{ "num_pairs": 13, "pairs": [ { "index": 1, "nt1": "///A/2647", "nt2": "///A/2673", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -179.582, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 24.715, "chi2": -141.929, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 41.291, "C1C1_dist": 12.241, "N1N9_dist": 9.812, "C6C8_dist": 9.754, "CNNC_torsion": 2.656, "hbonds_num": 1, "hbonds_desc": "O4(carbonyl)-N1(imino)[2.77]", "interBase_angle": 4.098, "planarity": 0.056, "simple_Shear": -1.517, "simple_Stretch": 0.572, "simple_Buckle": 1.337, "simple_Propeller": -3.874, "bp_simpleParams": [ -1.517, 0.572, -0.263, 1.337, -3.874, -43.720 ], "bp_params": [ -1.590, 0.316, -0.263, 1.954, -3.602, -43.734 ], "frame": { "rmsd": null, "origin": [ 22.758, 24.903, 29.038 ], "x_axis": [ 0.740, -0.118, -0.662 ], "y_axis": [ -0.118, -0.992, 0.046 ], "z_axis": [ -0.662, 0.044, -0.748 ], "quaternion": [ 0.000, 0.933, -0.063, -0.355 ] } }, { "index": 2, "nt1": "///A/2648", "nt2": "///A/2672", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.788, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 42.150, "chi2": -152.805, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 68.595, "C1C1_dist": 10.436, "N1N9_dist": 8.836, "C6C8_dist": 9.700, "CNNC_torsion": -8.106, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.78],N1(imino)-O2(carbonyl)[2.83]", "interBase_angle": 9.044, "planarity": 0.125, "simple_Shear": -2.441, "simple_Stretch": -0.010, "simple_Buckle": 2.667, "simple_Propeller": -8.641, "bp_simpleParams": [ -2.441, -0.010, 0.107, 2.667, -8.641, -2.949 ], "bp_params": [ -2.367, -0.597, 0.107, 4.665, -7.747, -2.953 ], "frame": { "rmsd": null, "origin": [ 23.215, 24.814, 24.494 ], "x_axis": [ 0.630, -0.660, -0.409 ], "y_axis": [ -0.486, -0.746, 0.456 ], "z_axis": [ -0.606, -0.088, -0.790 ], "quaternion": [ 0.153, 0.890, -0.322, -0.285 ] } }, { "index": 3, "nt1": "///A/2649", "nt2": "///A/2671", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.499, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.091, "chi2": -163.679, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.400, "C1C1_dist": 10.616, "N1N9_dist": 8.959, "C6C8_dist": 9.847, "CNNC_torsion": -13.854, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.97],N3-N1(imino)[2.84],N4(amino)-O6(carbonyl)[2.77]", "interBase_angle": 18.594, "planarity": 0.209, "simple_Shear": 0.087, "simple_Stretch": -0.169, "simple_Buckle": 9.604, "simple_Propeller": -15.922, "bp_simpleParams": [ 0.087, -0.169, 0.021, 9.604, -15.922, -2.296 ], "bp_params": [ 0.087, -0.169, 0.021, 9.595, -15.927, -2.310 ], "frame": { "rmsd": null, "origin": [ 22.064, 25.206, 21.340 ], "x_axis": [ 0.191, -0.980, 0.057 ], "y_axis": [ -0.775, -0.115, 0.621 ], "z_axis": [ -0.602, -0.163, -0.782 ], "quaternion": [ 0.271, 0.722, -0.607, -0.188 ] } }, { "index": 4, "nt1": "///A/2650", "nt2": "///A/2670", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -167.171, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.511, "chi2": -165.481, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 59.368, "C1C1_dist": 10.191, "N1N9_dist": 8.716, "C6C8_dist": 9.828, "CNNC_torsion": -16.335, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.81],O4(carbonyl)-N6(amino)[3.13]", "interBase_angle": 17.175, "planarity": 0.217, "simple_Shear": 0.109, "simple_Stretch": -0.110, "simple_Buckle": 4.998, "simple_Propeller": -16.431, "bp_simpleParams": [ 0.109, -0.110, 0.249, 4.998, -16.431, 6.270 ], "bp_params": [ 0.109, -0.111, 0.249, 4.923, -16.454, 6.329 ], "frame": { "rmsd": null, "origin": [ 21.227, 23.477, 18.260 ], "x_axis": [ -0.194, -0.853, 0.484 ], "y_axis": [ -0.771, 0.438, 0.462 ], "z_axis": [ -0.607, -0.284, -0.743 ], "quaternion": [ -0.354, -0.527, 0.770, 0.058 ] } }, { "index": 5, "nt1": "///A/2651", "nt2": "///A/2669", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.016, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.462, "chi2": -168.493, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.047, "C1C1_dist": 10.544, "N1N9_dist": 8.954, "C6C8_dist": 9.955, "CNNC_torsion": -13.518, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.70],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[2.99]", "interBase_angle": 17.805, "planarity": 0.203, "simple_Shear": 0.188, "simple_Stretch": -0.101, "simple_Buckle": 1.692, "simple_Propeller": -17.725, "bp_simpleParams": [ 0.188, -0.101, -0.072, 1.692, -17.725, 3.232 ], "bp_params": [ 0.186, -0.103, -0.072, 1.461, -17.745, 3.271 ], "frame": { "rmsd": null, "origin": [ 20.545, 21.695, 15.168 ], "x_axis": [ -0.554, -0.452, 0.699 ], "y_axis": [ -0.569, 0.819, 0.078 ], "z_axis": [ -0.608, -0.355, -0.710 ], "quaternion": [ -0.372, -0.291, 0.878, -0.079 ] } }, { "index": 6, "nt1": "///A/2652", "nt2": "///A/2668", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.794, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.903, "chi2": -167.211, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.816, "C1C1_dist": 10.639, "N1N9_dist": 8.991, "C6C8_dist": 9.947, "CNNC_torsion": -8.501, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.91],N4(amino)-O6(carbonyl)[2.90]", "interBase_angle": 9.650, "planarity": 0.122, "simple_Shear": 0.287, "simple_Stretch": -0.100, "simple_Buckle": -4.119, "simple_Propeller": -8.727, "bp_simpleParams": [ 0.287, -0.100, 0.257, -4.119, -8.727, 0.532 ], "bp_params": [ 0.285, -0.107, 0.257, -4.322, -8.628, 0.533 ], "frame": { "rmsd": null, "origin": [ 19.103, 18.936, 13.006 ], "x_axis": [ -0.670, 0.063, 0.739 ], "y_axis": [ -0.230, 0.929, -0.288 ], "z_axis": [ -0.705, -0.363, -0.609 ], "quaternion": [ -0.403, -0.047, 0.896, -0.182 ] } }, { "index": 7, "nt1": "///A/2653", "nt2": "///A/2667", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "tW.", "DSSR": "tW-.", "intra_chain": true, "chi1": -151.015, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 80.361, "chi2": -165.683, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 14.303, "C1C1_dist": 10.766, "N1N9_dist": 9.156, "C6C8_dist": 9.745, "CNNC_torsion": -19.735, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N4(amino)[2.90]", "interBase_angle": 12.070, "planarity": 0.145, "simple_Shear": 5.931, "simple_Stretch": 1.616, "simple_Buckle": 6.788, "simple_Propeller": -9.980, "bp_simpleParams": [ 5.931, 1.616, -0.252, 6.788, -9.980, -15.223 ], "bp_params": [ 5.745, -2.187, -0.252, -0.399, -12.063, -15.307 ], "frame": { "rmsd": null, "origin": [ 17.325, 16.236, 11.200 ], "x_axis": [ -0.581, 0.779, 0.238 ], "y_axis": [ 0.291, 0.472, -0.832 ], "z_axis": [ -0.760, -0.414, -0.501 ], "quaternion": [ -0.312, 0.335, 0.799, -0.390 ] } }, { "index": 8, "nt1": "///A/2654", "nt2": "///A/2666", "bp": "A+C", "name": "--", "Saenger": "--", "LW": "tHH", "DSSR": "tM+M", "intra_chain": true, "chi1": -145.331, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 12.851, "chi2": -165.329, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 39.299, "C1C1_dist": 12.589, "N1N9_dist": 10.041, "C6C8_dist": 8.138, "CNNC_torsion": -74.432, "hbonds_num": 1, "hbonds_desc": "N6(amino)-OP2[2.96]", "interBase_angle": 26.664, "planarity": 0.340, "simple_Shear": -8.414, "simple_Stretch": 4.175, "simple_Buckle": -24.407, "simple_Propeller": -10.735, "bp_simpleParams": [ -8.414, 4.175, 0.733, -24.407, -10.735, -137.999 ], "bp_params": [ -5.791, 7.395, 0.733, -26.647, 0.962, -136.944 ], "frame": { "rmsd": null, "origin": [ 14.382, 14.181, 10.498 ], "x_axis": [ 0.566, -0.191, -0.802 ], "y_axis": [ -0.252, 0.886, -0.389 ], "z_axis": [ 0.785, 0.422, 0.453 ], "quaternion": [ 0.852, -0.238, 0.466, 0.018 ] } }, { "index": 9, "nt1": "///A/2655", "nt2": "///A/2656", "bp": "G+U", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -93.468, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 143.288, "chi2": -173.859, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 50.108, "C1C1_dist": 6.814, "N1N9_dist": 7.058, "C6C8_dist": 7.028, "CNNC_torsion": 6.469, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-OP2[2.92],N2(amino)-O4(carbonyl)[2.75]", "interBase_angle": 3.528, "planarity": 0.056, "simple_Shear": 0.160, "simple_Stretch": 8.081, "simple_Buckle": -2.465, "simple_Propeller": 2.524, "bp_simpleParams": [ 0.160, 8.081, -0.221, -2.465, 2.524, 12.391 ], "bp_params": [ 7.891, 1.749, -0.221, 1.872, 2.991, 12.394 ], "frame": { "rmsd": null, "origin": [ 8.235, 18.334, 9.948 ], "x_axis": [ -0.680, 0.593, 0.431 ], "y_axis": [ -0.090, 0.516, -0.852 ], "z_axis": [ -0.728, -0.618, -0.297 ], "quaternion": [ -0.367, 0.159, 0.789, -0.466 ] } }, { "index": 10, "nt1": "///A/2656", "nt2": "///A/2665", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -173.859, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 27.923, "chi2": -179.053, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 24.166, "C1C1_dist": 9.598, "N1N9_dist": 7.083, "C6C8_dist": 6.032, "CNNC_torsion": -167.199, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[3.12],N3(imino)-N7[2.76]", "interBase_angle": 19.344, "planarity": 0.209, "simple_Shear": 4.046, "simple_Stretch": 1.588, "simple_Buckle": 18.049, "simple_Propeller": -6.958, "bp_simpleParams": [ 4.046, 1.588, -0.496, 18.049, -6.958, -105.558 ], "bp_params": [ 4.035, -1.616, -0.496, 8.420, -17.415, -106.047 ], "frame": { "rmsd": null, "origin": [ 11.997, 13.590, 8.704 ], "x_axis": [ -0.424, 0.864, -0.271 ], "y_axis": [ 0.509, -0.020, -0.860 ], "z_axis": [ -0.749, -0.503, -0.432 ], "quaternion": [ -0.176, 0.507, 0.678, -0.503 ] } }, { "index": 11, "nt1": "///A/2657", "nt2": "///A/2664", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -171.098, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 9.976, "chi2": -162.774, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 101.279, "C1C1_dist": 9.509, "N1N9_dist": 8.431, "C6C8_dist": 8.927, "CNNC_torsion": 32.784, "hbonds_num": 3, "hbonds_desc": "N7-N2(amino)[3.04],N6(amino)-O2'(hydroxyl)[2.96],N6(amino)-N3[3.04]", "interBase_angle": 2.804, "planarity": 0.036, "simple_Shear": -7.619, "simple_Stretch": 2.629, "simple_Buckle": 1.258, "simple_Propeller": 2.505, "bp_simpleParams": [ -7.619, 2.629, -0.064, 1.258, 2.505, -0.455 ], "bp_params": [ -6.873, -4.208, -0.064, -1.133, 2.564, -0.455 ], "frame": { "rmsd": null, "origin": [ 6.069, 16.231, 7.220 ], "x_axis": [ -0.584, 0.807, -0.085 ], "y_axis": [ 0.410, 0.203, -0.889 ], "z_axis": [ -0.701, -0.554, -0.450 ], "quaternion": [ -0.206, 0.407, 0.748, -0.482 ] } }, { "index": 12, "nt1": "///A/2658", "nt2": "///A/2663", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.496, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.857, "chi2": -170.941, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.844, "C1C1_dist": 10.548, "N1N9_dist": 8.965, "C6C8_dist": 9.919, "CNNC_torsion": 1.495, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.82],N3-N1(imino)[2.89],N4(amino)-O6(carbonyl)[2.89]", "interBase_angle": 7.814, "planarity": 0.076, "simple_Shear": 0.122, "simple_Stretch": -0.105, "simple_Buckle": 6.767, "simple_Propeller": -3.906, "bp_simpleParams": [ 0.122, -0.105, -0.289, 6.767, -3.906, 1.142 ], "bp_params": [ 0.121, -0.106, -0.289, 6.738, -3.956, 1.141 ], "frame": { "rmsd": null, "origin": [ 3.244, 14.533, 6.505 ], "x_axis": [ 0.133, 0.622, -0.772 ], "y_axis": [ 0.699, -0.611, -0.372 ], "z_axis": [ -0.703, -0.490, -0.516 ], "quaternion": [ 0.039, 0.752, 0.439, -0.490 ] } }, { "index": 13, "nt1": "///A/2659", "nt2": "///A/2662", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -172.864, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 100.184, "chi2": -130.898, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 10.995, "C1C1_dist": 9.248, "N1N9_dist": 8.175, "C6C8_dist": 8.568, "CNNC_torsion": -117.860, "hbonds_num": 2, "hbonds_desc": "N2(amino)-OP2[2.97],N2(amino)-N7[2.86]", "interBase_angle": 18.495, "planarity": 0.269, "simple_Shear": 7.908, "simple_Stretch": 2.601, "simple_Buckle": 14.272, "simple_Propeller": -11.763, "bp_simpleParams": [ 7.908, 2.601, 1.187, 14.272, -11.763, -11.606 ], "bp_params": [ 6.786, -4.822, 1.187, -0.984, -18.469, -11.757 ], "frame": { "rmsd": null, "origin": [ -1.019, 12.597, 6.807 ], "x_axis": [ 0.742, 0.162, -0.651 ], "y_axis": [ 0.397, -0.888, 0.232 ], "z_axis": [ -0.541, -0.431, -0.723 ], "quaternion": [ 0.181, 0.915, 0.153, -0.325 ] } } ], "num_multiplets": 1, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "GUA", "nts_long": "///A/2655,///A/2656,///A/2665", "planarity": 0.234 } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 1, "strand1": "UGCUCCUAUACG", "strand2": "GUGAGGCCAGGA", "bp_type": ".|||||....|.", "helix_form": "..AAA..x...", "helical_rise": 3.160, "helical_rise_std": 0.664, "helical_radius": 8.401, "helical_radius_std": 2.315, "helical_axis": [ -0.656, -0.327, -0.680 ], "point1": [ 25.845, 23.740, 26.480 ], "point2": [ 3.005, 12.350, 2.799 ], "num_pairs": 12, "pairs": [ { "index": 1, "nt1": "///A/2647", "nt2": "///A/2673", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -1.590, 0.316, -0.263, 1.954, -3.602, -43.734 ], "step_params": [ 2.964, -1.315, 3.218, -5.289, 6.766, 34.803 ], "heli_params": [ -2.995, -5.490, 2.465, 11.104, 8.680, 35.815 ], "bp2_params": [ -2.367, -0.597, 0.107, 4.665, -7.747, -2.953 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.218, "simple_Twist": 40.640, "simple_hRise": 2.587, "simple_hTwist": 41.500 }, { "index": 2, "nt1": "///A/2648", "nt2": "///A/2672", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.367, -0.597, 0.107, 4.665, -7.747, -2.953 ], "step_params": [ -0.235, -1.261, 3.127, -2.093, 3.784, 41.783 ], "heli_params": [ -2.129, 0.123, 3.014, 5.288, 2.925, 41.997 ], "bp2_params": [ 0.087, -0.169, 0.021, 9.595, -15.927, -2.310 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.127, "simple_Twist": 28.205, "simple_hRise": 2.945, "simple_hTwist": 28.528 }, { "index": 3, "nt1": "///A/2649", "nt2": "///A/2671", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, -0.169, 0.021, 9.595, -15.927, -2.310 ], "step_params": [ 0.788, -1.420, 3.246, -0.330, 7.258, 33.482 ], "heli_params": [ -3.494, -1.388, 2.877, 12.418, 0.565, 34.239 ], "bp2_params": [ 0.109, -0.111, 0.249, 4.923, -16.454, 6.329 ], "groove_widths": [ 16.026, null, 13.978, null ], "simple_Rise": 3.246, "simple_Twist": 33.330, "simple_hRise": 2.875, "simple_hTwist": 34.090 }, { "index": 4, "nt1": "///A/2650", "nt2": "///A/2670", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.109, -0.111, 0.249, 4.923, -16.454, 6.329 ], "step_params": [ -0.448, -1.599, 3.232, 2.117, 3.948, 33.526 ], "heli_params": [ -3.358, 1.097, 2.997, 6.807, -3.649, 33.816 ], "bp2_params": [ 0.186, -0.103, -0.072, 1.461, -17.745, 3.271 ], "groove_widths": [ 15.926, 14.679, 15.747, 12.382 ], "simple_Rise": 3.232, "simple_Twist": 33.045, "simple_hRise": 2.993, "simple_hTwist": 33.339 }, { "index": 5, "nt1": "///A/2651", "nt2": "///A/2669", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, -0.103, -0.072, 1.461, -17.745, 3.271 ], "step_params": [ -0.133, -1.725, 3.372, -1.242, 8.010, 29.668 ], "heli_params": [ -4.771, 0.016, 2.823, 15.287, 2.371, 30.731 ], "bp2_params": [ 0.285, -0.107, 0.257, -4.322, -8.628, 0.533 ], "groove_widths": [ 16.472, 13.941, 14.858, 13.058 ], "simple_Rise": 3.372, "simple_Twist": 29.294, "simple_hRise": 2.815, "simple_hTwist": 30.371 }, { "index": 6, "nt1": "///A/2652", "nt2": "///A/2668", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.285, -0.107, 0.257, -4.322, -8.628, 0.533 ], "step_params": [ -1.098, -1.100, 3.362, 6.243, 4.203, 52.001 ], "heli_params": [ -1.518, 1.648, 3.129, 4.765, -7.078, 52.506 ], "bp2_params": [ 5.745, -2.187, -0.252, -0.399, -12.063, -15.307 ], "groove_widths": [ 20.169, 16.678, 12.718, 12.344 ], "simple_Rise": 3.362, "simple_Twist": 21.299, "simple_hRise": 2.672, "simple_hTwist": 22.575 }, { "index": 7, "nt1": "///A/2653", "nt2": "///A/2667", "bp": "U-C", "name": "--", "Saenger": "--", "LW": "tW.", "DSSR": "tW-.", "bp1_params": [ 5.745, -2.187, -0.252, -0.399, -12.063, -15.307 ], "step_params": [ 0.388, -1.092, 3.469, 2.188, 2.187, -48.042 ], "heli_params": [ 1.156, 0.658, 3.493, -2.683, 2.685, -48.136 ], "bp2_params": [ -5.791, 7.395, 0.733, -26.647, 0.962, -136.944 ], "groove_widths": [ 22.251, 20.614, 13.208, 12.473 ], "simple_Rise": 3.469, "simple_Twist": 3.595, "simple_hRise": 2.305, "simple_hTwist": 4.742 }, { "index": 8, "nt1": "///A/2654", "nt2": "///A/2666", "bp": "A+C", "name": "--", "Saenger": "--", "LW": "tHH", "DSSR": "tM+M", "bp1_params": [ -5.791, 7.395, 0.733, -26.647, 0.962, -136.944 ], "step_params": [ 0.441, 0.809, 2.900, 3.252, -4.077, 79.135 ], "heli_params": [ 0.731, -0.268, 2.876, -3.197, -2.550, 79.279 ], "bp2_params": [ 4.035, -1.616, -0.496, 8.420, -17.415, -106.047 ], "groove_widths": [ 19.614, 18.959, 18.201, 15.989 ], "simple_Rise": 2.900, "simple_Twist": 35.391, "simple_hRise": 2.820, "simple_hTwist": 35.761 }, { "index": 9, "nt1": "///A/2656", "nt2": "///A/2665", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.035, -1.616, -0.496, 8.420, -17.415, -106.047 ], "step_params": [ 5.495, -1.210, 3.557, -1.906, -3.677, -13.990 ], "heli_params": [ 8.486, 19.712, 3.823, 14.680, -7.611, -14.587 ], "bp2_params": [ -6.873, -4.208, -0.064, -1.133, 2.564, -0.455 ], "groove_widths": [ 17.610, null, 22.312, null ], "simple_Rise": 3.557, "simple_Twist": 56.954, "simple_hRise": 3.452, "simple_hTwist": 57.092 }, { "index": 10, "nt1": "///A/2657", "nt2": "///A/2664", "bp": "A-G", "name": "Sheared", "Saenger": "11-XI", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -6.873, -4.208, -0.064, -1.133, 2.564, -0.455 ], "step_params": [ -0.284, -0.971, 3.217, -1.816, 4.959, 60.478 ], "heli_params": [ -1.195, 0.195, 3.143, 4.913, 1.799, 60.686 ], "bp2_params": [ 0.121, -0.106, -0.289, 6.738, -3.956, 1.141 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.217, "simple_Twist": 12.920, "simple_hRise": 2.673, "simple_hTwist": 13.953 }, { "index": 11, "nt1": "///A/2658", "nt2": "///A/2663", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.121, -0.106, -0.289, 6.738, -3.956, 1.141 ], "step_params": [ -3.036, -1.156, 3.386, -3.711, 15.028, 43.049 ], "heli_params": [ -2.834, 3.583, 3.076, 19.734, 4.873, 45.623 ], "bp2_params": [ 6.786, -4.822, 1.187, -0.984, -18.469, -11.757 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.386, "simple_Twist": -3.624, "simple_hRise": 1.159, "simple_hTwist": -15.896 }, { "index": 12, "nt1": "///A/2659", "nt2": "///A/2662", "bp": "G-A", "name": "Sheared", "Saenger": "11-XI", "LW": "tSH", "DSSR": "tm-M" } ] } ], "num_stems": 1, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GCUCC", "strand2": "UGAGG", "bp_type": "|||||", "helix_form": ".AAA", "helical_rise": 2.600, "helical_rise_std": 0.178, "helical_radius": 9.118, "helical_radius_std": 0.785, "helical_axis": [ -0.776, -0.167, -0.608 ], "point1": [ 24.637, 21.051, 22.830 ], "point2": [ 16.686, 19.344, 16.602 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///A/2648", "nt2": "///A/2672", "bp": "G-U", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.367, -0.597, 0.107, 4.665, -7.747, -2.953 ], "step_params": [ -0.235, -1.261, 3.127, -2.093, 3.784, 41.783 ], "heli_params": [ -2.129, 0.123, 3.014, 5.288, 2.925, 41.997 ], "bp2_params": [ 0.087, -0.169, 0.021, 9.595, -15.927, -2.310 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.127, "simple_Twist": 28.205, "simple_hRise": 2.945, "simple_hTwist": 28.528 }, { "index": 2, "nt1": "///A/2649", "nt2": "///A/2671", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.087, -0.169, 0.021, 9.595, -15.927, -2.310 ], "step_params": [ 0.788, -1.420, 3.246, -0.330, 7.258, 33.482 ], "heli_params": [ -3.494, -1.388, 2.877, 12.418, 0.565, 34.239 ], "bp2_params": [ 0.109, -0.111, 0.249, 4.923, -16.454, 6.329 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.246, "simple_Twist": 33.330, "simple_hRise": 2.875, "simple_hTwist": 34.090 }, { "index": 3, "nt1": "///A/2650", "nt2": "///A/2670", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.109, -0.111, 0.249, 4.923, -16.454, 6.329 ], "step_params": [ -0.448, -1.599, 3.232, 2.117, 3.948, 33.526 ], "heli_params": [ -3.358, 1.097, 2.997, 6.807, -3.649, 33.816 ], "bp2_params": [ 0.186, -0.103, -0.072, 1.461, -17.745, 3.271 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.232, "simple_Twist": 33.045, "simple_hRise": 2.993, "simple_hTwist": 33.339 }, { "index": 4, "nt1": "///A/2651", "nt2": "///A/2669", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.186, -0.103, -0.072, 1.461, -17.745, 3.271 ], "step_params": [ -0.133, -1.725, 3.372, -1.242, 8.010, 29.668 ], "heli_params": [ -4.771, 0.016, 2.823, 15.287, 2.371, 30.731 ], "bp2_params": [ 0.285, -0.107, 0.257, -4.322, -8.628, 0.533 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.372, "simple_Twist": 29.294, "simple_hRise": 2.815, "simple_hTwist": 30.371 }, { "index": 5, "nt1": "///A/2652", "nt2": "///A/2668", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 1, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///A/2658", "nt2": "///A/2663", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ], "num_stacks": 5, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "GG", "nts_long": "///A/2648,///A/2673" }, { "index": 2, "num_nts": 3, "nts_short": "UAA", "nts_long": "///A/2660,///A/2661,///A/2662" }, { "index": 3, "num_nts": 4, "nts_short": "CUAU", "nts_long": "///A/2652,///A/2653,///A/2654,///A/2656" }, { "index": 4, "num_nts": 4, "nts_short": "GGGG", "nts_long": "///A/2655,///A/2664,///A/2663,///A/2659" }, { "index": 5, "num_nts": 6, "nts_short": "CAACCG", "nts_long": "///A/2658,///A/2657,///A/2665,///A/2666,///A/2667,///A/2668" } ], "num_atom2bases": 2, "atom2bases": [ { "index": 1, "type": "phosphate", "atom": "///A/2661/OP2", "nt": "///A/2659", "vert_dist": 3.043 }, { "index": 2, "type": "sugar", "atom": "///A/2664/O4'", "nt": "///A/2663", "vert_dist": 3.478 } ], "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ -1 ], "summary": "[1] 4 [A.2658 A.2663] 1", "num_nts": 6, "nts_short": "CGUAAG", "nts_long": "///A/2658,///A/2659,///A/2660,///A/2661,///A/2662,///A/2663", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GUAA", "nts_long": "///A/2659,///A/2660,///A/2661,///A/2662" } ] } ], "num_iloops": 1, "iloops": [ { "index": 1, "type": "asymmetric internal loop", "bridging_nts": [ 5, 4 ], "stem_indices": [ 1, -1 ], "summary": "[2] 5 4 [A.2652 A.2668 A.2658 A.2663] 5 1", "num_nts": 13, "nts_short": "CUAGUACGGACCG", "nts_long": "///A/2652,///A/2653,///A/2654,///A/2655,///A/2656,///A/2657,///A/2658,///A/2663,///A/2664,///A/2665,///A/2666,///A/2667,///A/2668", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 5, "nts_short": "UAGUA", "nts_long": "///A/2653,///A/2654,///A/2655,///A/2656,///A/2657" }, { "index": 2, "num_nts": 4, "nts_short": "GACC", "nts_long": "///A/2664,///A/2665,///A/2666,///A/2667" } ] } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 1, "nts_short": "U", "nts_long": "///A/2647" }, { "index": 2, "num_nts": 1, "nts_short": "G", "nts_long": "///A/2673" } ], "num_splayUnits": 1, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "GU", "nts_long": "///A/2659,///A/2660" } ], "dbn": { "all_chains": { "num_nts": 27, "num_chars": 27, "bseq": "UGCUCCUAGUACGUAAGGACCGGAGUG", "sstr": ".(((((.....(....)....))))).", "form": ".AAAA....A.A.........AAAA.-" }, "chain_A": { "num_nts": 27, "num_chars": 27, "bseq": "UGCUCCUAGUACGUAAGGACCGGAGUG", "sstr": ".(((((.....(....)....))))).", "form": ".AAAA....A.A.........AAAA.-" } }, "chains": { "chain_A": { "num_nts": 27, "bseq": "UGCUCCUAGUACGUAAGGACCGGAGUG", "sstr": ".(((((.....(....)....))))).", "form": ".AAAA....A.A.........AAAA.-", "helical_rise": 0.301, "helical_rise_std": 2.472, "helical_axis": [ 0.200, 0.562, -0.803 ], "point1": [ 4.268, 12.922, 21.569 ], "point2": [ 5.984, 17.744, 14.674 ], "num_chars": 79, "suite": "U1aG1aC1aU1aC1aC1aU5zA4sG#aU1aA1aC1aG1gU1LA1aA1cG1aG1eA1aC1aC1aG1aG1aA1aG1aU!!G" } }, "num_nts": 27, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 2647, "nt_name": "U", "nt_code": "U", "nt_id": "///A/2647", "linked_nts": [ null, "///A/2648" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": null, "beta": null, "gamma": -75.982, "delta": 70.727, "epsilon": -129.786, "zeta": -73.136, "epsilon_zeta": -56.651, "bb_type": "--", "chi": -179.582, "glyco_bond": "anti", "C5prime_xyz": [ -1.373, 8.398, 1.716 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 4.885, "Dp": 4.897, "splay_angle": 33.432, "splay_distance": 4.979, "splay_ratio": 0.289, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 7.537, "v1": -34.535, "v2": 46.226, "v3": -43.812, "v4": 23.051, "amplitude": 46.922, "phase_angle": 9.885, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.011, "origin": [ 22.238, 24.834, 29.670 ], "x_axis": [ 0.716, 0.261, -0.648 ], "y_axis": [ 0.148, -0.963, -0.224 ], "z_axis": [ -0.683, 0.065, -0.728 ], "quaternion": [ -0.078, 0.923, 0.111, -0.360 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2648, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2648", "linked_nts": [ "///A/2647", "///A/2649" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end", "alpha": -33.896, "beta": 161.872, "gamma": 32.027, "delta": 91.865, "epsilon": -144.763, "zeta": -73.074, "epsilon_zeta": -71.689, "bb_type": "BI", "chi": -167.788, "glyco_bond": "anti", "C5prime_xyz": [ -1.369, 8.501, 1.020 ], "P_xyz": [ 1.108, 8.634, 1.736 ], "form": "A", "ssZp": 4.474, "Dp": 4.558, "splay_angle": 22.832, "splay_distance": 3.604, "splay_ratio": 0.199, "d22": null, "d64": null, "eta": 172.090, "theta": -133.253, "eta_prime": -163.513, "theta_prime": -131.240, "eta_base": -97.580, "theta_base": -93.137, "v0": 9.547, "v1": -31.510, "v2": 39.435, "v3": -35.521, "v4": 16.806, "amplitude": 39.605, "phase_angle": 5.305, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.052, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 22.582, 25.813, 24.799 ], "x_axis": [ 0.601, -0.644, -0.473 ], "y_axis": [ -0.496, -0.765, 0.412 ], "z_axis": [ -0.627, -0.013, -0.779 ], "quaternion": [ 0.120, 0.887, -0.321, -0.310 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 2649, "nt_name": "C", "nt_code": "C", "nt_id": "///A/2649", "linked_nts": [ "///A/2648", "///A/2650" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -58.197, "beta": 167.057, "gamma": 47.640, "delta": 84.071, "epsilon": -146.616, "zeta": -77.132, "epsilon_zeta": -69.484, "bb_type": "BI", "chi": -160.499, "glyco_bond": "anti", "C5prime_xyz": [ -1.471, 8.786, 0.498 ], "P_xyz": [ 1.118, 9.168, 0.664 ], "form": "A", "ssZp": 4.415, "Dp": 4.662, "splay_angle": 23.496, "splay_distance": 3.719, "splay_ratio": 0.204, "d22": 3.854, "d64": 3.893, "eta": 162.662, "theta": -140.127, "eta_prime": -177.975, "theta_prime": -138.877, "eta_base": -120.504, "theta_base": -104.829, "v0": 4.046, "v1": -28.257, "v2": 39.878, "v3": -38.405, "v4": 21.921, "amplitude": 40.904, "phase_angle": 12.861, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.665, "filter_rmsd": 0.064, "frame": { "rmsd": 0.019, "origin": [ 22.132, 25.171, 21.282 ], "x_axis": [ 0.127, -0.990, -0.066 ], "y_axis": [ -0.822, -0.142, 0.552 ], "z_axis": [ -0.556, -0.016, -0.831 ], "quaternion": [ 0.196, 0.725, -0.625, -0.214 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 2650, "nt_name": "U", "nt_code": "U", "nt_id": "///A/2650", "linked_nts": [ "///A/2649", "///A/2651" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -64.173, "beta": 164.156, "gamma": 60.346, "delta": 79.816, "epsilon": -154.481, "zeta": -73.112, "epsilon_zeta": -81.369, "bb_type": "BI", "chi": -167.171, "glyco_bond": "anti", "C5prime_xyz": [ -1.672, 8.763, 0.661 ], "P_xyz": [ 0.972, 9.197, 0.616 ], "form": "A", "ssZp": 4.403, "Dp": 4.550, "splay_angle": 21.631, "splay_distance": 3.457, "splay_ratio": 0.190, "d22": 4.500, "d64": 4.364, "eta": 167.021, "theta": -148.307, "eta_prime": -174.531, "theta_prime": -150.067, "eta_base": -122.643, "theta_base": -127.889, "v0": -2.370, "v1": -25.478, "v2": 41.862, "v3": -44.048, "v4": 29.417, "amplitude": 44.946, "phase_angle": 21.348, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.875, "filter_rmsd": 0.097, "frame": { "rmsd": 0.019, "origin": [ 21.184, 23.371, 18.168 ], "x_axis": [ -0.320, -0.861, 0.395 ], "y_axis": [ -0.779, 0.476, 0.408 ], "z_axis": [ -0.539, -0.177, -0.823 ], "quaternion": [ -0.288, -0.507, 0.809, 0.071 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 2651, "nt_name": "C", "nt_code": "C", "nt_id": "///A/2651", "linked_nts": [ "///A/2650", "///A/2652" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -62.279, "beta": 173.768, "gamma": 46.172, "delta": 84.344, "epsilon": -154.579, "zeta": -71.341, "epsilon_zeta": -83.238, "bb_type": "BI", "chi": -159.016, "glyco_bond": "anti", "C5prime_xyz": [ -1.447, 8.777, 0.252 ], "P_xyz": [ 1.125, 9.298, 0.363 ], "form": "A", "ssZp": 4.287, "Dp": 4.577, "splay_angle": 24.060, "splay_distance": 3.895, "splay_ratio": 0.212, "d22": 4.151, "d64": 4.427, "eta": 165.418, "theta": -147.237, "eta_prime": 177.637, "theta_prime": -145.632, "eta_base": -144.323, "theta_base": -123.941, "v0": 4.846, "v1": -32.452, "v2": 45.711, "v3": -44.578, "v4": 25.024, "amplitude": 46.901, "phase_angle": 12.932, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.871, "filter_rmsd": 0.064, "frame": { "rmsd": 0.024, "origin": [ 20.545, 21.623, 15.255 ], "x_axis": [ -0.657, -0.478, 0.583 ], "y_axis": [ -0.558, 0.828, 0.052 ], "z_axis": [ -0.508, -0.291, -0.811 ], "quaternion": [ -0.300, -0.285, 0.908, -0.066 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 2652, "nt_name": "C", "nt_code": "C", "nt_id": "///A/2652", "linked_nts": [ "///A/2651", "///A/2653" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -67.493, "beta": 175.181, "gamma": 58.124, "delta": 77.984, "epsilon": -153.954, "zeta": -67.015, "epsilon_zeta": -86.939, "bb_type": "BI", "chi": -158.794, "glyco_bond": "anti", "C5prime_xyz": [ -1.774, 8.862, 0.430 ], "P_xyz": [ 0.779, 9.500, 0.623 ], "form": ".", "ssZp": 4.282, "Dp": 4.526, "splay_angle": 22.842, "splay_distance": 3.601, "splay_ratio": 0.198, "d22": 3.989, "d64": 3.828, "eta": 171.269, "theta": -141.970, "eta_prime": -176.343, "theta_prime": -139.265, "eta_base": -142.023, "theta_base": -91.528, "v0": 2.933, "v1": -29.711, "v2": 43.784, "v3": -44.031, "v4": 25.940, "amplitude": 45.433, "phase_angle": 15.483, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.919, "filter_rmsd": 0.063, "frame": { "rmsd": 0.032, "origin": [ 18.930, 18.849, 13.049 ], "x_axis": [ -0.723, 0.042, 0.690 ], "y_axis": [ -0.201, 0.942, -0.267 ], "z_axis": [ -0.661, -0.332, -0.673 ], "quaternion": [ -0.370, -0.044, 0.914, -0.164 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 2653, "nt_name": "U", "nt_code": "U", "nt_id": "///A/2653", "linked_nts": [ "///A/2652", "///A/2654" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -61.758, "beta": 167.392, "gamma": 55.882, "delta": 82.358, "epsilon": -149.397, "zeta": 55.331, "epsilon_zeta": 155.272, "bb_type": "--", "chi": -151.015, "glyco_bond": "anti", "C5prime_xyz": [ -1.468, 8.809, -0.148 ], "P_xyz": [ 1.146, 9.111, -0.452 ], "form": ".", "ssZp": 3.998, "Dp": 4.621, "splay_angle": 22.568, "splay_distance": 3.586, "splay_ratio": 0.197, "d22": null, "d64": null, "eta": 172.244, "theta": -18.303, "eta_prime": -169.962, "theta_prime": -63.348, "eta_base": -107.899, "theta_base": -99.072, "v0": 1.595, "v1": -28.212, "v2": 42.323, "v3": -41.322, "v4": 25.221, "amplitude": 43.973, "phase_angle": 15.750, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.929, "filter_rmsd": 0.095, "frame": { "rmsd": 0.019, "origin": [ 15.434, 18.008, 12.856 ], "x_axis": [ -0.691, 0.661, 0.293 ], "y_axis": [ 0.204, 0.566, -0.799 ], "z_axis": [ -0.694, -0.492, -0.526 ], "quaternion": [ -0.296, 0.259, 0.834, -0.387 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 2654, "nt_name": "A", "nt_code": "A", "nt_id": "///A/2654", "linked_nts": [ "///A/2653", "///A/2655" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 165.233, "beta": 133.819, "gamma": 56.698, "delta": 149.401, "epsilon": -98.344, "zeta": 161.352, "epsilon_zeta": 100.303, "bb_type": "BII", "chi": -145.331, "glyco_bond": "anti", "C5prime_xyz": [ -2.007, 8.820, -0.085 ], "P_xyz": [ 0.552, 8.859, 0.521 ], "form": ".", "ssZp": 0.914, "Dp": 0.916, "splay_angle": 43.081, "splay_distance": 7.237, "splay_ratio": 0.367, "d22": null, "d64": null, "eta": 46.283, "theta": 172.017, "eta_prime": 120.499, "theta_prime": 135.581, "eta_base": 126.406, "theta_base": 150.349, "v0": -33.231, "v1": 44.290, "v2": -38.722, "v3": 20.051, "v4": 8.460, "amplitude": 44.253, "phase_angle": 151.048, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "5z", "suiteness": 0.849, "filter_rmsd": 0.038, "frame": { "rmsd": 0.019, "origin": [ 12.098, 18.165, 11.549 ], "x_axis": [ 0.602, -0.783, 0.153 ], "y_axis": [ 0.364, 0.099, -0.926 ], "z_axis": [ 0.710, 0.613, 0.345 ], "quaternion": [ 0.715, -0.538, 0.195, -0.401 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 2655, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2655", "linked_nts": [ "///A/2654", "///A/2656" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop", "alpha": -96.236, "beta": 91.744, "gamma": 179.322, "delta": 149.324, "epsilon": -167.208, "zeta": 141.405, "epsilon_zeta": 51.387, "bb_type": "--", "chi": -93.468, "glyco_bond": "anti", "C5prime_xyz": [ -3.296, 7.861, -2.277 ], "P_xyz": [ -4.505, 7.494, -4.631 ], "form": ".", "ssZp": 2.147, "Dp": 2.142, "splay_angle": 54.212, "splay_distance": 8.086, "splay_ratio": 0.457, "d22": null, "d64": null, "eta": -44.156, "theta": 24.896, "eta_prime": -82.279, "theta_prime": 58.970, "eta_base": -98.612, "theta_base": 91.338, "v0": -37.334, "v1": 50.130, "v2": -43.908, "v3": 22.935, "v4": 8.915, "amplitude": 49.974, "phase_angle": 151.477, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "22t", "cluster": "4s", "suiteness": 0.730, "filter_rmsd": 0.022, "frame": { "rmsd": 0.022, "origin": [ 5.554, 21.195, 10.937 ], "x_axis": [ -0.668, 0.660, 0.343 ], "y_axis": [ -0.030, 0.437, -0.899 ], "z_axis": [ -0.744, -0.611, -0.272 ], "quaternion": [ -0.353, 0.204, 0.771, -0.490 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 2656, "nt_name": "U", "nt_code": "U", "nt_id": "///A/2656", "linked_nts": [ "///A/2655", "///A/2657" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate", "alpha": -72.528, "beta": 157.795, "gamma": 37.868, "delta": 91.634, "epsilon": -140.967, "zeta": -65.561, "epsilon_zeta": -75.407, "bb_type": "BI", "chi": -173.859, "glyco_bond": "anti", "C5prime_xyz": [ -1.529, 8.414, 1.363 ], "P_xyz": [ 0.930, 8.199, 2.276 ], "form": "A", "ssZp": 4.352, "Dp": 4.423, "splay_angle": 27.392, "splay_distance": 4.431, "splay_ratio": 0.240, "d22": null, "d64": null, "eta": 170.891, "theta": -121.700, "eta_prime": 163.113, "theta_prime": -122.716, "eta_base": 161.882, "theta_base": -94.787, "v0": 12.691, "v1": -32.874, "v2": 39.592, "v3": -33.162, "v4": 13.315, "amplitude": 39.593, "phase_angle": 0.429, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "#a", "suiteness": 0.842, "filter_rmsd": 0.099, "frame": { "rmsd": 0.020, "origin": [ 10.915, 15.474, 8.959 ], "x_axis": [ -0.686, 0.517, 0.512 ], "y_axis": [ -0.154, 0.585, -0.796 ], "z_axis": [ -0.711, -0.625, -0.322 ], "quaternion": [ -0.380, 0.113, 0.805, -0.441 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 2657, "nt_name": "A", "nt_code": "A", "nt_id": "///A/2657", "linked_nts": [ "///A/2656", "///A/2658" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -68.731, "beta": 174.511, "gamma": 50.163, "delta": 83.706, "epsilon": -145.098, "zeta": -61.146, "epsilon_zeta": -83.952, "bb_type": "BI", "chi": -171.098, "glyco_bond": "anti", "C5prime_xyz": [ -1.950, 8.726, 1.058 ], "P_xyz": [ 0.490, 9.419, 1.765 ], "form": ".", "ssZp": 4.488, "Dp": 4.521, "splay_angle": 32.912, "splay_distance": 5.108, "splay_ratio": 0.284, "d22": null, "d64": null, "eta": 162.113, "theta": -127.401, "eta_prime": -177.669, "theta_prime": -123.187, "eta_base": -126.942, "theta_base": -67.015, "v0": -6.422, "v1": -21.700, "v2": 39.923, "v3": -44.452, "v4": 32.033, "amplitude": 44.602, "phase_angle": 26.480, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.693, "filter_rmsd": 0.056, "frame": { "rmsd": 0.023, "origin": [ 7.235, 13.046, 9.397 ], "x_axis": [ -0.570, 0.819, -0.071 ], "y_axis": [ 0.415, 0.212, -0.885 ], "z_axis": [ -0.710, -0.534, -0.460 ], "quaternion": [ -0.213, 0.412, 0.749, -0.474 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 2658, "nt_name": "C", "nt_code": "C", "nt_id": "///A/2658", "linked_nts": [ "///A/2657", "///A/2659" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,internal-loop", "alpha": -72.025, "beta": 172.711, "gamma": 51.466, "delta": 84.042, "epsilon": -151.766, "zeta": -62.875, "epsilon_zeta": -88.891, "bb_type": "BI", "chi": -165.496, "glyco_bond": "anti", "C5prime_xyz": [ -1.394, 8.768, 0.699 ], "P_xyz": [ 1.221, 9.076, 0.763 ], "form": "A", "ssZp": 4.487, "Dp": 4.701, "splay_angle": 26.734, "splay_distance": 4.289, "splay_ratio": 0.235, "d22": null, "d64": null, "eta": 159.429, "theta": -135.315, "eta_prime": -176.037, "theta_prime": -135.371, "eta_base": -98.166, "theta_base": -106.454, "v0": -0.040, "v1": -28.482, "v2": 44.618, "v3": -44.445, "v4": 28.389, "amplitude": 46.891, "phase_angle": 17.915, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.884, "filter_rmsd": 0.060, "frame": { "rmsd": 0.013, "origin": [ 3.317, 14.674, 6.553 ], "x_axis": [ 0.114, 0.599, -0.793 ], "y_axis": [ 0.655, -0.645, -0.393 ], "z_axis": [ -0.747, -0.474, -0.466 ], "quaternion": [ 0.027, 0.746, 0.420, -0.516 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 2659, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2659", "linked_nts": [ "///A/2658", "///A/2660" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,splayed-apart", "alpha": -71.797, "beta": -179.432, "gamma": 49.417, "delta": 80.935, "epsilon": -135.674, "zeta": -64.438, "epsilon_zeta": -71.237, "bb_type": "BI", "chi": -172.864, "glyco_bond": "anti", "C5prime_xyz": [ -1.646, 8.703, 1.045 ], "P_xyz": [ 0.857, 9.396, 1.229 ], "form": ".", "ssZp": 4.758, "Dp": 4.946, "splay_angle": 95.333, "splay_distance": 13.168, "splay_ratio": 0.739, "d22": null, "d64": null, "eta": 167.595, "theta": -117.701, "eta_prime": -179.401, "theta_prime": -160.644, "eta_base": -134.103, "theta_base": 156.867, "v0": -9.430, "v1": -20.595, "v2": 40.133, "v3": -45.312, "v4": 35.509, "amplitude": 46.075, "phase_angle": 29.420, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.894, "filter_rmsd": 0.033, "frame": { "rmsd": 0.033, "origin": [ 0.219, 15.029, 3.609 ], "x_axis": [ 0.601, 0.180, -0.779 ], "y_axis": [ 0.466, -0.870, 0.159 ], "z_axis": [ -0.649, -0.459, -0.607 ], "quaternion": [ 0.176, 0.877, 0.184, -0.407 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 2660, "nt_name": "U", "nt_code": "U", "nt_id": "///A/2660", "linked_nts": [ "///A/2659", "///A/2661" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart", "alpha": 166.226, "beta": 136.321, "gamma": 51.817, "delta": 88.966, "epsilon": -124.280, "zeta": -88.060, "epsilon_zeta": -36.220, "bb_type": "--", "chi": -157.276, "glyco_bond": "anti", "C5prime_xyz": [ -1.999, 8.880, 0.058 ], "P_xyz": [ 0.680, 9.088, 0.199 ], "form": ".", "ssZp": 3.510, "Dp": 3.951, "splay_angle": 27.583, "splay_distance": 4.628, "splay_ratio": 0.251, "d22": null, "d64": null, "eta": 15.080, "theta": -126.132, "eta_prime": 43.455, "theta_prime": -124.945, "eta_base": 20.952, "theta_base": -65.176, "v0": -8.918, "v1": -14.612, "v2": 31.261, "v3": -37.449, "v4": 29.015, "amplitude": 36.975, "phase_angle": 32.278, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.736, "filter_rmsd": 0.099, "frame": { "rmsd": 0.020, "origin": [ -9.426, 6.638, 6.764 ], "x_axis": [ 0.339, -0.609, 0.717 ], "y_axis": [ 0.905, 0.003, -0.425 ], "z_axis": [ 0.256, 0.793, 0.552 ], "quaternion": [ 0.688, -0.443, -0.167, -0.550 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 2661, "nt_name": "A", "nt_code": "A", "nt_id": "///A/2661", "linked_nts": [ "///A/2660", "///A/2662" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate", "alpha": -63.571, "beta": 139.702, "gamma": 65.553, "delta": 89.305, "epsilon": -148.660, "zeta": -74.776, "epsilon_zeta": -73.884, "bb_type": "BI", "chi": -130.900, "glyco_bond": "anti", "C5prime_xyz": [ -1.635, 8.587, -1.067 ], "P_xyz": [ 0.817, 8.208, -2.071 ], "form": ".", "ssZp": 3.088, "Dp": 4.236, "splay_angle": 24.885, "splay_distance": 4.179, "splay_ratio": 0.226, "d22": null, "d64": null, "eta": 160.382, "theta": -132.004, "eta_prime": -169.352, "theta_prime": -138.679, "eta_base": -95.794, "theta_base": -93.344, "v0": 7.247, "v1": -28.683, "v2": 38.254, "v3": -34.956, "v4": 17.541, "amplitude": 38.631, "phase_angle": 8.010, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.688, "filter_rmsd": 0.035, "frame": { "rmsd": 0.015, "origin": [ -5.444, 7.716, 8.861 ], "x_axis": [ 0.930, -0.359, 0.077 ], "y_axis": [ 0.325, 0.708, -0.627 ], "z_axis": [ 0.171, 0.608, 0.776 ], "quaternion": [ 0.924, -0.334, 0.025, -0.185 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 2662, "nt_name": "A", "nt_code": "A", "nt_id": "///A/2662", "linked_nts": [ "///A/2661", "///A/2663" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate", "alpha": -65.449, "beta": 164.553, "gamma": 51.392, "delta": 89.520, "epsilon": -135.376, "zeta": -65.824, "epsilon_zeta": -69.552, "bb_type": "BI", "chi": -130.898, "glyco_bond": "anti", "C5prime_xyz": [ -1.463, 8.418, -1.338 ], "P_xyz": [ 1.053, 8.235, -2.124 ], "form": ".", "ssZp": 2.705, "Dp": 4.682, "splay_angle": 44.814, "splay_distance": 7.741, "splay_ratio": 0.383, "d22": null, "d64": null, "eta": 167.009, "theta": -83.019, "eta_prime": -174.804, "theta_prime": -81.675, "eta_base": -116.966, "theta_base": -64.236, "v0": 0.011, "v1": -21.085, "v2": 32.934, "v3": -33.877, "v4": 21.432, "amplitude": 34.759, "phase_angle": 18.652, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.692, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ -2.256, 10.164, 10.005 ], "x_axis": [ 0.855, 0.136, -0.501 ], "y_axis": [ -0.307, 0.910, -0.278 ], "z_axis": [ 0.418, 0.392, 0.820 ], "quaternion": [ 0.947, -0.177, 0.243, 0.117 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 2663, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2663", "linked_nts": [ "///A/2662", "///A/2664" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,internal-loop,cap-acceptor", "alpha": 145.714, "beta": -139.817, "gamma": -168.753, "delta": 82.681, "epsilon": -146.022, "zeta": -59.616, "epsilon_zeta": -86.407, "bb_type": "BI", "chi": -170.941, "glyco_bond": "anti", "C5prime_xyz": [ -1.766, 8.717, 0.991 ], "P_xyz": [ -1.010, 10.450, -0.770 ], "form": ".", "ssZp": 4.709, "Dp": 4.823, "splay_angle": 35.714, "splay_distance": 5.498, "splay_ratio": 0.308, "d22": null, "d64": null, "eta": 172.592, "theta": -153.979, "eta_prime": -148.158, "theta_prime": -148.598, "eta_base": -101.150, "theta_base": -96.995, "v0": -7.931, "v1": -22.696, "v2": 42.303, "v3": -47.281, "v4": 35.699, "amplitude": 47.757, "phase_angle": 27.652, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.321, "filter_rmsd": 0.019, "frame": { "rmsd": 0.019, "origin": [ 3.172, 14.392, 6.457 ], "x_axis": [ 0.149, 0.645, -0.750 ], "y_axis": [ -0.740, 0.575, 0.348 ], "z_axis": [ 0.656, 0.503, 0.563 ], "quaternion": [ 0.756, -0.051, 0.465, 0.458 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 2664, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2664", "linked_nts": [ "///A/2663", "///A/2665" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-donor", "alpha": -61.434, "beta": 173.115, "gamma": 52.290, "delta": 77.568, "epsilon": -159.051, "zeta": -80.796, "epsilon_zeta": -78.255, "bb_type": "BI", "chi": -162.774, "glyco_bond": "anti", "C5prime_xyz": [ -1.294, 8.739, 0.633 ], "P_xyz": [ 1.335, 9.093, 0.647 ], "form": ".", "ssZp": 4.478, "Dp": 4.634, "splay_angle": 74.595, "splay_distance": 11.741, "splay_ratio": 0.612, "d22": null, "d64": null, "eta": 166.177, "theta": 166.894, "eta_prime": -168.925, "theta_prime": 147.369, "eta_base": -95.473, "theta_base": 137.886, "v0": 7.399, "v1": -33.596, "v2": 45.859, "v3": -43.096, "v4": 22.106, "amplitude": 46.529, "phase_angle": 9.732, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.878, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 4.904, 19.416, 5.044 ], "x_axis": [ -0.598, 0.796, -0.098 ], "y_axis": [ -0.406, -0.194, 0.893 ], "z_axis": [ 0.691, 0.574, 0.439 ], "quaternion": [ 0.402, 0.199, 0.491, 0.747 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 2665, "nt_name": "A", "nt_code": "A", "nt_id": "///A/2665", "linked_nts": [ "///A/2664", "///A/2666" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate", "alpha": -100.937, "beta": 72.349, "gamma": 170.409, "delta": 85.507, "epsilon": -153.249, "zeta": -77.235, "epsilon_zeta": -76.014, "bb_type": "BI", "chi": -179.053, "glyco_bond": "anti", "C5prime_xyz": [ -1.007, 8.211, 1.542 ], "P_xyz": [ -1.528, 10.532, 0.283 ], "form": ".", "ssZp": 4.736, "Dp": 4.749, "splay_angle": 25.770, "splay_distance": 4.017, "splay_ratio": 0.233, "d22": null, "d64": null, "eta": -155.633, "theta": 141.611, "eta_prime": 175.004, "theta_prime": 164.284, "eta_base": 154.705, "theta_base": -178.622, "v0": 11.209, "v1": -35.620, "v2": 45.245, "v3": -39.615, "v4": 18.071, "amplitude": 45.382, "phase_angle": 4.458, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1e", "suiteness": 0.875, "filter_rmsd": 0.040, "frame": { "rmsd": 0.014, "origin": [ 13.078, 11.706, 8.448 ], "x_axis": [ 0.266, 0.570, -0.778 ], "y_axis": [ -0.587, 0.736, 0.338 ], "z_axis": [ 0.765, 0.366, 0.530 ], "quaternion": [ 0.795, -0.009, 0.485, 0.363 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 2666, "nt_name": "C", "nt_code": "C", "nt_id": "///A/2666", "linked_nts": [ "///A/2665", "///A/2667" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": -58.856, "beta": 171.741, "gamma": 58.475, "delta": 80.604, "epsilon": -139.379, "zeta": -61.182, "epsilon_zeta": -78.197, "bb_type": "BI", "chi": -165.329, "glyco_bond": "anti", "C5prime_xyz": [ -1.418, 8.728, 0.855 ], "P_xyz": [ 1.169, 9.102, 0.902 ], "form": ".", "ssZp": 4.571, "Dp": 4.738, "splay_angle": 32.109, "splay_distance": 4.972, "splay_ratio": 0.277, "d22": 3.544, "d64": 3.797, "eta": -178.401, "theta": -125.253, "eta_prime": -168.954, "theta_prime": -122.986, "eta_base": -153.915, "theta_base": -74.820, "v0": 1.998, "v1": -27.624, "v2": 41.161, "v3": -41.228, "v4": 24.638, "amplitude": 42.813, "phase_angle": 15.966, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.891, "filter_rmsd": 0.068, "frame": { "rmsd": 0.016, "origin": [ 16.665, 10.197, 9.446 ], "x_axis": [ 0.150, 0.824, -0.547 ], "y_axis": [ -0.557, 0.527, 0.642 ], "z_axis": [ 0.817, 0.208, 0.537 ], "quaternion": [ 0.744, 0.146, 0.458, 0.464 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 2667, "nt_name": "C", "nt_code": "C", "nt_id": "///A/2667", "linked_nts": [ "///A/2666", "///A/2668" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -61.883, "beta": 166.761, "gamma": 51.177, "delta": 82.100, "epsilon": -138.507, "zeta": -56.671, "epsilon_zeta": -81.836, "bb_type": "BI", "chi": -165.683, "glyco_bond": "anti", "C5prime_xyz": [ -1.253, 8.682, 0.792 ], "P_xyz": [ 1.381, 8.970, 0.764 ], "form": ".", "ssZp": 4.532, "Dp": 4.793, "splay_angle": 37.344, "splay_distance": 5.701, "splay_ratio": 0.321, "d22": null, "d64": null, "eta": 164.567, "theta": -120.707, "eta_prime": -172.888, "theta_prime": -116.046, "eta_base": -101.551, "theta_base": -71.599, "v0": 1.870, "v1": -30.711, "v2": 45.696, "v3": -45.978, "v4": 28.167, "amplitude": 47.650, "phase_angle": 16.465, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.887, "filter_rmsd": 0.064, "frame": { "rmsd": 0.029, "origin": [ 19.216, 14.463, 9.543 ], "x_axis": [ -0.455, 0.873, 0.175 ], "y_axis": [ -0.352, -0.357, 0.865 ], "z_axis": [ 0.818, 0.332, 0.470 ], "quaternion": [ 0.406, 0.329, 0.396, 0.755 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 2668, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2668", "linked_nts": [ "///A/2667", "///A/2669" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop", "alpha": -65.334, "beta": 169.316, "gamma": 57.921, "delta": 74.750, "epsilon": -148.636, "zeta": -79.712, "epsilon_zeta": -68.924, "bb_type": "BI", "chi": -167.211, "glyco_bond": "anti", "C5prime_xyz": [ -1.164, 8.620, 1.021 ], "P_xyz": [ 1.454, 8.885, 1.049 ], "form": "A", "ssZp": 4.589, "Dp": 4.729, "splay_angle": 24.021, "splay_distance": 3.690, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 164.898, "theta": -150.023, "eta_prime": -168.406, "theta_prime": -145.796, "eta_base": -97.396, "theta_base": -120.166, "v0": 9.120, "v1": -34.395, "v2": 44.361, "v3": -40.892, "v4": 20.047, "amplitude": 44.720, "phase_angle": 7.273, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.756, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 19.277, 19.023, 12.964 ], "x_axis": [ -0.615, 0.088, 0.784 ], "y_axis": [ 0.260, -0.916, 0.306 ], "z_axis": [ 0.745, 0.392, 0.540 ], "quaternion": [ -0.049, 0.436, 0.199, 0.876 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 2669, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2669", "linked_nts": [ "///A/2668", "///A/2670" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -47.572, "beta": 158.228, "gamma": 54.610, "delta": 77.513, "epsilon": -153.498, "zeta": -66.035, "epsilon_zeta": -87.463, "bb_type": "BI", "chi": -168.493, "glyco_bond": "anti", "C5prime_xyz": [ -1.481, 8.661, 1.048 ], "P_xyz": [ 1.231, 8.906, 1.057 ], "form": "A", "ssZp": 4.587, "Dp": 4.651, "splay_angle": 24.400, "splay_distance": 3.811, "splay_ratio": 0.215, "d22": null, "d64": null, "eta": 171.276, "theta": -139.764, "eta_prime": -172.828, "theta_prime": -139.548, "eta_base": -131.722, "theta_base": -111.747, "v0": 4.520, "v1": -31.333, "v2": 45.059, "v3": -43.505, "v4": 24.445, "amplitude": 46.250, "phase_angle": 13.032, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.625, "filter_rmsd": 0.020, "frame": { "rmsd": 0.020, "origin": [ 20.546, 21.766, 15.081 ], "x_axis": [ -0.437, -0.416, 0.798 ], "y_axis": [ 0.574, -0.812, -0.109 ], "z_axis": [ 0.693, 0.410, 0.593 ], "quaternion": [ -0.293, 0.442, 0.089, 0.843 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 2670, "nt_name": "A", "nt_code": "A", "nt_id": "///A/2670", "linked_nts": [ "///A/2669", "///A/2671" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -66.159, "beta": 171.432, "gamma": 58.080, "delta": 80.685, "epsilon": -148.900, "zeta": -83.066, "epsilon_zeta": -65.834, "bb_type": "BI", "chi": -165.481, "glyco_bond": "anti", "C5prime_xyz": [ -1.669, 8.661, 0.861 ], "P_xyz": [ 0.906, 9.114, 1.076 ], "form": "A", "ssZp": 4.442, "Dp": 4.574, "splay_angle": 22.814, "splay_distance": 3.543, "splay_ratio": 0.200, "d22": null, "d64": null, "eta": 170.631, "theta": -153.195, "eta_prime": -173.835, "theta_prime": -152.741, "eta_base": -127.229, "theta_base": -132.016, "v0": 5.286, "v1": -32.851, "v2": 46.747, "v3": -45.266, "v4": 25.055, "amplitude": 47.903, "phase_angle": 12.609, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.914, "filter_rmsd": 0.034, "frame": { "rmsd": 0.019, "origin": [ 21.271, 23.583, 18.352 ], "x_axis": [ -0.062, -0.829, 0.556 ], "y_axis": [ 0.748, -0.407, -0.524 ], "z_axis": [ 0.661, 0.384, 0.645 ], "quaternion": [ 0.542, -0.418, 0.048, -0.727 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 2671, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2671", "linked_nts": [ "///A/2670", "///A/2672" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem", "alpha": -63.255, "beta": 167.467, "gamma": 56.501, "delta": 82.009, "epsilon": -151.205, "zeta": -63.892, "epsilon_zeta": -87.313, "bb_type": "BI", "chi": -163.679, "glyco_bond": "anti", "C5prime_xyz": [ -1.493, 8.655, 0.779 ], "P_xyz": [ 1.103, 9.027, 0.802 ], "form": "A", "ssZp": 4.474, "Dp": 4.616, "splay_angle": 22.800, "splay_distance": 3.638, "splay_ratio": 0.201, "d22": null, "d64": null, "eta": 170.410, "theta": -134.447, "eta_prime": -179.964, "theta_prime": -133.060, "eta_base": -147.090, "theta_base": -94.683, "v0": 7.566, "v1": -33.230, "v2": 44.596, "v3": -41.381, "v4": 21.653, "amplitude": 45.177, "phase_angle": 9.203, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.878, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 21.997, 25.240, 21.399 ], "x_axis": [ 0.262, -0.949, 0.175 ], "y_axis": [ 0.729, 0.076, -0.680 ], "z_axis": [ 0.632, 0.306, 0.712 ], "quaternion": [ 0.716, -0.344, 0.160, -0.586 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 2672, "nt_name": "U", "nt_code": "U", "nt_id": "///A/2672", "linked_nts": [ "///A/2671", "///A/2673" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end", "alpha": -60.296, "beta": 168.371, "gamma": 54.698, "delta": 85.108, "epsilon": -154.470, "zeta": -92.377, "epsilon_zeta": -62.094, "bb_type": "BI", "chi": -152.805, "glyco_bond": "anti", "C5prime_xyz": [ -1.690, 8.794, 0.111 ], "P_xyz": [ 0.909, 9.340, 0.199 ], "form": ".", "ssZp": 4.001, "Dp": 4.367, "splay_angle": 27.527, "splay_distance": 4.411, "splay_ratio": 0.238, "d22": null, "d64": null, "eta": 172.240, "theta": -167.888, "eta_prime": -166.607, "theta_prime": -170.649, "eta_base": -110.580, "theta_base": -171.560, "v0": -0.319, "v1": -23.035, "v2": 35.931, "v3": -37.553, "v4": 23.610, "amplitude": 38.041, "phase_angle": 19.171, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.912, "filter_rmsd": 0.101, "frame": { "rmsd": 0.024, "origin": [ 23.847, 23.814, 24.188 ], "x_axis": [ 0.658, -0.671, -0.343 ], "y_axis": [ 0.479, 0.724, -0.497 ], "z_axis": [ 0.581, 0.163, 0.797 ], "quaternion": [ 0.891, -0.185, 0.259, -0.322 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 2673, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2673", "linked_nts": [ "///A/2672", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop", "alpha": -47.492, "beta": -171.109, "gamma": 14.608, "delta": 88.086, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -141.929, "glyco_bond": "anti", "C5prime_xyz": [ -0.824, 8.431, -0.560 ], "P_xyz": [ 1.653, 9.137, -0.193 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 17.131, "v1": -39.613, "v2": 45.361, "v3": -37.060, "v4": 12.871, "amplitude": 45.415, "phase_angle": 357.206, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 23.278, 24.971, 28.406 ], "x_axis": [ 0.666, -0.481, -0.570 ], "y_axis": [ 0.382, 0.877, -0.292 ], "z_axis": [ 0.640, -0.023, 0.768 ], "quaternion": [ 0.910, -0.074, 0.333, -0.237 ] } } ], "num_hbonds": 40, "hbonds": [ { "index": 1, "atom1_serNum": 15, "atom2_serNum": 578, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/2647/O4", "atom2_id": "///A/2673/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 35, "atom2_serNum": 555, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/2648/O6", "atom2_id": "///A/2672/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 36, "atom2_serNum": 554, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///A/2648/N1", "atom2_id": "///A/2672/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 55, "atom2_serNum": 537, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/2649/O2", "atom2_id": "///A/2671/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 56, "atom2_serNum": 535, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/2649/N3", "atom2_id": "///A/2671/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 58, "atom2_serNum": 534, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///A/2649/N4", "atom2_id": "///A/2671/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 76, "atom2_serNum": 513, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/2650/N3", "atom2_id": "///A/2670/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 78, "atom2_serNum": 512, "donAcc_type": "standard", "distance": 3.129, "atom1_id": "///A/2650/O4", "atom2_id": "///A/2670/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 95, "atom2_serNum": 492, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///A/2651/O2", "atom2_id": "///A/2669/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 96, "atom2_serNum": 490, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/2651/N3", "atom2_id": "///A/2669/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 98, "atom2_serNum": 489, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/2651/N4", "atom2_id": "///A/2669/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 115, "atom2_serNum": 466, "donAcc_type": "standard", "distance": 2.817, "atom1_id": "///A/2652/O2", "atom2_id": "///A/2668/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 116, "atom2_serNum": 464, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/2652/N3", "atom2_id": "///A/2668/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 118, "atom2_serNum": 463, "donAcc_type": "standard", "distance": 2.897, "atom1_id": "///A/2652/N4", "atom2_id": "///A/2668/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 123, "atom2_serNum": 151, "donAcc_type": "acceptable", "distance": 2.622, "atom1_id": "///A/2653/OP2", "atom2_id": "///A/2654/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 135, "atom2_serNum": 443, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/2653/O2", "atom2_id": "///A/2667/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 147, "atom2_serNum": 192, "donAcc_type": "questionable", "distance": 3.054, "atom1_id": "///A/2654/O4'", "atom2_id": "///A/2656/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 158, "atom2_serNum": 408, "donAcc_type": "standard", "distance": 2.960, "atom1_id": "///A/2654/N6", "atom2_id": "///A/2666/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 173, "atom2_serNum": 188, "donAcc_type": "acceptable", "distance": 2.923, "atom1_id": "///A/2655/O2'", "atom2_id": "///A/2656/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 173, "atom2_serNum": 378, "donAcc_type": "acceptable", "distance": 3.093, "atom1_id": "///A/2655/O2'", "atom2_id": "///A/2664/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 173, "atom2_serNum": 379, "donAcc_type": "acceptable", "distance": 3.343, "atom1_id": "///A/2655/O2'", "atom2_id": "///A/2664/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 181, "atom2_serNum": 386, "donAcc_type": "standard", "distance": 2.768, "atom1_id": "///A/2655/N1", "atom2_id": "///A/2665/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 183, "atom2_serNum": 203, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/2655/N2", "atom2_id": "///A/2656/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 183, "atom2_serNum": 387, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/2655/N2", "atom2_id": "///A/2665/O5'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 188, "atom2_serNum": 379, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/2656/OP2", "atom2_id": "///A/2664/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 188, "atom2_serNum": 381, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/2656/OP2", "atom2_id": "///A/2664/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 200, "atom2_serNum": 401, "donAcc_type": "standard", "distance": 3.122, "atom1_id": "///A/2656/O2", "atom2_id": "///A/2665/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 201, "atom2_serNum": 398, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/2656/N3", "atom2_id": "///A/2665/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 220, "atom2_serNum": 381, "donAcc_type": "standard", "distance": 3.035, "atom1_id": "///A/2657/N7", "atom2_id": "///A/2664/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 223, "atom2_serNum": 371, "donAcc_type": "acceptable", "distance": 2.963, "atom1_id": "///A/2657/N6", "atom2_id": "///A/2664/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 223, "atom2_serNum": 382, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/2657/N6", "atom2_id": "///A/2664/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 242, "atom2_serNum": 358, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/2658/O2", "atom2_id": "///A/2663/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 243, "atom2_serNum": 356, "donAcc_type": "standard", "distance": 2.890, "atom1_id": "///A/2658/N3", "atom2_id": "///A/2663/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 245, "atom2_serNum": 355, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/2658/N4", "atom2_id": "///A/2663/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 258, "atom2_serNum": 305, "donAcc_type": "acceptable", "distance": 2.604, "atom1_id": "///A/2659/O2'", "atom2_id": "///A/2661/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 258, "atom2_serNum": 308, "donAcc_type": "acceptable", "distance": 3.264, "atom1_id": "///A/2659/O2'", "atom2_id": "///A/2661/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 268, "atom2_serNum": 315, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/2659/N2", "atom2_id": "///A/2662/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 268, "atom2_serNum": 327, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/2659/N2", "atom2_id": "///A/2662/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 371, "atom2_serNum": 390, "donAcc_type": "acceptable", "distance": 2.751, "atom1_id": "///A/2664/O2'", "atom2_id": "///A/2665/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 550, "atom2_serNum": 566, "donAcc_type": "acceptable", "distance": 3.372, "atom1_id": "///A/2672/O2'", "atom2_id": "///A/2673/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1msy", "num_naChains": 1, "naChains": "A=27", "num_atoms": 685, "num_waters": 109, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 17, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 7, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 8, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 9, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 10, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 11, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 12, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 13, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 14, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 15, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }