp": 4.603, "splay_angle": 28.312, "splay_distance": 4.494, "splay_ratio": 0.246, "d22": null, "d64": null, "eta": 20.721, "theta": -123.376, "eta_prime": 48.114, "theta_prime": -124.733, "eta_base": 23.492, "theta_base": -87.742, "v0": 1.677, "v1": -23.174, "v2": 34.780, "v3": -34.841, "v4": 20.909, "amplitude": 36.200, "phase_angle": 16.101, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.747, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 1.293, 40.148, 28.991 ], "x_axis": [ 0.331, 0.790, -0.516 ], "y_axis": [ -0.186, 0.590, 0.785 ], "z_axis": [ 0.925, -0.164, 0.342 ], "quaternion": [ 0.752, 0.315, 0.479, 0.324 ] } }, { "index": 55, "index_chain": 55, "chain_name": "B", "nt_resnum": 957, "nt_name": "G", "nt_code": "G", "nt_id": "///B/957", "linked_nts": [ "///B/956", "///B/958" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate", "alpha": -61.456, "beta": 175.439, "gamma": 48.597, "delta": 82.896, "epsilon": -147.509, "zeta": -59.356, "epsilon_zeta": -88.154, "bb_type": "BI", "chi": -162.208, "glyco_bond": "anti", "C5prime_xyz": [ -1.342, 8.750, 0.665 ], "P_xyz": [ 1.203, 9.238, 1.015 ], "form": ".", "ssZp": 4.480, "Dp": 4.607, "splay_angle": 43.828, "splay_distance": 6.688, "splay_ratio": 0.373, "d22": null, "d64": null, "eta": 164.835, "theta": -140.323, "eta_prime": -174.579, "theta_prime": -129.390, "eta_base": -114.111, "theta_base": -110.752, "v0": 1.483, "v1": -23.756, "v2": 35.739, "v3": -35.984, "v4": 21.696, "amplitude": 37.261, "phase_angle": 16.433, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.905, "filter_rmsd": 0.004, "frame": { "rmsd": 0.004, "origin": [ 5.590, 41.432, 28.692 ], "x_axis": [ 0.021, 0.979, 0.202 ], "y_axis": [ -0.378, -0.180, 0.908 ], "z_axis": [ 0.926, -0.095, 0.366 ], "quaternion": [ 0.549, 0.457, 0.329, 0.617 ] } }, { "index": 56, "index_chain": 56, "chain_name": "B", "nt_resnum": 958, "nt_name": "A", "nt_code": "A", "nt_id": "///B/958", "linked_nts": [ "///B/957", "///B/959" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate", "alpha": -56.227, "beta": -130.508, "gamma": 58.648, "delta": 149.443, "epsilon": -127.634, "zeta": -159.171, "epsilon_zeta": 31.538, "bb_type": "--", "chi": -76.840, "glyco_bond": "anti", "C5prime_xyz": [ -2.845, 7.159, -2.806 ], "P_xyz": [ -0.643, 8.592, -2.797 ], "form": ".", "ssZp": 0.928, "Dp": 1.459, "splay_angle": 71.731, "splay_distance": 11.239, "splay_ratio": 0.589, "d22": null, "d64": null, "eta": -137.739, "theta": -127.786, "eta_prime": -118.284, "theta_prime": -177.089, "eta_base": -114.083, "theta_base": 145.632, "v0": -19.972, "v1": 34.379, "v2": -34.908, "v3": 24.444, "v4": -3.003, "amplitude": 35.986, "phase_angle": 165.941, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "1[", "suiteness": 0.794, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 11.687, 42.798, 31.076 ], "x_axis": [ -0.162, 0.782, 0.601 ], "y_axis": [ -0.248, -0.622, 0.743 ], "z_axis": [ 0.955, -0.029, 0.295 ], "quaternion": [ 0.357, 0.540, 0.248, 0.721 ] } }, { "index": 57, "index_chain": 57, "chain_name": "B", "nt_resnum": 959, "nt_name": "A", "nt_code": "A", "nt_id": "///B/959", "linked_nts": [ "///B/958", "///B/960" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor", "alpha": 116.534, "beta": -153.120, "gamma": 54.732, "delta": 90.622, "epsilon": -159.707, "zeta": -69.764, "epsilon_zeta": -89.943, "bb_type": "BI", "chi": -167.862, "glyco_bond": "anti", "C5prime_xyz": [ -1.367, 8.498, 1.001 ], "P_xyz": [ 0.988, 8.562, 2.148 ], "form": ".", "ssZp": 4.449, "Dp": 4.461, "splay_angle": 27.030, "splay_distance": 4.218, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 27.506, "theta": -109.438, "eta_prime": 37.421, "theta_prime": -106.252, "eta_base": 51.273, "theta_base": -51.003, "v0": 2.925, "v1": -23.176, "v2": 33.197, "v3": -32.761, "v4": 18.818, "amplitude": 34.213, "phase_angle": 14.003, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "4d", "suiteness": 0.146, "filter_rmsd": 0.037, "frame": { "rmsd": 0.004, "origin": [ 14.609, 33.056, 26.294 ], "x_axis": [ -0.942, -0.217, -0.254 ], "y_axis": [ -0.213, -0.198, 0.957 ], "z_axis": [ -0.258, 0.956, 0.140 ], "quaternion": [ -0.001, -0.170, 0.633, 0.755 ] } }, { "index": 58, "index_chain": 58, "chain_name": "B", "nt_resnum": 960, "nt_name": "U", "nt_code": "U", "nt_id": "///B/960", "linked_nts": [ "///B/959", "///B/961" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-pair-contact,hairpin-loop,kissing-loop,phosphate", "alpha": 169.991, "beta": -150.903, "gamma": 162.512, "delta": 142.485, "epsilon": -93.463, "zeta": -44.543, "epsilon_zeta": -48.921, "bb_type": "--", "chi": -144.626, "glyco_bond": "anti", "C5prime_xyz": [ -1.711, 8.666, 0.177 ], "P_xyz": [ 0.689, 9.157, -0.670 ], "form": ".", "ssZp": 1.084, "Dp": 1.092, "splay_angle": 84.790, "splay_distance": 13.228, "splay_ratio": 0.675, "d22": 6.079, "d64": 6.736, "eta": -154.305, "theta": -61.913, "eta_prime": -131.711, "theta_prime": -70.069, "eta_base": -66.919, "theta_base": -38.586, "v0": -19.095, "v1": 31.967, "v2": -31.884, "v3": 21.867, "v4": -1.949, "amplitude": 33.091, "phase_angle": 164.482, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "1t", "suiteness": 0.449, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 10.570, 34.160, 26.799 ], "x_axis": [ -0.609, -0.441, 0.659 ], "y_axis": [ 0.538, 0.380, 0.752 ], "z_axis": [ -0.582, 0.813, 0.006 ], "quaternion": [ -0.441, 0.034, 0.704, 0.556 ] } }, { "index": 59, "index_chain": 59, "chain_name": "B", "nt_resnum": 961, "nt_name": "C", "nt_code": "C", "nt_id": "///B/961", "linked_nts": [ "///B/960", "///B/962" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop", "alpha": -92.764, "beta": -175.290, "gamma": 42.857, "delta": 81.482, "epsilon": -152.199, "zeta": -74.953, "epsilon_zeta": -77.246, "bb_type": "BI", "chi": -171.747, "glyco_bond": "anti", "C5prime_xyz": [ -1.524, 8.659, 1.156 ], "P_xyz": [ 0.766, 9.064, 2.372 ], "form": "A", "ssZp": 4.459, "Dp": 4.540, "splay_angle": 25.461, "splay_distance": 3.932, "splay_ratio": 0.221, "d22": 4.382, "d64": 4.295, "eta": 115.819, "theta": -150.924, "eta_prime": 162.574, "theta_prime": -144.371, "eta_base": -159.631, "theta_base": -112.427, "v0": 0.759, "v1": -22.934, "v2": 35.240, "v3": -35.887, "v4": 22.116, "amplitude": 36.961, "phase_angle": 17.555, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "2a", "suiteness": 0.340, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 13.180, 42.028, 37.108 ], "x_axis": [ 0.046, -0.995, 0.087 ], "y_axis": [ 0.274, -0.071, -0.959 ], "z_axis": [ 0.961, 0.068, 0.269 ], "quaternion": [ 0.558, -0.461, 0.392, -0.569 ] } }, { "index": 60, "index_chain": 60, "chain_name": "B", "nt_resnum": 962, "nt_name": "C", "nt_code": "C", "nt_id": "///B/962", "linked_nts": [ "///B/961", "///B/963" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.452, "beta": -178.061, "gamma": 48.390, "delta": 85.931, "epsilon": -151.611, "zeta": -76.629, "epsilon_zeta": -74.982, "bb_type": "BI", "chi": -166.261, "glyco_bond": "anti", "C5prime_xyz": [ -1.334, 8.646, 0.919 ], "P_xyz": [ 1.124, 8.800, 1.842 ], "form": "A", "ssZp": 4.398, "Dp": 4.499, "splay_angle": 24.464, "splay_distance": 3.865, "splay_ratio": 0.212, "d22": 4.635, "d64": 4.477, "eta": 173.063, "theta": -146.390, "eta_prime": -175.838, "theta_prime": -143.949, "eta_base": -136.392, "theta_base": -125.002, "v0": 1.646, "v1": -22.026, "v2": 32.910, "v3": -33.047, "v4": 19.771, "amplitude": 34.245, "phase_angle": 16.054, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.884, "filter_rmsd": 0.063, "frame": { "rmsd": 0.003, "origin": [ 16.298, 41.771, 39.488 ], "x_axis": [ 0.014, -0.846, -0.533 ], "y_axis": [ 0.109, 0.531, -0.841 ], "z_axis": [ 0.994, -0.046, 0.099 ], "quaternion": [ 0.641, -0.310, 0.595, -0.372 ] } }, { "index": 61, "index_chain": 61, "chain_name": "B", "nt_resnum": 963, "nt_name": "U", "nt_code": "U", "nt_id": "///B/963", "linked_nts": [ "///B/962", "///B/964" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.193, "beta": -178.500, "gamma": 45.741, "delta": 83.043, "epsilon": -154.149, "zeta": -83.722, "epsilon_zeta": -70.427, "bb_type": "BI", "chi": -159.438, "glyco_bond": "anti", "C5prime_xyz": [ -1.348, 8.687, 0.524 ], "P_xyz": [ 1.151, 9.078, 1.170 ], "form": "A", "ssZp": 4.380, "Dp": 4.564, "splay_angle": 20.975, "splay_distance": 3.290, "splay_ratio": 0.182, "d22": 4.502, "d64": 4.463, "eta": 168.364, "theta": -155.362, "eta_prime": 177.758, "theta_prime": -152.463, "eta_base": -152.665, "theta_base": -129.213, "v0": 2.478, "v1": -24.036, "v2": 35.171, "v3": -34.900, "v4": 20.481, "amplitude": 36.400, "phase_angle": 14.932, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.840, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 19.643, 40.930, 41.234 ], "x_axis": [ -0.102, -0.464, -0.880 ], "y_axis": [ 0.077, 0.878, -0.472 ], "z_axis": [ 0.992, -0.116, -0.054 ], "quaternion": [ 0.656, -0.136, 0.713, -0.206 ] } }, { "index": 62, "index_chain": 62, "chain_name": "B", "nt_resnum": 964, "nt_name": "C", "nt_code": "C", "nt_id": "///B/964", "linked_nts": [ "///B/963", "///B/965" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -48.256, "beta": 159.488, "gamma": 51.774, "delta": 84.511, "epsilon": -165.109, "zeta": -70.126, "epsilon_zeta": -94.982, "bb_type": "BI", "chi": -155.804, "glyco_bond": "anti", "C5prime_xyz": [ -1.312, 8.792, 0.270 ], "P_xyz": [ 1.299, 8.992, 0.228 ], "form": "A", "ssZp": 4.205, "Dp": 4.399, "splay_angle": 23.413, "splay_distance": 4.076, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 172.252, "theta": -118.841, "eta_prime": -172.452, "theta_prime": -132.725, "eta_base": -137.365, "theta_base": -112.276, "v0": 0.988, "v1": -22.096, "v2": 33.615, "v3": -34.154, "v4": 20.897, "amplitude": 35.183, "phase_angle": 17.171, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.661, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 22.573, 39.474, 41.570 ], "x_axis": [ 0.005, -0.010, -1.000 ], "y_axis": [ 0.228, 0.974, -0.009 ], "z_axis": [ 0.974, -0.228, 0.007 ], "quaternion": [ 0.704, 0.078, 0.700, -0.084 ] } }, { "index": 63, "index_chain": 63, "chain_name": "B", "nt_resnum": 965, "nt_name": "G", "nt_code": "G", "nt_id": "///B/965", "linked_nts": [ "///B/964", "///B/966" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": 150.696, "beta": -162.898, "gamma": 175.326, "delta": 84.028, "epsilon": -136.269, "zeta": -78.316, "epsilon_zeta": -57.952, "bb_type": "BI", "chi": 177.760, "glyco_bond": "anti", "C5prime_xyz": [ -1.498, 8.308, 1.850 ], "P_xyz": [ 0.123, 10.179, 1.017 ], "form": "A", "ssZp": 4.724, "Dp": 4.667, "splay_angle": 24.633, "splay_distance": 3.826, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 161.558, "theta": -164.804, "eta_prime": 178.787, "theta_prime": -158.793, "eta_base": -135.477, "theta_base": -122.531, "v0": 2.842, "v1": -24.054, "v2": 35.077, "v3": -34.505, "v4": 19.979, "amplitude": 36.205, "phase_angle": 14.335, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.929, "filter_rmsd": 0.003, "frame": { "rmsd": 0.003, "origin": [ 25.509, 37.176, 39.924 ], "x_axis": [ -0.035, 0.506, -0.862 ], "y_axis": [ 0.181, 0.852, 0.492 ], "z_axis": [ 0.983, -0.138, -0.121 ], "quaternion": [ 0.651, 0.242, 0.709, 0.125 ] } }, { "index": 64, "index_chain": 64, "chain_name": "B", "nt_resnum": 966, "nt_name": "U", "nt_code": "U", "nt_id": "///B/966", "linked_nts": [ "///B/965", "///B/967" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -56.468, "beta": 167.549, "gamma": 50.177, "delta": 82.921, "epsilon": -153.110, "zeta": -80.167, "epsilon_zeta": -72.943, "bb_type": "BI", "chi": -169.027, "glyco_bond": "anti", "C5prime_xyz": [ -1.486, 8.628, 1.053 ], "P_xyz": [ 1.066, 8.978, 1.506 ], "form": "A", "ssZp": 4.514, "Dp": 4.541, "splay_angle": 19.806, "splay_distance": 3.045, "splay_ratio": 0.173, "d22": null, "d64": null, "eta": 166.641, "theta": -152.179, "eta_prime": -175.973, "theta_prime": -150.329, "eta_base": -126.489, "theta_base": -127.731, "v0": 0.993, "v1": -23.280, "v2": 35.665, "v3": -36.115, "v4": 22.040, "amplitude": 37.325, "phase_angle": 17.154, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.846, "filter_rmsd": 0.105, "frame": { "rmsd": 0.002, "origin": [ 28.420, 36.070, 37.701 ], "x_axis": [ 0.078, 0.930, -0.359 ], "y_axis": [ 0.156, 0.344, 0.926 ], "z_axis": [ 0.985, -0.128, -0.118 ], "quaternion": [ 0.571, 0.462, 0.588, 0.339 ] } }, { "index": 65, "index_chain": 65, "chain_name": "B", "nt_resnum": 967, "nt_name": "A", "nt_code": "A", "nt_id": "///B/967", "linked_nts": [ "///B/966", "///B/968" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.820, "beta": 178.414, "gamma": 48.276, "delta": 84.918, "epsilon": -151.403, "zeta": -75.161, "epsilon_zeta": -76.242, "bb_type": "BI", "chi": -150.255, "glyco_bond": "anti", "C5prime_xyz": [ -1.075, 8.649, -0.059 ], "P_xyz": [ 1.531, 8.833, 0.141 ], "form": "A", "ssZp": 4.083, "Dp": 4.608, "splay_angle": 18.572, "splay_distance": 2.988, "splay_ratio": 0.162, "d22": null, "d64": null, "eta": 171.663, "theta": -145.016, "eta_prime": -179.197, "theta_prime": -144.491, "eta_base": -146.762, "theta_base": -124.597, "v0": 4.596, "v1": -25.861, "v2": 36.171, "v3": -34.559, "v4": 18.903, "amplitude": 36.936, "phase_angle": 11.676, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.875, "filter_rmsd": 0.038, "frame": { "rmsd": 0.004, "origin": [ 30.827, 35.373, 35.972 ], "x_axis": [ 0.167, 0.964, 0.205 ], "y_axis": [ 0.274, -0.245, 0.930 ], "z_axis": [ 0.947, -0.099, -0.305 ], "quaternion": [ 0.393, 0.655, 0.472, 0.440 ] } }, { "index": 66, "index_chain": 66, "chain_name": "B", "nt_resnum": 968, "nt_name": "C", "nt_code": "C", "nt_id": "///B/968", "linked_nts": [ "///B/967", "///B/969" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.659, "beta": 165.703, "gamma": 56.073, "delta": 84.140, "epsilon": -159.040, "zeta": -71.718, "epsilon_zeta": -87.322, "bb_type": "BI", "chi": -149.045, "glyco_bond": "anti", "C5prime_xyz": [ -1.433, 8.858, -0.160 ], "P_xyz": [ 1.139, 9.259, -0.506 ], "form": "A", "ssZp": 4.066, "Dp": 4.452, "splay_angle": 28.319, "splay_distance": 4.587, "splay_ratio": 0.245, "d22": 4.212, "d64": 4.434, "eta": 167.214, "theta": -147.584, "eta_prime": -176.328, "theta_prime": -149.717, "eta_base": -141.734, "theta_base": -129.481, "v0": 0.373, "v1": -22.857, "v2": 35.271, "v3": -36.079, "v4": 22.538, "amplitude": 37.098, "phase_angle": 18.055, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.916, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 33.291, 35.924, 34.374 ], "x_axis": [ 0.182, 0.757, 0.627 ], "y_axis": [ 0.367, -0.644, 0.671 ], "z_axis": [ 0.912, 0.108, -0.396 ], "quaternion": [ 0.189, 0.745, 0.377, 0.516 ] } }, { "index": 67, "index_chain": 67, "chain_name": "B", "nt_resnum": 969, "nt_name": "C", "nt_code": "C", "nt_id": "///B/969", "linked_nts": [ "///B/968", "///B/970" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.232, "beta": -179.159, "gamma": 51.771, "delta": 83.000, "epsilon": -153.460, "zeta": -75.359, "epsilon_zeta": -78.101, "bb_type": "BI", "chi": -164.034, "glyco_bond": "anti", "C5prime_xyz": [ -1.555, 8.782, 0.737 ], "P_xyz": [ 0.944, 9.336, 1.269 ], "form": "A", "ssZp": 4.478, "Dp": 4.549, "splay_angle": 24.939, "splay_distance": 3.910, "splay_ratio": 0.217, "d22": 4.410, "d64": 4.352, "eta": 167.410, "theta": -149.728, "eta_prime": 178.895, "theta_prime": -147.025, "eta_base": -146.923, "theta_base": -118.755, "v0": -0.871, "v1": -22.332, "v2": 35.652, "v3": -37.189, "v4": 23.901, "amplitude": 37.906, "phase_angle": 19.858, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.893, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 37.128, 37.582, 32.484 ], "x_axis": [ 0.005, 0.321, 0.947 ], "y_axis": [ 0.106, -0.942, 0.318 ], "z_axis": [ 0.994, 0.098, -0.038 ], "quaternion": [ 0.078, 0.704, 0.151, 0.689 ] } }, { "index": 68, "index_chain": 68, "chain_name": "B", "nt_resnum": 970, "nt_name": "C", "nt_code": "C", "nt_id": "///B/970", "linked_nts": [ "///B/969", "///B/971" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.258, "beta": -176.859, "gamma": 51.663, "delta": 84.200, "epsilon": -151.666, "zeta": -77.783, "epsilon_zeta": -73.883, "bb_type": "BI", "chi": -161.704, "glyco_bond": "anti", "C5prime_xyz": [ -1.299, 8.714, 0.668 ], "P_xyz": [ 1.250, 9.059, 1.094 ], "form": "A", "ssZp": 4.506, "Dp": 4.580, "splay_angle": 21.024, "splay_distance": 3.362, "splay_ratio": 0.184, "d22": 4.524, "d64": 4.360, "eta": 168.362, "theta": -149.296, "eta_prime": 178.472, "theta_prime": -147.082, "eta_base": -142.543, "theta_base": -129.333, "v0": 1.477, "v1": -23.942, "v2": 35.970, "v3": -36.187, "v4": 21.855, "amplitude": 37.499, "phase_angle": 16.420, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.917, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 40.540, 39.470, 32.774 ], "x_axis": [ -0.131, -0.296, 0.946 ], "y_axis": [ 0.092, -0.954, -0.285 ], "z_axis": [ 0.987, 0.050, 0.152 ], "quaternion": [ -0.130, 0.646, -0.079, 0.748 ] } }, { "index": 69, "index_chain": 69, "chain_name": "B", "nt_resnum": 971, "nt_name": "C", "nt_code": "C", "nt_id": "///B/971", "linked_nts": [ "///B/970", "///B/972" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -61.208, "beta": 177.287, "gamma": 50.061, "delta": 84.349, "epsilon": -132.919, "zeta": -88.954, "epsilon_zeta": -43.965, "bb_type": "BI", "chi": -151.839, "glyco_bond": "anti", "C5prime_xyz": [ -1.335, 8.815, -0.020 ], "P_xyz": [ 1.230, 9.283, 0.211 ], "form": ".", "ssZp": 3.947, "Dp": 4.599, "splay_angle": 55.926, "splay_distance": 8.853, "splay_ratio": 0.469, "d22": null, "d64": null, "eta": 176.128, "theta": -149.580, "eta_prime": -175.661, "theta_prime": -138.873, "eta_base": -150.702, "theta_base": -117.703, "v0": 1.176, "v1": -23.029, "v2": 34.756, "v3": -35.184, "v4": 21.513, "amplitude": 36.324, "phase_angle": 16.896, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.920, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 43.255, 41.030, 33.998 ], "x_axis": [ -0.230, -0.721, 0.653 ], "y_axis": [ 0.306, -0.691, -0.655 ], "z_axis": [ 0.924, 0.049, 0.380 ], "quaternion": [ -0.339, 0.520, -0.200, 0.758 ] } }, { "index": 70, "index_chain": 70, "chain_name": "B", "nt_resnum": 972, "nt_name": "A", "nt_code": "A", "nt_id": "///B/972", "linked_nts": [ "///B/971", "///B/973" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -63.119, "beta": -161.600, "gamma": 54.097, "delta": 86.209, "epsilon": -149.186, "zeta": 94.076, "epsilon_zeta": 116.738, "bb_type": "--", "chi": -154.295, "glyco_bond": "anti", "C5prime_xyz": [ -1.374, 8.722, 0.153 ], "P_xyz": [ 1.119, 9.254, 0.803 ], "form": ".", "ssZp": 4.169, "Dp": 4.535, "splay_angle": 109.068, "splay_distance": 14.269, "splay_ratio": 0.815, "d22": null, "d64": null, "eta": -168.601, "theta": 67.967, "eta_prime": -166.507, "theta_prime": 32.885, "eta_base": -151.801, "theta_base": -41.558, "v0": 2.207, "v1": -22.855, "v2": 33.529, "v3": -33.405, "v4": 19.679, "amplitude": 34.743, "phase_angle": 15.193, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.559, "filter_rmsd": 0.036, "frame": { "rmsd": 0.005, "origin": [ 51.308, 39.605, 37.389 ], "x_axis": [ -0.591, -0.791, 0.158 ], "y_axis": [ -0.136, -0.095, -0.986 ], "z_axis": [ 0.795, -0.605, -0.052 ], "quaternion": [ -0.256, 0.372, -0.622, 0.639 ] } }, { "index": 71, "index_chain": 71, "chain_name": "B", "nt_resnum": 973, "nt_name": "G", "nt_code": "G", "nt_id": "///B/973", "linked_nts": [ "///B/972", "///B/974" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 51.773, "beta": 93.845, "gamma": -178.432, "delta": 145.549, "epsilon": -107.358, "zeta": -130.019, "epsilon_zeta": 22.661, "bb_type": "--", "chi": 47.175, "glyco_bond": "syn", "C5prime_xyz": [ -5.545, 3.985, 0.760 ], "P_xyz": [ -6.709, 3.838, 3.113 ], "form": ".", "ssZp": -0.689, "Dp": 0.955, "splay_angle": 130.492, "splay_distance": 17.920, "splay_ratio": 0.908, "d22": null, "d64": null, "eta": 83.206, "theta": 171.100, "eta_prime": 86.206, "theta_prime": 152.254, "eta_base": 161.335, "theta_base": 118.926, "v0": -24.219, "v1": 36.901, "v2": -34.969, "v3": 22.041, "v4": 1.130, "amplitude": 37.330, "phase_angle": 159.514, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32t", "cluster": "5q", "suiteness": 0.474, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 52.398, 31.772, 25.513 ], "x_axis": [ 0.271, -0.879, -0.391 ], "y_axis": [ 0.811, 0.428, -0.400 ], "z_axis": [ 0.519, -0.209, 0.829 ], "quaternion": [ 0.795, -0.060, 0.286, -0.531 ] } }, { "index": 72, "index_chain": 72, "chain_name": "B", "nt_resnum": 974, "nt_name": "C", "nt_code": "C", "nt_id": "///B/974", "linked_nts": [ "///B/973", "///B/975" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 59.588, "beta": -143.414, "gamma": 65.316, "delta": 145.443, "epsilon": -144.277, "zeta": 54.296, "epsilon_zeta": 161.427, "bb_type": "--", "chi": -140.068, "glyco_bond": "anti", "C5prime_xyz": [ -2.036, 8.801, -0.230 ], "P_xyz": [ -0.257, 9.458, 1.581 ], "form": ".", "ssZp": 1.573, "Dp": 1.838, "splay_angle": 154.603, "splay_distance": 20.168, "splay_ratio": 0.976, "d22": 11.962, "d64": 15.070, "eta": -24.949, "theta": 82.296, "eta_prime": 15.267, "theta_prime": 27.808, "eta_base": 30.527, "theta_base": -10.609, "v0": -23.023, "v1": 35.775, "v2": -34.080, "v3": 21.867, "v4": 0.515, "amplitude": 36.187, "phase_angle": 160.353, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "4p", "suiteness": 0.653, "filter_rmsd": 0.063, "frame": { "rmsd": 0.004, "origin": [ 65.871, 42.438, 20.430 ], "x_axis": [ 0.103, 0.794, 0.599 ], "y_axis": [ -0.963, -0.072, 0.260 ], "z_axis": [ 0.250, -0.604, 0.757 ], "quaternion": [ 0.668, 0.323, -0.131, 0.657 ] } }, { "index": 73, "index_chain": 73, "chain_name": "B", "nt_resnum": 975, "nt_name": "C", "nt_code": "C", "nt_id": "///B/975", "linked_nts": [ "///B/974", "///B/976" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 80.808, "beta": 100.571, "gamma": -179.063, "delta": 81.809, "epsilon": -144.889, "zeta": -64.992, "epsilon_zeta": -79.897, "bb_type": "BI", "chi": -160.059, "glyco_bond": "anti", "C5prime_xyz": [ -1.408, 8.831, 0.553 ], "P_xyz": [ -2.430, 10.846, -0.790 ], "form": ".", "ssZp": 4.499, "Dp": 4.626, "splay_angle": 28.674, "splay_distance": 4.443, "splay_ratio": 0.248, "d22": null, "d64": null, "eta": 71.322, "theta": 159.284, "eta_prime": 82.858, "theta_prime": -175.346, "eta_base": 124.068, "theta_base": -112.473, "v0": 0.580, "v1": -23.955, "v2": 36.883, "v3": -37.513, "v4": 23.441, "amplitude": 38.735, "phase_angle": 17.788, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23t", "cluster": "6j", "suiteness": 0.444, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ 49.272, 31.222, 22.751 ], "x_axis": [ -0.462, 0.731, 0.502 ], "y_axis": [ 0.745, 0.627, -0.228 ], "z_axis": [ -0.481, 0.268, -0.834 ], "quaternion": [ -0.287, 0.432, 0.855, 0.012 ] } }, { "index": 74, "index_chain": 74, "chain_name": "B", "nt_resnum": 976, "nt_name": "A", "nt_code": "A", "nt_id": "///B/976", "linked_nts": [ "///B/975", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": -63.773, "beta": 168.926, "gamma": 54.015, "delta": 86.701, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -151.552, "glyco_bond": "anti", "C5prime_xyz": [ -1.142, 8.665, 0.053 ], "P_xyz": [ 1.470, 8.773, -0.246 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 3.580, "v1": -23.868, "v2": 33.893, "v3": -32.796, "v4": 18.516, "amplitude": 34.768, "phase_angle": 12.886, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.888, "filter_rmsd": 0.038, "frame": { "rmsd": 0.006, "origin": [ 47.189, 35.064, 21.950 ], "x_axis": [ 0.347, 0.925, 0.155 ], "y_axis": [ 0.679, -0.134, -0.722 ], "z_axis": [ -0.647, 0.355, -0.674 ], "quaternion": [ -0.367, 0.734, 0.546, -0.168 ] } }, { "index": 75, "index_chain": 1, "chain_name": "A", "nt_resnum": 998, "nt_name": "QSI", "nt_code": "a", "is_modified": true, "nt_id": "///A/998", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C2'-endo,non-pair-contact,ss-non-loop", "alpha": null, "beta": null, "gamma": 79.184, "delta": 137.736, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -112.836, "glyco_bond": "anti", "C5prime_xyz": [ -2.332, 8.418, -1.513 ], "P_xyz": [ null, null, null ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -25.289, "v1": 35.825, "v2": -32.170, "v3": 19.884, "v4": 3.525, "amplitude": 35.304, "phase_angle": 155.675, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.013, "origin": [ 38.687, 24.220, 20.070 ], "x_axis": [ 0.636, -0.425, 0.645 ], "y_axis": [ 0.765, 0.462, -0.449 ], "z_axis": [ -0.107, 0.778, 0.619 ], "quaternion": [ 0.824, -0.372, -0.228, -0.361 ] } } ], "num_hbonds": 712, "hbonds": [ { "index": 1, "atom1_serNum": 15, "atom2_serNum": 1461, "donAcc_type": "standard", "distance": 2.639, "atom1_id": "///B/902/O6", "atom2_id": "///B/971/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 16, "atom2_serNum": 1459, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///B/902/N1", "atom2_id": "///B/971/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 18, "atom2_serNum": 1458, "donAcc_type": "standard", "distance": 3.191, "atom1_id": "///B/902/N2", "atom2_id": "///B/971/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 18, "atom2_serNum": 2973, "donAcc_type": "standard", "distance": 3.386, "atom1_id": "///B/902/N2", "atom2_id": "///A/181/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 5, "atom1_serNum": 19, "atom2_serNum": 2624, "donAcc_type": "questionable", "distance": 2.824, "atom1_id": "///B/902/N3", "atom2_id": "///A/136/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 6, "atom1_serNum": 38, "atom2_serNum": 1441, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/903/O6", "atom2_id": "///B/970/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 39, "atom2_serNum": 1439, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///B/903/N1", "atom2_id": "///B/970/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 41, "atom2_serNum": 1438, "donAcc_type": "standard", "distance": 2.561, "atom1_id": "///B/903/N2", "atom2_id": "///B/970/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 41, "atom2_serNum": 3427, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///B/903/N2", "atom2_id": "///A/235/OD2", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 10, "atom1_serNum": 52, "atom2_serNum": 3457, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///B/904/O3'", "atom2_id": "///A/238/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 11, "atom1_serNum": 61, "atom2_serNum": 1421, "donAcc_type": "standard", "distance": 2.959, "atom1_id": "///B/904/O6", "atom2_id": "///B/969/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 62, "atom2_serNum": 1419, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///B/904/N1", "atom2_id": "///B/969/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 64, "atom2_serNum": 1418, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///B/904/N2", "atom2_id": "///B/969/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 68, "atom2_serNum": 3446, "donAcc_type": "standard", "distance": 3.816, "atom1_id": "///B/905/OP1", "atom2_id": "///A/237/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 15, "atom1_serNum": 68, "atom2_serNum": 3457, "donAcc_type": "standard", "distance": 3.550, "atom1_id": "///B/905/OP1", "atom2_id": "///A/238/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 16, "atom1_serNum": 77, "atom2_serNum": 3419, "donAcc_type": "acceptable", "distance": 3.241, "atom1_id": "///B/905/O2'", "atom2_id": "///A/234/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 17, "atom1_serNum": 84, "atom2_serNum": 1401, "donAcc_type": "standard", "distance": 2.950, "atom1_id": "///B/905/O6", "atom2_id": "///B/968/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 85, "atom2_serNum": 1399, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/905/N1", "atom2_id": "///B/968/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 87, "atom2_serNum": 1398, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///B/905/N2", "atom2_id": "///B/968/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 91, "atom2_serNum": 4116, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///B/906/OP1", "atom2_id": "///A/317/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 21, "atom1_serNum": 105, "atom2_serNum": 1380, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///B/906/N3", "atom2_id": "///B/967/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 107, "atom2_serNum": 1379, "donAcc_type": "standard", "distance": 3.230, "atom1_id": "///B/906/O4", "atom2_id": "///B/967/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 113, "atom2_serNum": 4125, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///B/907/O5'", "atom2_id": "///A/318/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 24, "atom1_serNum": 120, "atom2_serNum": 983, "donAcc_type": "acceptable", "distance": 2.746, "atom1_id": "///B/907/O2'", "atom2_id": "///B/949/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 127, "atom2_serNum": 1359, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///B/907/N6", "atom2_id": "///B/966/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 128, "atom2_serNum": 1357, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///B/907/N1", "atom2_id": "///B/966/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 134, "atom2_serNum": 4125, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///B/908/OP2", "atom2_id": "///A/318/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 28, "atom1_serNum": 142, "atom2_serNum": 406, "donAcc_type": "acceptable", "distance": 2.586, "atom1_id": "///B/908/O2'", "atom2_id": "///B/921/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 146, "atom2_serNum": 274, "donAcc_type": "standard", "distance": 2.749, "atom1_id": "///B/908/O2", "atom2_id": "///B/914/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 147, "atom2_serNum": 271, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///B/908/N3", "atom2_id": "///B/914/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 154, "atom2_serNum": 252, "donAcc_type": "standard", "distance": 3.595, "atom1_id": "///B/909/OP2", "atom2_id": "///B/913/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 158, "atom2_serNum": 919, "donAcc_type": "questionable", "distance": 3.006, "atom1_id": "///B/909/O4'", "atom2_id": "///B/945/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 162, "atom2_serNum": 212, "donAcc_type": "acceptable", "distance": 3.442, "atom1_id": "///B/909/O2'", "atom2_id": "///B/911/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 169, "atom2_serNum": 449, "donAcc_type": "standard", "distance": 3.263, "atom1_id": "///B/909/N4", "atom2_id": "///B/923/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 189, "atom2_serNum": 495, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///B/910/O6", "atom2_id": "///B/925/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 190, "atom2_serNum": 493, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///B/910/N1", "atom2_id": "///B/925/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 192, "atom2_serNum": 492, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///B/910/N2", "atom2_id": "///B/925/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 192, "atom2_serNum": 4164, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///B/910/N2", "atom2_id": "///A/323/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 39, "atom1_serNum": 205, "atom2_serNum": 4145, "donAcc_type": "acceptable", "distance": 2.802, "atom1_id": "///B/911/O2'", "atom2_id": "///A/321/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 40, "atom1_serNum": 209, "atom2_serNum": 475, "donAcc_type": "standard", "distance": 2.562, "atom1_id": "///B/911/O2", "atom2_id": "///B/924/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 210, "atom2_serNum": 473, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///B/911/N3", "atom2_id": "///B/924/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 212, "atom2_serNum": 472, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///B/911/N4", "atom2_id": "///B/924/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 216, "atom2_serNum": 4142, "donAcc_type": "standard", "distance": 2.811, "atom1_id": "///B/912/OP1", "atom2_id": "///A/321/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 44, "atom1_serNum": 225, "atom2_serNum": 4085, "donAcc_type": "acceptable", "distance": 2.829, "atom1_id": "///B/912/O2'", "atom2_id": "///A/313/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 45, "atom1_serNum": 229, "atom2_serNum": 452, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///B/912/O2", "atom2_id": "///B/923/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 230, "atom2_serNum": 450, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///B/912/N3", "atom2_id": "///B/923/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 232, "atom2_serNum": 449, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///B/912/N4", "atom2_id": "///B/923/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 236, "atom2_serNum": 4106, "donAcc_type": "acceptable", "distance": 2.649, "atom1_id": "///B/913/OP1", "atom2_id": "///A/316/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 49, "atom1_serNum": 245, "atom2_serNum": 260, "donAcc_type": "acceptable", "distance": 2.712, "atom1_id": "///B/913/O2'", "atom2_id": "///B/914/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 245, "atom2_serNum": 427, "donAcc_type": "acceptable", "distance": 2.909, "atom1_id": "///B/913/O2'", "atom2_id": "///B/922/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 252, "atom2_serNum": 917, "donAcc_type": "standard", "distance": 3.847, "atom1_id": "///B/913/N6", "atom2_id": "///B/945/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 255, "atom2_serNum": 427, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///B/913/N3", "atom2_id": "///B/922/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 274, "atom2_serNum": 408, "donAcc_type": "standard", "distance": 3.313, "atom1_id": "///B/914/N6", "atom2_id": "///B/921/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 275, "atom2_serNum": 398, "donAcc_type": "acceptable", "distance": 2.769, "atom1_id": "///B/914/N1", "atom2_id": "///B/921/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 281, "atom2_serNum": 319, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///B/915/OP2", "atom2_id": "///B/916/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 287, "atom2_serNum": 1214, "donAcc_type": "standard", "distance": 3.543, "atom1_id": "///B/915/O3'", "atom2_id": "///B/959/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 289, "atom2_serNum": 305, "donAcc_type": "acceptable", "distance": 2.964, "atom1_id": "///B/915/O2'", "atom2_id": "///B/916/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 289, "atom2_serNum": 316, "donAcc_type": "acceptable", "distance": 2.694, "atom1_id": "///B/915/O2'", "atom2_id": "///B/916/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 289, "atom2_serNum": 1215, "donAcc_type": "acceptable", "distance": 2.541, "atom1_id": "///B/915/O2'", "atom2_id": "///B/959/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 297, "atom2_serNum": 975, "donAcc_type": "standard", "distance": 3.018, "atom1_id": "///B/915/N1", "atom2_id": "///B/948/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 299, "atom2_serNum": 976, "donAcc_type": "standard", "distance": 2.743, "atom1_id": "///B/915/N2", "atom2_id": "///B/948/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 303, "atom2_serNum": 1214, "donAcc_type": "standard", "distance": 3.375, "atom1_id": "///B/916/OP1", "atom2_id": "///B/959/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 312, "atom2_serNum": 323, "donAcc_type": "acceptable", "distance": 2.950, "atom1_id": "///B/916/O2'", "atom2_id": "///B/918/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 312, "atom2_serNum": 324, "donAcc_type": "acceptable", "distance": 2.561, "atom1_id": "///B/916/O2'", "atom2_id": "///B/918/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 319, "atom2_serNum": 1624, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///B/916/N4", "atom2_id": "///A/13/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 66, "atom1_serNum": 332, "atom2_serNum": 1172, "donAcc_type": "acceptable", "distance": 2.625, "atom1_id": "///B/918/O2'", "atom2_id": "///B/957/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 340, "atom2_serNum": 1126, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///B/918/N1", "atom2_id": "///B/955/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 342, "atom2_serNum": 1126, "donAcc_type": "standard", "distance": 2.958, "atom1_id": "///B/918/N2", "atom2_id": "///B/955/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 342, "atom2_serNum": 1178, "donAcc_type": "standard", "distance": 3.253, "atom1_id": "///B/918/N2", "atom2_id": "///B/958/O5'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 351, "atom2_serNum": 1172, "donAcc_type": "standard", "distance": 3.144, "atom1_id": "///B/919/O4'", "atom2_id": "///B/957/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 362, "atom2_serNum": 1149, "donAcc_type": "standard", "distance": 2.915, "atom1_id": "///B/919/O6", "atom2_id": "///B/956/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 363, "atom2_serNum": 1147, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///B/919/N1", "atom2_id": "///B/956/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 365, "atom2_serNum": 385, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///B/919/N2", "atom2_id": "///B/920/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 365, "atom2_serNum": 1146, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///B/919/N2", "atom2_id": "///B/956/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 378, "atom2_serNum": 382, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///B/920/O2'", "atom2_id": "///B/920/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 390, "atom2_serNum": 958, "donAcc_type": "questionable", "distance": 3.334, "atom1_id": "///B/921/OP2", "atom2_id": "///B/947/O4", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 442, "atom2_serNum": 461, "donAcc_type": "acceptable", "distance": 3.289, "atom1_id": "///B/923/O2'", "atom2_id": "///B/924/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 515, "atom2_serNum": 894, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///B/926/N6", "atom2_id": "///B/944/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 516, "atom2_serNum": 893, "donAcc_type": "questionable", "distance": 3.273, "atom1_id": "///B/926/N1", "atom2_id": "///B/944/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 522, "atom2_serNum": 5835, "donAcc_type": "standard", "distance": 3.518, "atom1_id": "///B/927/OP2", "atom2_id": "///A/545/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 81, "atom1_serNum": 534, "atom2_serNum": 876, "donAcc_type": "standard", "distance": 2.687, "atom1_id": "///B/927/O2", "atom2_id": "///B/943/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 535, "atom2_serNum": 874, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///B/927/N3", "atom2_id": "///B/943/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 83, "atom1_serNum": 537, "atom2_serNum": 873, "donAcc_type": "standard", "distance": 3.020, "atom1_id": "///B/927/N4", "atom2_id": "///B/943/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 554, "atom2_serNum": 853, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///B/928/O2", "atom2_id": "///B/942/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 555, "atom2_serNum": 851, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///B/928/N3", "atom2_id": "///B/942/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 555, "atom2_serNum": 853, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///B/928/N3", "atom2_id": "///B/942/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 87, "atom1_serNum": 577, "atom2_serNum": 830, "donAcc_type": "standard", "distance": 2.735, "atom1_id": "///B/929/O6", "atom2_id": "///B/941/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 578, "atom2_serNum": 828, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///B/929/N1", "atom2_id": "///B/941/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 580, "atom2_serNum": 827, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/929/N2", "atom2_id": "///B/941/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 601, "atom2_serNum": 807, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/930/N1", "atom2_id": "///B/940/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 603, "atom2_serNum": 807, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///B/930/N2", "atom2_id": "///B/940/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 623, "atom2_serNum": 790, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///B/931/N6", "atom2_id": "///B/939/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 93, "atom1_serNum": 624, "atom2_serNum": 788, "donAcc_type": "standard", "distance": 3.341, "atom1_id": "///B/931/N1", "atom2_id": "///B/939/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 643, "atom2_serNum": 770, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/932/N3", "atom2_id": "///B/938/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 658, "atom2_serNum": 689, "donAcc_type": "acceptable", "distance": 3.041, "atom1_id": "///B/933/O2'", "atom2_id": "///B/935/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 96, "atom1_serNum": 658, "atom2_serNum": 690, "donAcc_type": "acceptable", "distance": 2.456, "atom1_id": "///B/933/O2'", "atom2_id": "///B/935/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 97, "atom1_serNum": 662, "atom2_serNum": 748, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///B/933/O2", "atom2_id": "///B/937/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 98, "atom1_serNum": 678, "atom2_serNum": 4879, "donAcc_type": "acceptable", "distance": 2.684, "atom1_id": "///B/934/O2'", "atom2_id": "///A/412/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 99, "atom1_serNum": 682, "atom2_serNum": 4879, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///B/934/O2", "atom2_id": "///A/412/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 100, "atom1_serNum": 682, "atom2_serNum": 4881, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///B/934/O2", "atom2_id": "///A/413/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 101, "atom1_serNum": 683, "atom2_serNum": 4881, "donAcc_type": "standard", "distance": 3.329, "atom1_id": "///B/934/N3", "atom2_id": "///A/413/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 102, "atom1_serNum": 685, "atom2_serNum": 4861, "donAcc_type": "questionable", "distance": 3.002, "atom1_id": "///B/934/N4", "atom2_id": "///A/410/NH2", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 103, "atom1_serNum": 685, "atom2_serNum": 4892, "donAcc_type": "standard", "distance": 3.658, "atom1_id": "///B/934/N4", "atom2_id": "///A/414/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 104, "atom1_serNum": 685, "atom2_serNum": 5111, "donAcc_type": "standard", "distance": 3.893, "atom1_id": "///B/934/N4", "atom2_id": "///A/442/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 105, "atom1_serNum": 690, "atom2_serNum": 4880, "donAcc_type": "standard", "distance": 3.442, "atom1_id": "///B/935/OP2", "atom2_id": "///A/412/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 106, "atom1_serNum": 698, "atom2_serNum": 737, "donAcc_type": "acceptable", "distance": 3.275, "atom1_id": "///B/935/O2'", "atom2_id": "///B/937/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 107, "atom1_serNum": 702, "atom2_serNum": 5623, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///B/935/O2", "atom2_id": "///A/520/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 108, "atom1_serNum": 703, "atom2_serNum": 5601, "donAcc_type": "standard", "distance": 3.177, "atom1_id": "///B/935/N3", "atom2_id": "///A/517/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 109, "atom1_serNum": 705, "atom2_serNum": 4304, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///B/935/O4", "atom2_id": "///A/341/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 110, "atom1_serNum": 709, "atom2_serNum": 4787, "donAcc_type": "standard", "distance": 3.354, "atom1_id": "///B/936/OP1", "atom2_id": "///A/401/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 111, "atom1_serNum": 709, "atom2_serNum": 5632, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///B/936/OP1", "atom2_id": "///A/520/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 112, "atom1_serNum": 710, "atom2_serNum": 4787, "donAcc_type": "standard", "distance": 2.470, "atom1_id": "///B/936/OP2", "atom2_id": "///A/401/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 113, "atom1_serNum": 718, "atom2_serNum": 5842, "donAcc_type": "acceptable", "distance": 3.495, "atom1_id": "///B/936/O2'", "atom2_id": "///A/546/OD1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 114, "atom1_serNum": 726, "atom2_serNum": 4761, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///B/936/N1", "atom2_id": "///A/399/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 115, "atom1_serNum": 728, "atom2_serNum": 4761, "donAcc_type": "standard", "distance": 2.858, "atom1_id": "///B/936/N2", "atom2_id": "///A/399/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 116, "atom1_serNum": 763, "atom2_serNum": 4265, "donAcc_type": "acceptable", "distance": 3.749, "atom1_id": "///B/938/O2'", "atom2_id": "///A/336/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 117, "atom1_serNum": 767, "atom2_serNum": 4526, "donAcc_type": "standard", "distance": 2.869, "atom1_id": "///B/938/O2", "atom2_id": "///A/370/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 118, "atom1_serNum": 909, "atom2_serNum": 922, "donAcc_type": "acceptable", "distance": 2.541, "atom1_id": "///B/945/O2'", "atom2_id": "///B/946/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 119, "atom1_serNum": 951, "atom2_serNum": 955, "donAcc_type": "acceptable", "distance": 2.404, "atom1_id": "///B/947/O2'", "atom2_id": "///B/947/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 120, "atom1_serNum": 951, "atom2_serNum": 963, "donAcc_type": "acceptable", "distance": 2.531, "atom1_id": "///B/947/O2'", "atom2_id": "///B/948/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 121, "atom1_serNum": 964, "atom2_serNum": 1003, "donAcc_type": "questionable", "distance": 3.335, "atom1_id": "///B/948/O5'", "atom2_id": "///B/950/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 122, "atom1_serNum": 971, "atom2_serNum": 975, "donAcc_type": "acceptable", "distance": 3.054, "atom1_id": "///B/948/O2'", "atom2_id": "///B/948/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 123, "atom1_serNum": 971, "atom2_serNum": 982, "donAcc_type": "acceptable", "distance": 2.934, "atom1_id": "///B/948/O2'", "atom2_id": "///B/949/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 124, "atom1_serNum": 971, "atom2_serNum": 1207, "donAcc_type": "acceptable", "distance": 3.172, "atom1_id": "///B/948/O2'", "atom2_id": "///B/959/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 125, "atom1_serNum": 995, "atom2_serNum": 1339, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///B/949/O2", "atom2_id": "///B/965/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 126, "atom1_serNum": 996, "atom2_serNum": 1337, "donAcc_type": "standard", "distance": 2.731, "atom1_id": "///B/949/N3", "atom2_id": "///B/965/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 127, "atom1_serNum": 998, "atom2_serNum": 1336, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///B/949/N4", "atom2_id": "///B/965/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 128, "atom1_serNum": 1011, "atom2_serNum": 1030, "donAcc_type": "acceptable", "distance": 3.178, "atom1_id": "///B/950/O2'", "atom2_id": "///B/951/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 129, "atom1_serNum": 1018, "atom2_serNum": 1316, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/950/O6", "atom2_id": "///B/964/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 130, "atom1_serNum": 1019, "atom2_serNum": 1314, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///B/950/N1", "atom2_id": "///B/964/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 131, "atom1_serNum": 1021, "atom2_serNum": 1313, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///B/950/N2", "atom2_id": "///B/964/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 132, "atom1_serNum": 1041, "atom2_serNum": 1296, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///B/951/N6", "atom2_id": "///B/963/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 133, "atom1_serNum": 1042, "atom2_serNum": 1294, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///B/951/N1", "atom2_id": "///B/963/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 134, "atom1_serNum": 1063, "atom2_serNum": 1276, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///B/952/O6", "atom2_id": "///B/962/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 135, "atom1_serNum": 1064, "atom2_serNum": 1273, "donAcc_type": "standard", "distance": 3.103, "atom1_id": "///B/952/N1", "atom2_id": "///B/962/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 136, "atom1_serNum": 1064, "atom2_serNum": 1274, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///B/952/N1", "atom2_id": "///B/962/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 137, "atom1_serNum": 1066, "atom2_serNum": 1273, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///B/952/N2", "atom2_id": "///B/962/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 138, "atom1_serNum": 1086, "atom2_serNum": 1256, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///B/953/O6", "atom2_id": "///B/961/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 139, "atom1_serNum": 1087, "atom2_serNum": 1254, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///B/953/N1", "atom2_id": "///B/961/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 140, "atom1_serNum": 1089, "atom2_serNum": 1253, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///B/953/N2", "atom2_id": "///B/961/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 141, "atom1_serNum": 1106, "atom2_serNum": 1192, "donAcc_type": "standard", "distance": 3.171, "atom1_id": "///B/954/O2", "atom2_id": "///B/958/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 142, "atom1_serNum": 1107, "atom2_serNum": 1189, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///B/954/N3", "atom2_id": "///B/958/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 143, "atom1_serNum": 1122, "atom2_serNum": 1166, "donAcc_type": "acceptable", "distance": 2.659, "atom1_id": "///B/955/O2'", "atom2_id": "///B/957/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 144, "atom1_serNum": 1127, "atom2_serNum": 1177, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///B/955/N3", "atom2_id": "///B/958/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 145, "atom1_serNum": 1185, "atom2_serNum": 1221, "donAcc_type": "acceptable", "distance": 2.630, "atom1_id": "///B/958/O2'", "atom2_id": "///B/960/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 146, "atom1_serNum": 1220, "atom2_serNum": 1256, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///B/960/OP1", "atom2_id": "///B/961/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 147, "atom1_serNum": 1289, "atom2_serNum": 1305, "donAcc_type": "acceptable", "distance": 2.656, "atom1_id": "///B/963/O2'", "atom2_id": "///B/964/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 148, "atom1_serNum": 1394, "atom2_serNum": 1410, "donAcc_type": "acceptable", "distance": 3.258, "atom1_id": "///B/968/O2'", "atom2_id": "///B/969/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 149, "atom1_serNum": 1465, "atom2_serNum": 1506, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///B/972/OP1", "atom2_id": "///B/973/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 150, "atom1_serNum": 1472, "atom2_serNum": 2606, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///B/972/O3'", "atom2_id": "///A/133/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 151, "atom1_serNum": 1474, "atom2_serNum": 2606, "donAcc_type": "acceptable", "distance": 2.964, "atom1_id": "///B/972/O2'", "atom2_id": "///A/133/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 152, "atom1_serNum": 1474, "atom2_serNum": 2613, "donAcc_type": "acceptable", "distance": 3.869, "atom1_id": "///B/972/O2'", "atom2_id": "///A/134/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 153, "atom1_serNum": 1488, "atom2_serNum": 2609, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///B/973/OP2", "atom2_id": "///A/133/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 154, "atom1_serNum": 1496, "atom2_serNum": 1532, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///B/973/O2'", "atom2_id": "///B/975/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 155, "atom1_serNum": 1510, "atom2_serNum": 2609, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///B/974/OP1", "atom2_id": "///A/133/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 156, "atom1_serNum": 1511, "atom2_serNum": 2608, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///B/974/OP2", "atom2_id": "///A/133/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 157, "atom1_serNum": 1519, "atom2_serNum": 1530, "donAcc_type": "acceptable", "distance": 2.755, "atom1_id": "///B/974/O2'", "atom2_id": "///B/975/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 158, "atom1_serNum": 1526, "atom2_serNum": 2522, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///B/974/N4", "atom2_id": "///A/124/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 159, "atom1_serNum": 1526, "atom2_serNum": 2881, "donAcc_type": "standard", "distance": 2.920, "atom1_id": "///B/974/N4", "atom2_id": "///A/168/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 160, "atom1_serNum": 1531, "atom2_serNum": 3071, "donAcc_type": "standard", "distance": 2.818, "atom1_id": "///B/975/OP2", "atom2_id": "///A/192/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 161, "atom1_serNum": 1531, "atom2_serNum": 3074, "donAcc_type": "standard", "distance": 3.274, "atom1_id": "///B/975/OP2", "atom2_id": "///A/192/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 162, "atom1_serNum": 1531, "atom2_serNum": 3091, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///B/975/OP2", "atom2_id": "///A/194/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 163, "atom1_serNum": 1537, "atom2_serNum": 2066, "donAcc_type": "standard", "distance": 3.213, "atom1_id": "///B/975/O3'", "atom2_id": "///A/69/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 164, "atom1_serNum": 1537, "atom2_serNum": 3074, "donAcc_type": "standard", "distance": 2.782, "atom1_id": "///B/975/O3'", "atom2_id": "///A/192/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 165, "atom1_serNum": 1539, "atom2_serNum": 2066, "donAcc_type": "acceptable", "distance": 2.614, "atom1_id": "///B/975/O2'", "atom2_id": "///A/69/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 166, "atom1_serNum": 1550, "atom2_serNum": 2057, "donAcc_type": "acceptable", "distance": 2.730, "atom1_id": "///B/976/OP1", "atom2_id": "///A/68/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 167, "atom1_serNum": 1550, "atom2_serNum": 3074, "donAcc_type": "standard", "distance": 2.738, "atom1_id": "///B/976/OP1", "atom2_id": "///A/192/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 168, "atom1_serNum": 1551, "atom2_serNum": 3229, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///B/976/OP2", "atom2_id": "///A/211/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 169, "atom1_serNum": 1557, "atom2_serNum": 5872, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///B/976/O3'", "atom2_id": "///A/998/N", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 170, "atom1_serNum": 1559, "atom2_serNum": 5881, "donAcc_type": "acceptable", "distance": 3.113, "atom1_id": "///B/976/O2'", "atom2_id": "///A/998/N10", "atom_pair": "O:N", "residue_pair": "nt:ligand" }, { "index": 171, "atom1_serNum": 1566, "atom2_serNum": 3434, "donAcc_type": "standard", "distance": 3.686, "atom1_id": "///B/976/N6", "atom2_id": "///A/236/OD1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 172, "atom1_serNum": 1582, "atom2_serNum": 1617, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/9/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1585, "atom2_serNum": 1598, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///A/9/OD1", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1585, "atom2_serNum": 1606, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/9/OD1", "atom2_id": "///A/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1590, "atom2_serNum": 1626, "donAcc_type": "standard", "distance": 3.197, "atom1_id": "///A/10/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1601, "atom2_serNum": 1634, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1609, "atom2_serNum": 1642, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/12/O", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1616, "atom2_serNum": 1957, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/12/NH2", "atom2_id": "///A/56/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1620, "atom2_serNum": 1650, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/13/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1629, "atom2_serNum": 1659, "donAcc_type": "standard", "distance": 2.878, "atom1_id": "///A/14/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1637, "atom2_serNum": 1667, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/15/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1645, "atom2_serNum": 1675, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/16/O", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1648, "atom2_serNum": 1969, "donAcc_type": "acceptable", "distance": 2.817, "atom1_id": "///A/16/OD1", "atom2_id": "///A/57/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1653, "atom2_serNum": 1680, "donAcc_type": "standard", "distance": 2.844, "atom1_id": "///A/17/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1653, "atom2_serNum": 1685, "donAcc_type": "acceptable", "distance": 3.032, "atom1_id": "///A/17/O", "atom2_id": "///A/21/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1662, "atom2_serNum": 1685, "donAcc_type": "acceptable", "distance": 3.151, "atom1_id": "///A/18/O", "atom2_id": "///A/21/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1662, "atom2_serNum": 1686, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/18/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1662, "atom2_serNum": 1690, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/18/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1726, "atom2_serNum": 1983, "donAcc_type": "standard", "distance": 3.202, "atom1_id": "///A/27/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1730, "atom2_serNum": 3344, "donAcc_type": "acceptable", "distance": 2.895, "atom1_id": "///A/28/N", "atom2_id": "///A/225/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1733, "atom2_serNum": 3339, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/28/O", "atom2_id": "///A/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1733, "atom2_serNum": 3344, "donAcc_type": "acceptable", "distance": 3.140, "atom1_id": "///A/28/O", "atom2_id": "///A/225/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1736, "atom2_serNum": 1743, "donAcc_type": "acceptable", "distance": 3.440, "atom1_id": "///A/28/ND1", "atom2_id": "///A/29/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1740, "atom2_serNum": 1986, "donAcc_type": "standard", "distance": 2.909, "atom1_id": "///A/29/N", "atom2_id": "///A/60/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1743, "atom2_serNum": 1998, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/29/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1745, "atom2_serNum": 1908, "donAcc_type": "acceptable", "distance": 2.835, "atom1_id": "///A/29/OG1", "atom2_id": "///A/50/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1756, "atom2_serNum": 3276, "donAcc_type": "questionable", "distance": 2.503, "atom1_id": "///A/30/NH1", "atom2_id": "///A/215/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1756, "atom2_serNum": 3304, "donAcc_type": "standard", "distance": 3.893, "atom1_id": "///A/30/NH1", "atom2_id": "///A/219/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1757, "atom2_serNum": 3365, "donAcc_type": "standard", "distance": 2.538, "atom1_id": "///A/30/NH2", "atom2_id": "///A/228/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1757, "atom2_serNum": 5877, "donAcc_type": "standard", "distance": 3.929, "atom1_id": "///A/30/NH2", "atom2_id": "///A/998/OE1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 201, "atom1_serNum": 1758, "atom2_serNum": 2001, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/31/N", "atom2_id": "///A/62/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1761, "atom2_serNum": 2014, "donAcc_type": "standard", "distance": 3.056, "atom1_id": "///A/31/O", "atom2_id": "///A/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1772, "atom2_serNum": 5872, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///A/32/O", "atom2_id": "///A/998/N", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 204, "atom1_serNum": 1779, "atom2_serNum": 2036, "donAcc_type": "standard", "distance": 2.917, "atom1_id": "///A/33/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1783, "atom2_serNum": 5884, "donAcc_type": "acceptable", "distance": 2.973, "atom1_id": "///A/34/N", "atom2_id": "///A/998/O2S", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 206, "atom1_serNum": 1786, "atom2_serNum": 1799, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/34/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 207, "atom1_serNum": 1791, "atom2_serNum": 2098, "donAcc_type": "questionable", "distance": 2.979, "atom1_id": "///A/34/OE2", "atom2_id": "///A/73/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1795, "atom2_serNum": 2099, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/35/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1799, "atom2_serNum": 1805, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/36/N", "atom2_id": "///A/36/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1805, "atom2_serNum": 3735, "donAcc_type": "standard", "distance": 2.910, "atom1_id": "///A/36/OD1", "atom2_id": "///A/270/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1822, "atom2_serNum": 2123, "donAcc_type": "acceptable", "distance": 2.989, "atom1_id": "///A/38/OH", "atom2_id": "///A/76/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1826, "atom2_serNum": 3919, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/39/O", "atom2_id": "///A/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1831, "atom2_serNum": 1859, "donAcc_type": "acceptable", "distance": 3.078, "atom1_id": "///A/40/N", "atom2_id": "///A/43/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1834, "atom2_serNum": 1853, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/40/O", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1834, "atom2_serNum": 1863, "donAcc_type": "standard", "distance": 3.227, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1837, "atom2_serNum": 1849, "donAcc_type": "acceptable", "distance": 2.978, "atom1_id": "///A/40/ND1", "atom2_id": "///A/42/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1837, "atom2_serNum": 1853, "donAcc_type": "acceptable", "distance": 3.230, "atom1_id": "///A/40/ND1", "atom2_id": "///A/43/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1840, "atom2_serNum": 5859, "donAcc_type": "acceptable", "distance": 3.564, "atom1_id": "///A/40/NE2", "atom2_id": "///A/1394/O2", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 219, "atom1_serNum": 1841, "atom2_serNum": 3908, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/41/N", "atom2_id": "///A/291/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1844, "atom2_serNum": 1868, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///A/41/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1852, "atom2_serNum": 1868, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/42/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1852, "atom2_serNum": 1877, "donAcc_type": "standard", "distance": 3.450, "atom1_id": "///A/42/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 223, "atom1_serNum": 1856, "atom2_serNum": 1883, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/43/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1862, "atom2_serNum": 5861, "donAcc_type": "acceptable", "distance": 2.907, "atom1_id": "///A/43/NE2", "atom2_id": "///A/1394/O4", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 225, "atom1_serNum": 1862, "atom2_serNum": 5885, "donAcc_type": "standard", "distance": 3.417, "atom1_id": "///A/43/NE2", "atom2_id": "///A/998/O5'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 226, "atom1_serNum": 1866, "atom2_serNum": 1891, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/44/O", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1871, "atom2_serNum": 1897, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/45/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1876, "atom2_serNum": 3640, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///A/45/NZ", "atom2_id": "///A/259/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 229, "atom1_serNum": 1876, "atom2_serNum": 4093, "donAcc_type": "standard", "distance": 3.504, "atom1_id": "///A/45/NZ", "atom2_id": "///A/314/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1880, "atom2_serNum": 1905, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/46/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1880, "atom2_serNum": 1912, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/46/O", "atom2_id": "///A/50/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1886, "atom2_serNum": 1913, "donAcc_type": "standard", "distance": 2.982, "atom1_id": "///A/47/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1894, "atom2_serNum": 1924, "donAcc_type": "standard", "distance": 2.990, "atom1_id": "///A/48/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1900, "atom2_serNum": 1928, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/49/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1908, "atom2_serNum": 1936, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/50/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1912, "atom2_serNum": 3365, "donAcc_type": "standard", "distance": 3.955, "atom1_id": "///A/50/ND2", "atom2_id": "///A/228/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1916, "atom2_serNum": 1941, "donAcc_type": "standard", "distance": 3.110, "atom1_id": "///A/51/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1927, "atom2_serNum": 1950, "donAcc_type": "standard", "distance": 3.179, "atom1_id": "///A/52/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1931, "atom2_serNum": 1958, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/53/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1939, "atom2_serNum": 1970, "donAcc_type": "standard", "distance": 3.037, "atom1_id": "///A/54/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1939, "atom2_serNum": 1979, "donAcc_type": "standard", "distance": 2.615, "atom1_id": "///A/54/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1990, "atom2_serNum": 2273, "donAcc_type": "acceptable", "distance": 3.029, "atom1_id": "///A/60/OE1", "atom2_id": "///A/93/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1995, "atom2_serNum": 2268, "donAcc_type": "standard", "distance": 2.935, "atom1_id": "///A/61/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 2005, "atom2_serNum": 3325, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/62/ND2", "atom2_id": "///A/222/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 2009, "atom2_serNum": 2293, "donAcc_type": "standard", "distance": 2.981, "atom1_id": "///A/63/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2023, "atom2_serNum": 3303, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/64/NH1", "atom2_id": "///A/219/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2023, "atom2_serNum": 3325, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///A/64/NH1", "atom2_id": "///A/222/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2024, "atom2_serNum": 3303, "donAcc_type": "standard", "distance": 2.607, "atom1_id": "///A/64/NH2", "atom2_id": "///A/219/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2025, "atom2_serNum": 2296, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/65/N", "atom2_id": "///A/97/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2028, "atom2_serNum": 2044, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/65/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2028, "atom2_serNum": 2316, "donAcc_type": "standard", "distance": 2.923, "atom1_id": "///A/65/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2039, "atom2_serNum": 2052, "donAcc_type": "standard", "distance": 3.299, "atom1_id": "///A/66/O", "atom2_id": "///A/68/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2042, "atom2_serNum": 2321, "donAcc_type": "acceptable", "distance": 2.854, "atom1_id": "///A/66/OD1", "atom2_id": "///A/99/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2043, "atom2_serNum": 3273, "donAcc_type": "acceptable", "distance": 2.674, "atom1_id": "///A/66/OD2", "atom2_id": "///A/215/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2043, "atom2_serNum": 5872, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/66/OD2", "atom2_id": "///A/998/N", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 256, "atom1_serNum": 2044, "atom2_serNum": 2050, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///A/67/N", "atom2_id": "///A/67/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2047, "atom2_serNum": 3126, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/67/O", "atom2_id": "///A/198/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2050, "atom2_serNum": 2316, "donAcc_type": "standard", "distance": 3.082, "atom1_id": "///A/67/OD1", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2050, "atom2_serNum": 2322, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/67/OD1", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2050, "atom2_serNum": 2327, "donAcc_type": "acceptable", "distance": 2.789, "atom1_id": "///A/67/OD1", "atom2_id": "///A/100/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2051, "atom2_serNum": 2327, "donAcc_type": "acceptable", "distance": 2.473, "atom1_id": "///A/67/OD2", "atom2_id": "///A/100/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2059, "atom2_serNum": 2098, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///A/69/N", "atom2_id": "///A/73/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2062, "atom2_serNum": 2081, "donAcc_type": "standard", "distance": 3.163, "atom1_id": "///A/69/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2062, "atom2_serNum": 2090, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///A/69/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2065, "atom2_serNum": 3091, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/69/OD1", "atom2_id": "///A/194/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2070, "atom2_serNum": 2090, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/70/O", "atom2_id": "///A/73/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2097, "atom2_serNum": 3136, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///A/73/OE1", "atom2_id": "///A/199/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2102, "atom2_serNum": 2124, "donAcc_type": "standard", "distance": 2.998, "atom1_id": "///A/74/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2102, "atom2_serNum": 2136, "donAcc_type": "standard", "distance": 3.607, "atom1_id": "///A/74/O", "atom2_id": "///A/78/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2106, "atom2_serNum": 2115, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/74/OD2", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2110, "atom2_serNum": 2143, "donAcc_type": "standard", "distance": 3.424, "atom1_id": "///A/75/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2118, "atom2_serNum": 2152, "donAcc_type": "standard", "distance": 3.375, "atom1_id": "///A/76/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2118, "atom2_serNum": 2157, "donAcc_type": "acceptable", "distance": 3.308, "atom1_id": "///A/76/O", "atom2_id": "///A/80/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2127, "atom2_serNum": 2157, "donAcc_type": "acceptable", "distance": 2.956, "atom1_id": "///A/77/O", "atom2_id": "///A/80/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2127, "atom2_serNum": 2158, "donAcc_type": "standard", "distance": 2.999, "atom1_id": "///A/77/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2135, "atom2_serNum": 3857, "donAcc_type": "acceptable", "distance": 3.844, "atom1_id": "///A/77/OH", "atom2_id": "///A/285/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2139, "atom2_serNum": 2166, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/78/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2146, "atom2_serNum": 2175, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/79/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2155, "atom2_serNum": 2183, "donAcc_type": "standard", "distance": 3.022, "atom1_id": "///A/80/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2161, "atom2_serNum": 2191, "donAcc_type": "standard", "distance": 3.142, "atom1_id": "///A/81/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2169, "atom2_serNum": 2198, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///A/82/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2174, "atom2_serNum": 5853, "donAcc_type": "acceptable", "distance": 3.138, "atom1_id": "///A/82/NZ", "atom2_id": "///A/1393/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 283, "atom1_serNum": 2174, "atom2_serNum": 5854, "donAcc_type": "acceptable", "distance": 2.769, "atom1_id": "///A/82/NZ", "atom2_id": "///A/1393/O2", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 284, "atom1_serNum": 2178, "atom2_serNum": 2207, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/83/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2186, "atom2_serNum": 2221, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/84/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2189, "atom2_serNum": 3954, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/84/OD1", "atom2_id": "///A/297/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2189, "atom2_serNum": 3955, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/84/OD1", "atom2_id": "///A/297/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2194, "atom2_serNum": 2233, "donAcc_type": "standard", "distance": 3.385, "atom1_id": "///A/85/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2201, "atom2_serNum": 2229, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/86/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2224, "atom2_serNum": 4032, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/88/O", "atom2_id": "///A/307/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2281, "atom2_serNum": 2300, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/95/O", "atom2_id": "///A/97/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2286, "atom2_serNum": 5856, "donAcc_type": "acceptable", "distance": 3.963, "atom1_id": "///A/96/N", "atom2_id": "///A/1393/O4", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 293, "atom1_serNum": 2304, "atom2_serNum": 2335, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/98/N", "atom2_id": "///A/101/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2307, "atom2_serNum": 2328, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/98/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2315, "atom2_serNum": 5853, "donAcc_type": "acceptable", "distance": 2.651, "atom1_id": "///A/98/OH", "atom2_id": "///A/1393/O1", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 296, "atom1_serNum": 2319, "atom2_serNum": 2336, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/99/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2325, "atom2_serNum": 2348, "donAcc_type": "standard", "distance": 2.868, "atom1_id": "///A/100/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2339, "atom2_serNum": 2376, "donAcc_type": "standard", "distance": 2.674, "atom1_id": "///A/102/O", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2347, "atom2_serNum": 3326, "donAcc_type": "acceptable", "distance": 2.576, "atom1_id": "///A/102/OH", "atom2_id": "///A/222/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2351, "atom2_serNum": 2384, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/103/O", "atom2_id": "///A/107/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2362, "atom2_serNum": 2394, "donAcc_type": "standard", "distance": 3.157, "atom1_id": "///A/104/O", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2365, "atom2_serNum": 3173, "donAcc_type": "standard", "distance": 3.194, "atom1_id": "///A/104/OD1", "atom2_id": "///A/204/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2370, "atom2_serNum": 2399, "donAcc_type": "standard", "distance": 3.041, "atom1_id": "///A/105/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2379, "atom2_serNum": 2411, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/106/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2387, "atom2_serNum": 2416, "donAcc_type": "standard", "distance": 3.076, "atom1_id": "///A/107/O", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2397, "atom2_serNum": 2424, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/108/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2402, "atom2_serNum": 2433, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/109/O", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2410, "atom2_serNum": 3542, "donAcc_type": "acceptable", "distance": 2.936, "atom1_id": "///A/109/OH", "atom2_id": "///A/248/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2414, "atom2_serNum": 2441, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/110/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2419, "atom2_serNum": 2449, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/111/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2427, "atom2_serNum": 2457, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/112/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2432, "atom2_serNum": 2465, "donAcc_type": "standard", "distance": 3.320, "atom1_id": "///A/112/OE2", "atom2_id": "///A/116/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2432, "atom2_serNum": 3539, "donAcc_type": "standard", "distance": 3.065, "atom1_id": "///A/112/OE2", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2432, "atom2_serNum": 3544, "donAcc_type": "acceptable", "distance": 2.809, "atom1_id": "///A/112/OE2", "atom2_id": "///A/248/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2436, "atom2_serNum": 2466, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///A/113/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2436, "atom2_serNum": 2470, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///A/113/O", "atom2_id": "///A/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2444, "atom2_serNum": 2466, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/114/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2465, "atom2_serNum": 3526, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/116/NZ", "atom2_id": "///A/246/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2473, "atom2_serNum": 2926, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/118/O", "atom2_id": "///A/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2483, "atom2_serNum": 2913, "donAcc_type": "standard", "distance": 2.827, "atom1_id": "///A/120/N", "atom2_id": "///A/173/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2486, "atom2_serNum": 2910, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/120/O", "atom2_id": "///A/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2494, "atom2_serNum": 3029, "donAcc_type": "acceptable", "distance": 2.789, "atom1_id": "///A/120/OH", "atom2_id": "///A/187/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2495, "atom2_serNum": 2766, "donAcc_type": "questionable", "distance": 2.813, "atom1_id": "///A/121/N", "atom2_id": "///A/153/ND2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2498, "atom2_serNum": 2727, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///A/121/O", "atom2_id": "///A/148/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2502, "atom2_serNum": 2899, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/122/N", "atom2_id": "///A/171/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2505, "atom2_serNum": 2896, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/122/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2508, "atom2_serNum": 2510, "donAcc_type": "standard", "distance": 2.852, "atom1_id": "///A/122/OD1", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2508, "atom2_serNum": 2519, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/122/OD1", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2508, "atom2_serNum": 2678, "donAcc_type": "acceptable", "distance": 2.704, "atom1_id": "///A/122/OD1", "atom2_id": "///A/143/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2509, "atom2_serNum": 2917, "donAcc_type": "standard", "distance": 3.127, "atom1_id": "///A/122/OD2", "atom2_id": "///A/173/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2509, "atom2_serNum": 2920, "donAcc_type": "standard", "distance": 3.330, "atom1_id": "///A/122/OD2", "atom2_id": "///A/173/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2518, "atom2_serNum": 2727, "donAcc_type": "standard", "distance": 3.513, "atom1_id": "///A/123/OE2", "atom2_id": "///A/148/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2530, "atom2_serNum": 2559, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///A/125/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2532, "atom2_serNum": 2550, "donAcc_type": "acceptable", "distance": 3.073, "atom1_id": "///A/125/OG1", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2544, "atom2_serNum": 2567, "donAcc_type": "standard", "distance": 3.106, "atom1_id": "///A/127/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2544, "atom2_serNum": 2578, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///A/127/O", "atom2_id": "///A/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2553, "atom2_serNum": 2587, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/128/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2562, "atom2_serNum": 2599, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/129/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2570, "atom2_serNum": 2610, "donAcc_type": "standard", "distance": 3.819, "atom1_id": "///A/130/O", "atom2_id": "///A/134/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2590, "atom2_serNum": 2656, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///A/132/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2602, "atom2_serNum": 3018, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/133/O", "atom2_id": "///A/186/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2614, "atom2_serNum": 2639, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/135/N", "atom2_id": "///A/138/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2617, "atom2_serNum": 3021, "donAcc_type": "standard", "distance": 2.824, "atom1_id": "///A/135/O", "atom2_id": "///A/186/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2619, "atom2_serNum": 2629, "donAcc_type": "acceptable", "distance": 3.197, "atom1_id": "///A/135/OG1", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2619, "atom2_serNum": 2636, "donAcc_type": "acceptable", "distance": 2.892, "atom1_id": "///A/135/OG1", "atom2_id": "///A/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2652, "atom2_serNum": 2954, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/140/N", "atom2_id": "///A/178/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2676, "atom2_serNum": 2698, "donAcc_type": "standard", "distance": 3.273, "atom1_id": "///A/143/O", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2689, "atom2_serNum": 2717, "donAcc_type": "standard", "distance": 3.403, "atom1_id": "///A/145/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2701, "atom2_serNum": 2934, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///A/146/O", "atom2_id": "///A/175/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2705, "atom2_serNum": 3029, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/146/NE", "atom2_id": "///A/187/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2708, "atom2_serNum": 2938, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/146/NH2", "atom2_id": "///A/176/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2708, "atom2_serNum": 3028, "donAcc_type": "standard", "distance": 3.168, "atom1_id": "///A/146/NH2", "atom2_id": "///A/187/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2728, "atom2_serNum": 2758, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///A/149/N", "atom2_id": "///A/152/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2731, "atom2_serNum": 2759, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/149/O", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2733, "atom2_serNum": 2750, "donAcc_type": "acceptable", "distance": 3.064, "atom1_id": "///A/149/OG", "atom2_id": "///A/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2737, "atom2_serNum": 2767, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/150/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2741, "atom2_serNum": 2749, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/151/N", "atom2_id": "///A/151/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2744, "atom2_serNum": 2775, "donAcc_type": "standard", "distance": 3.050, "atom1_id": "///A/151/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2753, "atom2_serNum": 2780, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/152/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2762, "atom2_serNum": 2788, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///A/153/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2770, "atom2_serNum": 2799, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/154/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2778, "atom2_serNum": 2808, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///A/155/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2783, "atom2_serNum": 2817, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/156/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2791, "atom2_serNum": 2825, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/157/O", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2802, "atom2_serNum": 2836, "donAcc_type": "standard", "distance": 2.644, "atom1_id": "///A/158/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2806, "atom2_serNum": 2834, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/158/OE1", "atom2_id": "///A/161/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2807, "atom2_serNum": 2834, "donAcc_type": "standard", "distance": 3.062, "atom1_id": "///A/158/OE2", "atom2_id": "///A/161/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2807, "atom2_serNum": 2835, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/158/OE2", "atom2_id": "///A/161/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2811, "atom2_serNum": 2841, "donAcc_type": "standard", "distance": 3.195, "atom1_id": "///A/159/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2811, "atom2_serNum": 2845, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/159/O", "atom2_id": "///A/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 2820, "atom2_serNum": 2841, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/160/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2863, "atom2_serNum": 2882, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/166/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 2902, "atom2_serNum": 3055, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/172/N", "atom2_id": "///A/191/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 2905, "atom2_serNum": 3044, "donAcc_type": "standard", "distance": 2.573, "atom1_id": "///A/172/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 2905, "atom2_serNum": 3052, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///A/172/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2919, "atom2_serNum": 3025, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///A/173/NH1", "atom2_id": "///A/187/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 2921, "atom2_serNum": 3033, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/174/N", "atom2_id": "///A/188/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2935, "atom2_serNum": 3028, "donAcc_type": "standard", "distance": 3.010, "atom1_id": "///A/176/N", "atom2_id": "///A/187/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 2943, "atom2_serNum": 3006, "donAcc_type": "standard", "distance": 3.392, "atom1_id": "///A/177/N", "atom2_id": "///A/185/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2943, "atom2_serNum": 3028, "donAcc_type": "standard", "distance": 3.748, "atom1_id": "///A/177/N", "atom2_id": "///A/187/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 2946, "atom2_serNum": 2964, "donAcc_type": "standard", "distance": 3.203, "atom1_id": "///A/177/O", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 2949, "atom2_serNum": 2959, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/177/OD1", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 2967, "atom2_serNum": 3020, "donAcc_type": "standard", "distance": 2.518, "atom1_id": "///A/180/O", "atom2_id": "///A/186/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 2973, "atom2_serNum": 2988, "donAcc_type": "standard", "distance": 3.297, "atom1_id": "///A/181/O", "atom2_id": "///A/183/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 2980, "atom2_serNum": 3003, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/182/O", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 2991, "atom2_serNum": 3011, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///A/183/O", "atom2_id": "///A/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 3006, "atom2_serNum": 3022, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/185/O", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3047, "atom2_serNum": 3221, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/190/O", "atom2_id": "///A/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3064, "atom2_serNum": 3205, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/192/N", "atom2_id": "///A/208/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3067, "atom2_serNum": 3202, "donAcc_type": "standard", "distance": 2.986, "atom1_id": "///A/192/O", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3073, "atom2_serNum": 3205, "donAcc_type": "standard", "distance": 3.240, "atom1_id": "///A/192/NH1", "atom2_id": "///A/208/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3073, "atom2_serNum": 3217, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/192/NH1", "atom2_id": "///A/209/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3083, "atom2_serNum": 3191, "donAcc_type": "standard", "distance": 2.684, "atom1_id": "///A/194/N", "atom2_id": "///A/206/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3086, "atom2_serNum": 3103, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/194/O", "atom2_id": "///A/196/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3106, "atom2_serNum": 3213, "donAcc_type": "acceptable", "distance": 2.708, "atom1_id": "///A/196/O", "atom2_id": "///A/208/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3115, "atom2_serNum": 3164, "donAcc_type": "standard", "distance": 3.250, "atom1_id": "///A/197/OE1", "atom2_id": "///A/203/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3117, "atom2_serNum": 3156, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///A/198/N", "atom2_id": "///A/202/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3120, "atom2_serNum": 3153, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///A/198/O", "atom2_id": "///A/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3123, "atom2_serNum": 3137, "donAcc_type": "acceptable", "distance": 2.820, "atom1_id": "///A/198/ND1", "atom2_id": "///A/200/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3123, "atom2_serNum": 3146, "donAcc_type": "acceptable", "distance": 3.385, "atom1_id": "///A/198/ND1", "atom2_id": "///A/201/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3133, "atom2_serNum": 3145, "donAcc_type": "acceptable", "distance": 2.884, "atom1_id": "///A/199/ND1", "atom2_id": "///A/200/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3149, "atom2_serNum": 3165, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/201/O", "atom2_id": "///A/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3224, "atom2_serNum": 3249, "donAcc_type": "standard", "distance": 3.059, "atom1_id": "///A/210/O", "atom2_id": "///A/213/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3224, "atom2_serNum": 3260, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/210/O", "atom2_id": "///A/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3232, "atom2_serNum": 3267, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/211/O", "atom2_id": "///A/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3240, "atom2_serNum": 5878, "donAcc_type": "acceptable", "distance": 2.945, "atom1_id": "///A/211/OH", "atom2_id": "///A/998/NE2", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 407, "atom1_serNum": 3247, "atom2_serNum": 3434, "donAcc_type": "questionable", "distance": 2.938, "atom1_id": "///A/212/OD1", "atom2_id": "///A/236/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3252, "atom2_serNum": 3283, "donAcc_type": "standard", "distance": 3.977, "atom1_id": "///A/213/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3263, "atom2_serNum": 3291, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/214/O", "atom2_id": "///A/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3270, "atom2_serNum": 3297, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/215/O", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3276, "atom2_serNum": 3361, "donAcc_type": "acceptable", "distance": 3.841, "atom1_id": "///A/215/NE2", "atom2_id": "///A/227/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3280, "atom2_serNum": 3305, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/216/O", "atom2_id": "///A/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3286, "atom2_serNum": 3310, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/217/O", "atom2_id": "///A/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3294, "atom2_serNum": 3318, "donAcc_type": "standard", "distance": 3.017, "atom1_id": "///A/218/O", "atom2_id": "///A/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3300, "atom2_serNum": 3327, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/219/O", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3300, "atom2_serNum": 3331, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/219/O", "atom2_id": "///A/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3304, "atom2_serNum": 3361, "donAcc_type": "acceptable", "distance": 2.677, "atom1_id": "///A/219/OD2", "atom2_id": "///A/227/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3304, "atom2_serNum": 3477, "donAcc_type": "acceptable", "distance": 3.021, "atom1_id": "///A/219/OD2", "atom2_id": "///A/240/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3308, "atom2_serNum": 3327, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/220/O", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3342, "atom2_serNum": 3585, "donAcc_type": "standard", "distance": 3.360, "atom1_id": "///A/225/O", "atom2_id": "///A/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3356, "atom2_serNum": 3588, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/227/N", "atom2_id": "///A/254/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3359, "atom2_serNum": 3605, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/227/O", "atom2_id": "///A/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3370, "atom2_serNum": 3608, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/229/N", "atom2_id": "///A/256/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3373, "atom2_serNum": 3626, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/229/O", "atom2_id": "///A/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3376, "atom2_serNum": 5901, "donAcc_type": "acceptable", "distance": 3.207, "atom1_id": "///A/230/N", "atom2_id": "///A/998/O2'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 426, "atom1_serNum": 3379, "atom2_serNum": 3400, "donAcc_type": "standard", "distance": 3.325, "atom1_id": "///A/230/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3381, "atom2_serNum": 3398, "donAcc_type": "acceptable", "distance": 2.609, "atom1_id": "///A/230/OG1", "atom2_id": "///A/232/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3381, "atom2_serNum": 5901, "donAcc_type": "acceptable", "distance": 2.722, "atom1_id": "///A/230/OG1", "atom2_id": "///A/998/O2'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 429, "atom1_serNum": 3386, "atom2_serNum": 3400, "donAcc_type": "standard", "distance": 2.668, "atom1_id": "///A/231/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3386, "atom2_serNum": 3411, "donAcc_type": "standard", "distance": 2.883, "atom1_id": "///A/231/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3391, "atom2_serNum": 3398, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///A/232/N", "atom2_id": "///A/232/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3394, "atom2_serNum": 3435, "donAcc_type": "standard", "distance": 3.361, "atom1_id": "///A/232/O", "atom2_id": "///A/236/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3399, "atom2_serNum": 3652, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///A/232/OE2", "atom2_id": "///A/260/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3403, "atom2_serNum": 3436, "donAcc_type": "standard", "distance": 3.140, "atom1_id": "///A/233/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3403, "atom2_serNum": 3604, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///A/233/O", "atom2_id": "///A/255/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3414, "atom2_serNum": 3456, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/234/O", "atom2_id": "///A/238/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3418, "atom2_serNum": 4116, "donAcc_type": "standard", "distance": 3.317, "atom1_id": "///A/234/OE1", "atom2_id": "///A/317/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3423, "atom2_serNum": 3447, "donAcc_type": "standard", "distance": 3.102, "atom1_id": "///A/235/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3431, "atom2_serNum": 3458, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///A/236/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3431, "atom2_serNum": 3466, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/236/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3439, "atom2_serNum": 3478, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/237/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3445, "atom2_serNum": 3624, "donAcc_type": "standard", "distance": 3.351, "atom1_id": "///A/237/NH1", "atom2_id": "///A/257/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3445, "atom2_serNum": 3625, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/237/NH1", "atom2_id": "///A/257/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3450, "atom2_serNum": 3486, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/238/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3461, "atom2_serNum": 3500, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/239/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3469, "atom2_serNum": 3507, "donAcc_type": "standard", "distance": 3.314, "atom1_id": "///A/240/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3481, "atom2_serNum": 3515, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/241/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3484, "atom2_serNum": 3577, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/241/OD1", "atom2_id": "///A/252/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3489, "atom2_serNum": 3523, "donAcc_type": "standard", "distance": 3.068, "atom1_id": "///A/242/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3489, "atom2_serNum": 3530, "donAcc_type": "standard", "distance": 2.568, "atom1_id": "///A/242/O", "atom2_id": "///A/246/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3503, "atom2_serNum": 3523, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/243/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3503, "atom2_serNum": 3531, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///A/243/O", "atom2_id": "///A/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3521, "atom2_serNum": 3574, "donAcc_type": "acceptable", "distance": 3.264, "atom1_id": "///A/245/OD1", "atom2_id": "///A/252/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3534, "atom2_serNum": 3546, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///A/247/O", "atom2_id": "///A/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3604, "atom2_serNum": 3625, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///A/255/NE2", "atom2_id": "///A/257/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3617, "atom2_serNum": 3624, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///A/257/N", "atom2_id": "///A/257/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3637, "atom2_serNum": 4104, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///A/259/N", "atom2_id": "///A/316/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 458, "atom1_serNum": 3642, "atom2_serNum": 4120, "donAcc_type": "acceptable", "distance": 2.660, "atom1_id": "///A/259/OG", "atom2_id": "///A/318/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 459, "atom1_serNum": 3642, "atom2_serNum": 4141, "donAcc_type": "acceptable", "distance": 3.268, "atom1_id": "///A/259/OG", "atom2_id": "///A/320/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3653, "atom2_serNum": 3716, "donAcc_type": "standard", "distance": 3.322, "atom1_id": "///A/260/NH2", "atom2_id": "///A/268/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3653, "atom2_serNum": 5858, "donAcc_type": "acceptable", "distance": 2.692, "atom1_id": "///A/260/NH2", "atom2_id": "///A/1394/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 462, "atom1_serNum": 3654, "atom2_serNum": 5894, "donAcc_type": "standard", "distance": 2.938, "atom1_id": "///A/261/N", "atom2_id": "///A/998/N1", "atom_pair": "N:N", "residue_pair": "aa:ligand" }, { "index": 463, "atom1_serNum": 3657, "atom2_serNum": 5896, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///A/261/O", "atom2_id": "///A/998/N6", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 464, "atom1_serNum": 3665, "atom2_serNum": 4149, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/262/O", "atom2_id": "///A/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3669, "atom2_serNum": 4137, "donAcc_type": "standard", "distance": 3.301, "atom1_id": "///A/262/ND2", "atom2_id": "///A/320/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 466, "atom1_serNum": 3673, "atom2_serNum": 3699, "donAcc_type": "standard", "distance": 3.317, "atom1_id": "///A/263/O", "atom2_id": "///A/266/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3673, "atom2_serNum": 3702, "donAcc_type": "questionable", "distance": 2.985, "atom1_id": "///A/263/O", "atom2_id": "///A/266/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3678, "atom2_serNum": 4152, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/264/N", "atom2_id": "///A/322/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3687, "atom2_serNum": 5321, "donAcc_type": "standard", "distance": 2.662, "atom1_id": "///A/265/N", "atom2_id": "///A/479/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 470, "atom1_serNum": 3690, "atom2_serNum": 5294, "donAcc_type": "standard", "distance": 3.467, "atom1_id": "///A/265/O", "atom2_id": "///A/476/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 471, "atom1_serNum": 3713, "atom2_serNum": 5863, "donAcc_type": "acceptable", "distance": 3.166, "atom1_id": "///A/268/N", "atom2_id": "///A/1395/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 472, "atom1_serNum": 3716, "atom2_serNum": 5859, "donAcc_type": "acceptable", "distance": 3.749, "atom1_id": "///A/268/O", "atom2_id": "///A/1394/O2", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 473, "atom1_serNum": 3724, "atom2_serNum": 3756, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/269/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 474, "atom1_serNum": 3726, "atom2_serNum": 3747, "donAcc_type": "acceptable", "distance": 2.891, "atom1_id": "///A/269/OG", "atom2_id": "///A/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3727, "atom2_serNum": 5859, "donAcc_type": "acceptable", "distance": 2.677, "atom1_id": "///A/270/N", "atom2_id": "///A/1394/O2", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 476, "atom1_serNum": 3730, "atom2_serNum": 3764, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///A/270/O", "atom2_id": "///A/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 477, "atom1_serNum": 3735, "atom2_serNum": 5861, "donAcc_type": "acceptable", "distance": 3.185, "atom1_id": "///A/270/NZ", "atom2_id": "///A/1394/O4", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 478, "atom1_serNum": 3735, "atom2_serNum": 5884, "donAcc_type": "acceptable", "distance": 2.945, "atom1_id": "///A/270/NZ", "atom2_id": "///A/998/O2S", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 479, "atom1_serNum": 3739, "atom2_serNum": 3772, "donAcc_type": "standard", "distance": 3.319, "atom1_id": "///A/271/O", "atom2_id": "///A/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3750, "atom2_serNum": 3780, "donAcc_type": "standard", "distance": 3.206, "atom1_id": "///A/272/O", "atom2_id": "///A/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3755, "atom2_serNum": 5866, "donAcc_type": "acceptable", "distance": 2.851, "atom1_id": "///A/272/NZ", "atom2_id": "///A/1395/O4", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 482, "atom1_serNum": 3759, "atom2_serNum": 3788, "donAcc_type": "standard", "distance": 3.339, "atom1_id": "///A/273/O", "atom2_id": "///A/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3767, "atom2_serNum": 3795, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///A/274/O", "atom2_id": "///A/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3767, "atom2_serNum": 3800, "donAcc_type": "acceptable", "distance": 2.650, "atom1_id": "///A/274/O", "atom2_id": "///A/278/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3775, "atom2_serNum": 3802, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/275/O", "atom2_id": "///A/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 3783, "atom2_serNum": 3819, "donAcc_type": "standard", "distance": 2.888, "atom1_id": "///A/276/O", "atom2_id": "///A/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 3791, "atom2_serNum": 3810, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/277/O", "atom2_id": "///A/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 3836, "atom2_serNum": 3878, "donAcc_type": "standard", "distance": 2.701, "atom1_id": "///A/283/N", "atom2_id": "///A/287/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 3843, "atom2_serNum": 3966, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///A/283/OE1", "atom2_id": "///A/298/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 3843, "atom2_serNum": 5718, "donAcc_type": "standard", "distance": 2.905, "atom1_id": "///A/283/OE1", "atom2_id": "///A/530/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 3844, "atom2_serNum": 5245, "donAcc_type": "standard", "distance": 3.193, "atom1_id": "///A/283/OE2", "atom2_id": "///A/470/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 3848, "atom2_serNum": 3871, "donAcc_type": "standard", "distance": 2.873, "atom1_id": "///A/284/O", "atom2_id": "///A/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 3852, "atom2_serNum": 3917, "donAcc_type": "acceptable", "distance": 2.671, "atom1_id": "///A/285/O", "atom2_id": "///A/292/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 3870, "atom2_serNum": 3965, "donAcc_type": "standard", "distance": 3.089, "atom1_id": "///A/286/OD2", "atom2_id": "///A/298/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 3874, "atom2_serNum": 3897, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/287/O", "atom2_id": "///A/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 3877, "atom2_serNum": 3886, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/287/OD1", "atom2_id": "///A/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 3878, "atom2_serNum": 3895, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/287/OD2", "atom2_id": "///A/289/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 3882, "atom2_serNum": 3976, "donAcc_type": "standard", "distance": 2.832, "atom1_id": "///A/288/O", "atom2_id": "///A/299/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 3915, "atom2_serNum": 3937, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///A/292/O", "atom2_id": "///A/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 3917, "atom2_serNum": 3933, "donAcc_type": "acceptable", "distance": 3.167, "atom1_id": "///A/292/OG1", "atom2_id": "///A/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 3922, "atom2_serNum": 3945, "donAcc_type": "standard", "distance": 2.722, "atom1_id": "///A/293/O", "atom2_id": "///A/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 3930, "atom2_serNum": 3956, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/294/O", "atom2_id": "///A/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 3936, "atom2_serNum": 3967, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/295/O", "atom2_id": "///A/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 3940, "atom2_serNum": 3978, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/296/O", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 3940, "atom2_serNum": 3982, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/296/O", "atom2_id": "///A/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 3948, "atom2_serNum": 3978, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/297/O", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 3959, "atom2_serNum": 5787, "donAcc_type": "standard", "distance": 2.860, "atom1_id": "///A/298/O", "atom2_id": "///A/539/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 3970, "atom2_serNum": 5804, "donAcc_type": "acceptable", "distance": 2.904, "atom1_id": "///A/299/O", "atom2_id": "///A/541/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 3974, "atom2_serNum": 5791, "donAcc_type": "standard", "distance": 3.284, "atom1_id": "///A/299/NE", "atom2_id": "///A/540/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 3974, "atom2_serNum": 5802, "donAcc_type": "standard", "distance": 3.084, "atom1_id": "///A/299/NE", "atom2_id": "///A/541/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 3997, "atom2_serNum": 3999, "donAcc_type": "acceptable", "distance": 2.883, "atom1_id": "///A/302/O", "atom2_id": "///A/302/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 3997, "atom2_serNum": 4016, "donAcc_type": "acceptable", "distance": 2.548, "atom1_id": "///A/302/O", "atom2_id": "///A/305/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 3997, "atom2_serNum": 4017, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/302/O", "atom2_id": "///A/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 3999, "atom2_serNum": 4011, "donAcc_type": "acceptable", "distance": 2.876, "atom1_id": "///A/302/OG1", "atom2_id": "///A/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 3999, "atom2_serNum": 4016, "donAcc_type": "acceptable", "distance": 3.087, "atom1_id": "///A/302/OG1", "atom2_id": "///A/305/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 3999, "atom2_serNum": 4249, "donAcc_type": "acceptable", "distance": 2.665, "atom1_id": "///A/302/OG1", "atom2_id": "///A/334/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4004, "atom2_serNum": 4025, "donAcc_type": "standard", "distance": 3.006, "atom1_id": "///A/303/O", "atom2_id": "///A/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4009, "atom2_serNum": 4036, "donAcc_type": "standard", "distance": 2.989, "atom1_id": "///A/304/O", "atom2_id": "///A/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4014, "atom2_serNum": 4045, "donAcc_type": "standard", "distance": 2.992, "atom1_id": "///A/305/O", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 520, "atom1_serNum": 4020, "atom2_serNum": 4056, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///A/306/O", "atom2_id": "///A/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 521, "atom1_serNum": 4028, "atom2_serNum": 4062, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/307/O", "atom2_id": "///A/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 522, "atom1_serNum": 4035, "atom2_serNum": 5868, "donAcc_type": "acceptable", "distance": 3.075, "atom1_id": "///A/307/NH2", "atom2_id": "///A/1396/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 523, "atom1_serNum": 4035, "atom2_serNum": 5870, "donAcc_type": "acceptable", "distance": 2.649, "atom1_id": "///A/307/NH2", "atom2_id": "///A/1396/O3", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 524, "atom1_serNum": 4039, "atom2_serNum": 4071, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/308/O", "atom2_id": "///A/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4044, "atom2_serNum": 4078, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/308/OE2", "atom2_id": "///A/312/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4048, "atom2_serNum": 4082, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/309/O", "atom2_id": "///A/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4059, "atom2_serNum": 4090, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///A/310/O", "atom2_id": "///A/314/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4080, "atom2_serNum": 4207, "donAcc_type": "acceptable", "distance": 3.244, "atom1_id": "///A/312/NH1", "atom2_id": "///A/329/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4081, "atom2_serNum": 4241, "donAcc_type": "standard", "distance": 3.257, "atom1_id": "///A/312/NH2", "atom2_id": "///A/333/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4106, "atom2_serNum": 4117, "donAcc_type": "acceptable", "distance": 3.044, "atom1_id": "///A/316/OG1", "atom2_id": "///A/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4120, "atom2_serNum": 4141, "donAcc_type": "standard", "distance": 3.207, "atom1_id": "///A/318/O", "atom2_id": "///A/320/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4160, "atom2_serNum": 4179, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///A/323/O", "atom2_id": "///A/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4169, "atom2_serNum": 4193, "donAcc_type": "standard", "distance": 3.075, "atom1_id": "///A/324/O", "atom2_id": "///A/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4177, "atom2_serNum": 4202, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/325/O", "atom2_id": "///A/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4182, "atom2_serNum": 4208, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///A/326/O", "atom2_id": "///A/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4188, "atom2_serNum": 4214, "donAcc_type": "standard", "distance": 3.285, "atom1_id": "///A/327/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4196, "atom2_serNum": 4222, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/328/O", "atom2_id": "///A/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4205, "atom2_serNum": 4233, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/329/O", "atom2_id": "///A/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4211, "atom2_serNum": 4242, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/330/O", "atom2_id": "///A/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4217, "atom2_serNum": 4250, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/331/O", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4225, "atom2_serNum": 4258, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///A/332/O", "atom2_id": "///A/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4229, "atom2_serNum": 5816, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/332/NE", "atom2_id": "///A/543/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4232, "atom2_serNum": 5816, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/332/NH2", "atom2_id": "///A/543/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4236, "atom2_serNum": 4266, "donAcc_type": "standard", "distance": 3.393, "atom1_id": "///A/333/O", "atom2_id": "///A/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4245, "atom2_serNum": 4266, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/334/O", "atom2_id": "///A/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4245, "atom2_serNum": 4275, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/334/O", "atom2_id": "///A/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4248, "atom2_serNum": 4282, "donAcc_type": "standard", "distance": 2.983, "atom1_id": "///A/334/OD1", "atom2_id": "///A/338/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4253, "atom2_serNum": 4283, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///A/335/O", "atom2_id": "///A/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4253, "atom2_serNum": 4305, "donAcc_type": "standard", "distance": 3.584, "atom1_id": "///A/335/O", "atom2_id": "///A/341/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4261, "atom2_serNum": 4305, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///A/336/O", "atom2_id": "///A/341/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4269, "atom2_serNum": 4535, "donAcc_type": "standard", "distance": 2.815, "atom1_id": "///A/337/O", "atom2_id": "///A/371/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4286, "atom2_serNum": 4302, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///A/339/O", "atom2_id": "///A/341/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4291, "atom2_serNum": 5594, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/340/O", "atom2_id": "///A/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4295, "atom2_serNum": 4497, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/341/N", "atom2_id": "///A/367/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4306, "atom2_serNum": 5597, "donAcc_type": "standard", "distance": 3.016, "atom1_id": "///A/342/N", "atom2_id": "///A/517/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4309, "atom2_serNum": 5614, "donAcc_type": "standard", "distance": 2.886, "atom1_id": "///A/342/O", "atom2_id": "///A/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4311, "atom2_serNum": 5508, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/343/N", "atom2_id": "///A/504/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4314, "atom2_serNum": 5501, "donAcc_type": "standard", "distance": 3.268, "atom1_id": "///A/343/O", "atom2_id": "///A/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4322, "atom2_serNum": 5141, "donAcc_type": "acceptable", "distance": 2.873, "atom1_id": "///A/344/O", "atom2_id": "///A/457/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4324, "atom2_serNum": 5488, "donAcc_type": "standard", "distance": 2.830, "atom1_id": "///A/345/N", "atom2_id": "///A/502/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4327, "atom2_serNum": 5485, "donAcc_type": "standard", "distance": 3.152, "atom1_id": "///A/345/O", "atom2_id": "///A/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4342, "atom2_serNum": 4659, "donAcc_type": "questionable", "distance": 3.187, "atom1_id": "///A/347/O", "atom2_id": "///A/387/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4342, "atom2_serNum": 4670, "donAcc_type": "questionable", "distance": 3.332, "atom1_id": "///A/347/O", "atom2_id": "///A/388/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4342, "atom2_serNum": 4672, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/347/O", "atom2_id": "///A/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4354, "atom2_serNum": 4659, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/349/N", "atom2_id": "///A/387/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4357, "atom2_serNum": 4656, "donAcc_type": "standard", "distance": 3.453, "atom1_id": "///A/349/O", "atom2_id": "///A/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4361, "atom2_serNum": 5025, "donAcc_type": "standard", "distance": 3.590, "atom1_id": "///A/350/N", "atom2_id": "///A/431/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4364, "atom2_serNum": 5036, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/350/O", "atom2_id": "///A/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4370, "atom2_serNum": 4637, "donAcc_type": "standard", "distance": 3.100, "atom1_id": "///A/351/N", "atom2_id": "///A/385/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4373, "atom2_serNum": 4634, "donAcc_type": "standard", "distance": 3.374, "atom1_id": "///A/351/O", "atom2_id": "///A/385/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4381, "atom2_serNum": 5055, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///A/352/O", "atom2_id": "///A/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4385, "atom2_serNum": 4624, "donAcc_type": "standard", "distance": 2.587, "atom1_id": "///A/353/N", "atom2_id": "///A/383/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4388, "atom2_serNum": 4410, "donAcc_type": "standard", "distance": 3.409, "atom1_id": "///A/353/O", "atom2_id": "///A/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4393, "atom2_serNum": 5058, "donAcc_type": "standard", "distance": 3.086, "atom1_id": "///A/354/N", "atom2_id": "///A/435/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4401, "atom2_serNum": 4954, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/354/OE2", "atom2_id": "///A/421/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4408, "atom2_serNum": 5071, "donAcc_type": "questionable", "distance": 3.013, "atom1_id": "///A/355/OD1", "atom2_id": "///A/437/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4421, "atom2_serNum": 4455, "donAcc_type": "acceptable", "distance": 2.592, "atom1_id": "///A/356/OH", "atom2_id": "///A/361/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4448, "atom2_serNum": 4607, "donAcc_type": "standard", "distance": 2.976, "atom1_id": "///A/361/N", "atom2_id": "///A/381/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4451, "atom2_serNum": 4604, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/361/O", "atom2_id": "///A/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4455, "atom2_serNum": 4905, "donAcc_type": "acceptable", "distance": 3.076, "atom1_id": "///A/361/OE1", "atom2_id": "///A/415/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4456, "atom2_serNum": 4905, "donAcc_type": "acceptable", "distance": 2.912, "atom1_id": "///A/361/OE2", "atom2_id": "///A/415/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4465, "atom2_serNum": 4593, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/363/N", "atom2_id": "///A/379/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4468, "atom2_serNum": 4590, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/363/O", "atom2_id": "///A/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4479, "atom2_serNum": 4573, "donAcc_type": "standard", "distance": 3.055, "atom1_id": "///A/365/N", "atom2_id": "///A/377/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4482, "atom2_serNum": 4570, "donAcc_type": "standard", "distance": 2.908, "atom1_id": "///A/365/O", "atom2_id": "///A/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4490, "atom2_serNum": 4579, "donAcc_type": "standard", "distance": 3.223, "atom1_id": "///A/366/O", "atom2_id": "///A/377/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4494, "atom2_serNum": 4563, "donAcc_type": "standard", "distance": 2.781, "atom1_id": "///A/367/N", "atom2_id": "///A/375/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4500, "atom2_serNum": 4579, "donAcc_type": "standard", "distance": 3.326, "atom1_id": "///A/367/OD1", "atom2_id": "///A/377/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4501, "atom2_serNum": 4555, "donAcc_type": "standard", "distance": 3.359, "atom1_id": "///A/367/ND2", "atom2_id": "///A/374/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 4505, "atom2_serNum": 4527, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///A/368/O", "atom2_id": "///A/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4519, "atom2_serNum": 4525, "donAcc_type": "standard", "distance": 2.875, "atom1_id": "///A/370/N", "atom2_id": "///A/370/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4530, "atom2_serNum": 4552, "donAcc_type": "standard", "distance": 3.067, "atom1_id": "///A/371/O", "atom2_id": "///A/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 4539, "atom2_serNum": 4560, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/372/O", "atom2_id": "///A/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 4543, "atom2_serNum": 4550, "donAcc_type": "standard", "distance": 2.928, "atom1_id": "///A/373/N", "atom2_id": "///A/373/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4577, "atom2_serNum": 5509, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/377/NE", "atom2_id": "///A/504/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4580, "atom2_serNum": 5508, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/377/NH2", "atom2_id": "///A/504/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4620, "atom2_serNum": 5171, "donAcc_type": "acceptable", "distance": 2.942, "atom1_id": "///A/382/OG", "atom2_id": "///A/460/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4628, "atom2_serNum": 5172, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/384/O", "atom2_id": "///A/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 4642, "atom2_serNum": 5162, "donAcc_type": "standard", "distance": 2.579, "atom1_id": "///A/386/N", "atom2_id": "///A/459/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 4645, "atom2_serNum": 5159, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/386/O", "atom2_id": "///A/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 4667, "atom2_serNum": 4688, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///A/388/O", "atom2_id": "///A/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 4670, "atom2_serNum": 4672, "donAcc_type": "standard", "distance": 2.834, "atom1_id": "///A/388/OD1", "atom2_id": "///A/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 4675, "atom2_serNum": 4699, "donAcc_type": "questionable", "distance": 3.262, "atom1_id": "///A/389/O", "atom2_id": "///A/392/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 4681, "atom2_serNum": 5017, "donAcc_type": "standard", "distance": 2.979, "atom1_id": "///A/389/NH1", "atom2_id": "///A/430/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 4686, "atom2_serNum": 4778, "donAcc_type": "acceptable", "distance": 3.225, "atom1_id": "///A/390/O", "atom2_id": "///A/400/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 4691, "atom2_serNum": 4799, "donAcc_type": "standard", "distance": 3.003, "atom1_id": "///A/391/O", "atom2_id": "///A/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 4694, "atom2_serNum": 4797, "donAcc_type": "standard", "distance": 3.715, "atom1_id": "///A/391/OD1", "atom2_id": "///A/402/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 4694, "atom2_serNum": 5633, "donAcc_type": "standard", "distance": 2.807, "atom1_id": "///A/391/OD1", "atom2_id": "///A/520/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 4707, "atom2_serNum": 4802, "donAcc_type": "standard", "distance": 2.885, "atom1_id": "///A/393/N", "atom2_id": "///A/403/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 4710, "atom2_serNum": 4814, "donAcc_type": "standard", "distance": 3.210, "atom1_id": "///A/393/O", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 4717, "atom2_serNum": 4798, "donAcc_type": "questionable", "distance": 3.410, "atom1_id": "///A/393/NH2", "atom2_id": "///A/402/NH2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 4725, "atom2_serNum": 4979, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/394/OE1", "atom2_id": "///A/424/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 4726, "atom2_serNum": 4979, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///A/394/OE2", "atom2_id": "///A/424/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 4744, "atom2_serNum": 4767, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/397/O", "atom2_id": "///A/400/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 4761, "atom2_serNum": 4779, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///A/399/O", "atom2_id": "///A/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 4778, "atom2_serNum": 4802, "donAcc_type": "acceptable", "distance": 3.980, "atom1_id": "///A/400/OH", "atom2_id": "///A/403/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 4791, "atom2_serNum": 4807, "donAcc_type": "standard", "distance": 3.295, "atom1_id": "///A/402/O", "atom2_id": "///A/404/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 4810, "atom2_serNum": 4826, "donAcc_type": "standard", "distance": 3.124, "atom1_id": "///A/404/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 4829, "atom2_serNum": 4930, "donAcc_type": "standard", "distance": 3.668, "atom1_id": "///A/407/O", "atom2_id": "///A/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 4844, "atom2_serNum": 4916, "donAcc_type": "standard", "distance": 3.308, "atom1_id": "///A/409/N", "atom2_id": "///A/417/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 4847, "atom2_serNum": 4913, "donAcc_type": "standard", "distance": 3.220, "atom1_id": "///A/409/O", "atom2_id": "///A/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 4851, "atom2_serNum": 5119, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/410/N", "atom2_id": "///A/454/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 4854, "atom2_serNum": 5127, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/410/O", "atom2_id": "///A/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 4858, "atom2_serNum": 4892, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/410/NE", "atom2_id": "///A/414/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 4862, "atom2_serNum": 4897, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/411/N", "atom2_id": "///A/415/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 4865, "atom2_serNum": 4881, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/411/O", "atom2_id": "///A/413/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 4865, "atom2_serNum": 4889, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///A/411/O", "atom2_id": "///A/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 4870, "atom2_serNum": 5130, "donAcc_type": "standard", "distance": 2.931, "atom1_id": "///A/412/N", "atom2_id": "///A/456/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 4873, "atom2_serNum": 5153, "donAcc_type": "standard", "distance": 3.347, "atom1_id": "///A/412/O", "atom2_id": "///A/458/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 4877, "atom2_serNum": 5622, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/412/NE", "atom2_id": "///A/519/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 4892, "atom2_serNum": 5104, "donAcc_type": "questionable", "distance": 3.170, "atom1_id": "///A/414/O", "atom2_id": "///A/441/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 4906, "atom2_serNum": 5106, "donAcc_type": "acceptable", "distance": 3.346, "atom1_id": "///A/416/N", "atom2_id": "///A/441/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 4909, "atom2_serNum": 5080, "donAcc_type": "standard", "distance": 3.344, "atom1_id": "///A/416/O", "atom2_id": "///A/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 4921, "atom2_serNum": 5064, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///A/418/N", "atom2_id": "///A/436/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 4924, "atom2_serNum": 5061, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///A/418/O", "atom2_id": "///A/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 4935, "atom2_serNum": 5047, "donAcc_type": "standard", "distance": 3.248, "atom1_id": "///A/420/N", "atom2_id": "///A/434/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 4944, "atom2_serNum": 5047, "donAcc_type": "standard", "distance": 3.365, "atom1_id": "///A/421/N", "atom2_id": "///A/434/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 4947, "atom2_serNum": 5044, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/421/O", "atom2_id": "///A/434/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 4953, "atom2_serNum": 4969, "donAcc_type": "standard", "distance": 3.830, "atom1_id": "///A/421/NH1", "atom2_id": "///A/423/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 4962, "atom2_serNum": 5032, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/423/N", "atom2_id": "///A/432/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 4965, "atom2_serNum": 5022, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///A/423/O", "atom2_id": "///A/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 4980, "atom2_serNum": 5009, "donAcc_type": "standard", "distance": 2.956, "atom1_id": "///A/425/N", "atom2_id": "///A/429/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 4983, "atom2_serNum": 5002, "donAcc_type": "standard", "distance": 3.085, "atom1_id": "///A/425/O", "atom2_id": "///A/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 4986, "atom2_serNum": 5002, "donAcc_type": "standard", "distance": 3.007, "atom1_id": "///A/425/OD1", "atom2_id": "///A/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 4986, "atom2_serNum": 5006, "donAcc_type": "standard", "distance": 2.656, "atom1_id": "///A/425/OD1", "atom2_id": "///A/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 5064, "atom2_serNum": 5066, "donAcc_type": "acceptable", "distance": 3.061, "atom1_id": "///A/436/O", "atom2_id": "///A/436/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 5086, "atom2_serNum": 5093, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/438/OD1", "atom2_id": "///A/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5123, "atom2_serNum": 5632, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///A/455/O", "atom2_id": "///A/520/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5162, "atom2_serNum": 5172, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///A/459/O", "atom2_id": "///A/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5169, "atom2_serNum": 5192, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/460/O", "atom2_id": "///A/464/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5171, "atom2_serNum": 5188, "donAcc_type": "acceptable", "distance": 2.977, "atom1_id": "///A/460/OG", "atom2_id": "///A/463/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5197, "atom2_serNum": 5499, "donAcc_type": "standard", "distance": 2.797, "atom1_id": "///A/465/N", "atom2_id": "///A/503/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5200, "atom2_serNum": 5212, "donAcc_type": "standard", "distance": 2.968, "atom1_id": "///A/465/O", "atom2_id": "///A/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5200, "atom2_serNum": 5496, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/465/O", "atom2_id": "///A/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5212, "atom2_serNum": 5484, "donAcc_type": "standard", "distance": 3.046, "atom1_id": "///A/467/N", "atom2_id": "///A/501/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5215, "atom2_serNum": 5481, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/467/O", "atom2_id": "///A/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5219, "atom2_serNum": 5758, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/468/N", "atom2_id": "///A/536/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5222, "atom2_serNum": 5769, "donAcc_type": "standard", "distance": 2.879, "atom1_id": "///A/468/O", "atom2_id": "///A/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5226, "atom2_serNum": 5480, "donAcc_type": "standard", "distance": 3.293, "atom1_id": "///A/468/OE1", "atom2_id": "///A/500/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5227, "atom2_serNum": 5243, "donAcc_type": "standard", "distance": 3.119, "atom1_id": "///A/468/OE2", "atom2_id": "///A/470/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5228, "atom2_serNum": 5466, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///A/469/N", "atom2_id": "///A/499/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5231, "atom2_serNum": 5463, "donAcc_type": "standard", "distance": 2.633, "atom1_id": "///A/469/O", "atom2_id": "///A/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5236, "atom2_serNum": 5772, "donAcc_type": "standard", "distance": 2.867, "atom1_id": "///A/470/N", "atom2_id": "///A/538/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5239, "atom2_serNum": 5788, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/470/O", "atom2_id": "///A/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5245, "atom2_serNum": 5266, "donAcc_type": "acceptable", "distance": 3.836, "atom1_id": "///A/470/NH1", "atom2_id": "///A/472/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5247, "atom2_serNum": 5451, "donAcc_type": "standard", "distance": 3.138, "atom1_id": "///A/471/N", "atom2_id": "///A/497/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5250, "atom2_serNum": 5448, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///A/471/O", "atom2_id": "///A/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5258, "atom2_serNum": 5798, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///A/472/O", "atom2_id": "///A/540/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5266, "atom2_serNum": 5786, "donAcc_type": "acceptable", "distance": 3.333, "atom1_id": "///A/472/OH", "atom2_id": "///A/539/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5267, "atom2_serNum": 5437, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/473/N", "atom2_id": "///A/495/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5274, "atom2_serNum": 5417, "donAcc_type": "standard", "distance": 3.436, "atom1_id": "///A/473/OD2", "atom2_id": "///A/492/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5278, "atom2_serNum": 5417, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/474/O", "atom2_id": "///A/492/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5289, "atom2_serNum": 5410, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///A/475/O", "atom2_id": "///A/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5305, "atom2_serNum": 5398, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/477/N", "atom2_id": "///A/490/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5308, "atom2_serNum": 5310, "donAcc_type": "acceptable", "distance": 2.987, "atom1_id": "///A/477/O", "atom2_id": "///A/477/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 5328, "atom2_serNum": 5344, "donAcc_type": "standard", "distance": 3.087, "atom1_id": "///A/480/O", "atom2_id": "///A/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5336, "atom2_serNum": 5349, "donAcc_type": "standard", "distance": 2.993, "atom1_id": "///A/481/O", "atom2_id": "///A/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5365, "atom2_serNum": 5389, "donAcc_type": "standard", "distance": 2.949, "atom1_id": "///A/486/O", "atom2_id": "///A/489/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5365, "atom2_serNum": 5394, "donAcc_type": "acceptable", "distance": 2.777, "atom1_id": "///A/486/O", "atom2_id": "///A/489/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5373, "atom2_serNum": 5395, "donAcc_type": "standard", "distance": 3.190, "atom1_id": "///A/487/O", "atom2_id": "///A/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5384, "atom2_serNum": 5402, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/488/O", "atom2_id": "///A/491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5413, "atom2_serNum": 5439, "donAcc_type": "acceptable", "distance": 3.193, "atom1_id": "///A/492/O", "atom2_id": "///A/495/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5416, "atom2_serNum": 5418, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/492/OD1", "atom2_id": "///A/493/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5416, "atom2_serNum": 5425, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/492/OD1", "atom2_id": "///A/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5451, "atom2_serNum": 5463, "donAcc_type": "standard", "distance": 3.415, "atom1_id": "///A/497/O", "atom2_id": "///A/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5504, "atom2_serNum": 5523, "donAcc_type": "standard", "distance": 3.277, "atom1_id": "///A/504/O", "atom2_id": "///A/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5513, "atom2_serNum": 5531, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/505/O", "atom2_id": "///A/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5520, "atom2_serNum": 5540, "donAcc_type": "standard", "distance": 3.021, "atom1_id": "///A/506/O", "atom2_id": "///A/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5526, "atom2_serNum": 5548, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/507/O", "atom2_id": "///A/510/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5556, "atom2_serNum": 5569, "donAcc_type": "standard", "distance": 3.558, "atom1_id": "///A/511/O", "atom2_id": "///A/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5583, "atom2_serNum": 5662, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/516/N", "atom2_id": "///A/524/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5586, "atom2_serNum": 5659, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/516/O", "atom2_id": "///A/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5602, "atom2_serNum": 5658, "donAcc_type": "acceptable", "distance": 3.747, "atom1_id": "///A/517/NE2", "atom2_id": "///A/523/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5603, "atom2_serNum": 5646, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/518/N", "atom2_id": "///A/522/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5606, "atom2_serNum": 5634, "donAcc_type": "standard", "distance": 3.224, "atom1_id": "///A/518/O", "atom2_id": "///A/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5606, "atom2_serNum": 5643, "donAcc_type": "standard", "distance": 3.290, "atom1_id": "///A/518/O", "atom2_id": "///A/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5647, "atom2_serNum": 5809, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/523/N", "atom2_id": "///A/542/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5650, "atom2_serNum": 5799, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///A/523/O", "atom2_id": "///A/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5650, "atom2_serNum": 5806, "donAcc_type": "standard", "distance": 3.505, "atom1_id": "///A/523/O", "atom2_id": "///A/542/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5670, "atom2_serNum": 5783, "donAcc_type": "standard", "distance": 3.150, "atom1_id": "///A/525/N", "atom2_id": "///A/539/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 5673, "atom2_serNum": 5780, "donAcc_type": "standard", "distance": 2.929, "atom1_id": "///A/525/O", "atom2_id": "///A/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5687, "atom2_serNum": 5709, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/527/O", "atom2_id": "///A/530/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5687, "atom2_serNum": 5719, "donAcc_type": "standard", "distance": 3.143, "atom1_id": "///A/527/O", "atom2_id": "///A/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 5687, "atom2_serNum": 5724, "donAcc_type": "acceptable", "distance": 2.600, "atom1_id": "///A/527/O", "atom2_id": "///A/531/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5712, "atom2_serNum": 5725, "donAcc_type": "standard", "distance": 3.156, "atom1_id": "///A/530/O", "atom2_id": "///A/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 5722, "atom2_serNum": 5724, "donAcc_type": "acceptable", "distance": 2.953, "atom1_id": "///A/531/O", "atom2_id": "///A/531/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 5725, "atom2_serNum": 5749, "donAcc_type": "standard", "distance": 3.151, "atom1_id": "///A/532/N", "atom2_id": "///A/535/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 5730, "atom2_serNum": 5746, "donAcc_type": "acceptable", "distance": 3.093, "atom1_id": "///A/532/OG1", "atom2_id": "///A/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 5783, "atom2_serNum": 5799, "donAcc_type": "standard", "distance": 3.234, "atom1_id": "///A/539/O", "atom2_id": "///A/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 5858, "atom2_serNum": 5898, "donAcc_type": "acceptable", "distance": 2.772, "atom1_id": "///A/1394/O1", "atom2_id": "///A/998/N7", "atom_pair": "O:N", "residue_pair": "ligand:ligand" }, { "index": 711, "atom1_serNum": 5861, "atom2_serNum": 5883, "donAcc_type": "acceptable", "distance": 2.934, "atom1_id": "///A/1394/O4", "atom2_id": "///A/998/O1S", "atom_pair": "O:O", "residue_pair": "ligand:ligand" }, { "index": 712, "atom1_serNum": 5880, "atom2_serNum": 5883, "donAcc_type": "acceptable", "distance": 2.973, "atom1_id": "///A/998/O", "atom2_id": "///A/998/O1S", "atom_pair": "O:O", "residue_pair": "ligand:ligand" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1qtq", "num_aaChains": 1, "aaChains": "A=530", "num_naChains": 1, "naChains": "B=74", "num_atoms": 6061, "num_waters": 160, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 17, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-junctions.pdb", "desc": "an ensemble of junctions (multi-branch)" }, { "index": 7, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 8, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 9, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 10, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 11, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 12, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 13, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 14, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 15, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }