{ "num_pairs": 33, "pairs": [ { "index": 1, "nt1": "///B/902", "nt2": "///B/971", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 175.236, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 44.617, "chi2": -146.557, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.808, "C1C1_dist": 10.783, "N1N9_dist": 8.854, "C6C8_dist": 9.559, "CNNC_torsion": 2.054, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.58],N1(imino)-N3[2.89],N2(amino)-O2(carbonyl)[3.12]", "interBase_angle": 11.517, "planarity": 0.141, "simple_Shear": -0.792, "simple_Stretch": -0.359, "simple_Buckle": -11.295, "simple_Propeller": 2.249, "bp_simpleParams": [ -0.792, -0.359, -0.326, -11.295, 2.249, -9.227 ], "bp_params": [ -0.762, -0.419, -0.326, -11.435, 1.370, -9.182 ], "frame": { "rmsd": null, "origin": [ 42.923, 41.555, 34.002 ], "x_axis": [ -0.098, -0.747, 0.658 ], "y_axis": [ -0.236, 0.659, 0.714 ], "z_axis": [ -0.967, -0.086, -0.241 ], "quaternion": [ 0.575, 0.348, -0.707, -0.222 ] } }, { "index": 2, "nt1": "///B/903", "nt2": "///B/970", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -165.047, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.546, "chi2": -153.632, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.135, "C1C1_dist": 10.273, "N1N9_dist": 8.572, "C6C8_dist": 9.510, "CNNC_torsion": -3.905, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.58],N1(imino)-N3[2.55],N2(amino)-O2(carbonyl)[2.48]", "interBase_angle": 6.432, "planarity": 0.113, "simple_Shear": -0.113, "simple_Stretch": -0.513, "simple_Buckle": -2.586, "simple_Propeller": -5.889, "bp_simpleParams": [ -0.113, -0.513, -0.390, -2.586, -5.889, 0.323 ], "bp_params": [ -0.109, -0.513, -0.390, -2.548, -5.906, 0.323 ], "frame": { "rmsd": null, "origin": [ 40.028, 39.757, 32.668 ], "x_axis": [ -0.151, -0.233, 0.961 ], "y_axis": [ -0.135, 0.968, 0.214 ], "z_axis": [ -0.979, -0.098, -0.178 ], "quaternion": [ 0.640, 0.122, -0.758, -0.038 ] } }, { "index": 3, "nt1": "///B/904", "nt2": "///B/969", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.273, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.449, "chi2": -166.127, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 53.468, "C1C1_dist": 10.447, "N1N9_dist": 8.684, "C6C8_dist": 9.602, "CNNC_torsion": -14.702, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.63],N1(imino)-N3[2.60],N2(amino)-O2(carbonyl)[2.53]", "interBase_angle": 13.870, "planarity": 0.176, "simple_Shear": -0.136, "simple_Stretch": -0.425, "simple_Buckle": -2.035, "simple_Propeller": -13.720, "bp_simpleParams": [ -0.136, -0.425, 0.047, -2.035, -13.720, -0.326 ], "bp_params": [ -0.133, -0.426, 0.047, -1.913, -13.738, -0.328 ], "frame": { "rmsd": null, "origin": [ 36.911, 37.695, 32.399 ], "x_axis": [ -0.184, 0.345, 0.920 ], "y_axis": [ -0.016, 0.935, -0.354 ], "z_axis": [ -0.983, -0.080, -0.166 ], "quaternion": [ 0.630, -0.109, -0.756, 0.144 ] } }, { "index": 4, "nt1": "///B/905", "nt2": "///B/968", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -174.792, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.507, "chi2": -156.801, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.778, "C1C1_dist": 10.498, "N1N9_dist": 8.752, "C6C8_dist": 9.630, "CNNC_torsion": -15.409, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.65],N1(imino)-N3[2.72],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 20.102, "planarity": 0.226, "simple_Shear": -0.192, "simple_Stretch": -0.321, "simple_Buckle": -13.931, "simple_Propeller": -14.492, "bp_simpleParams": [ -0.192, -0.321, -0.134, -13.931, -14.492, -2.208 ], "bp_params": [ -0.190, -0.322, -0.134, -13.821, -14.597, -2.210 ], "frame": { "rmsd": null, "origin": [ 33.413, 36.120, 34.170 ], "x_axis": [ 0.002, 0.744, 0.668 ], "y_axis": [ -0.085, 0.665, -0.742 ], "z_axis": [ -0.996, -0.055, 0.065 ], "quaternion": [ 0.658, -0.261, -0.632, 0.315 ] } }, { "index": 5, "nt1": "///B/906", "nt2": "///B/967", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.034, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.816, "chi2": -155.056, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 52.759, "C1C1_dist": 10.207, "N1N9_dist": 8.542, "C6C8_dist": 9.487, "CNNC_torsion": -11.810, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.58],O4(carbonyl)-N6(amino)[2.60]", "interBase_angle": 18.147, "planarity": 0.224, "simple_Shear": 0.276, "simple_Stretch": -0.405, "simple_Buckle": -13.647, "simple_Propeller": -11.961, "bp_simpleParams": [ 0.276, -0.405, 0.090, -13.647, -11.961, -0.147 ], "bp_params": [ 0.264, -0.413, 0.090, -13.998, -11.549, -0.146 ], "frame": { "rmsd": null, "origin": [ 30.182, 35.621, 35.881 ], "x_axis": [ 0.025, 0.993, 0.119 ], "y_axis": [ -0.115, 0.121, -0.986 ], "z_axis": [ -0.993, 0.011, 0.117 ], "quaternion": [ 0.562, -0.444, -0.495, 0.493 ] } }, { "index": 6, "nt1": "///B/907", "nt2": "///B/966", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -157.025, "conf1": "anti", "pucker1": "----", "lambda1": 50.652, "chi2": -170.019, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.647, "C1C1_dist": 10.687, "N1N9_dist": 8.819, "C6C8_dist": 9.555, "CNNC_torsion": -11.297, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.41],N1-N3(imino)[2.70]", "interBase_angle": 8.548, "planarity": 0.113, "simple_Shear": 0.029, "simple_Stretch": -0.355, "simple_Buckle": 2.487, "simple_Propeller": -8.178, "bp_simpleParams": [ 0.029, -0.355, -0.101, 2.487, -8.178, -9.296 ], "bp_params": [ 0.027, -0.355, -0.101, 2.442, -8.191, -9.318 ], "frame": { "rmsd": null, "origin": [ 27.716, 36.205, 37.902 ], "x_axis": [ 0.097, 0.908, -0.407 ], "y_axis": [ -0.254, -0.372, -0.893 ], "z_axis": [ -0.962, 0.190, 0.195 ], "quaternion": [ 0.479, -0.565, -0.290, 0.606 ] } }, { "index": 7, "nt1": "///B/908", "nt2": "///B/914", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -165.512, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 34.954, "chi2": -172.594, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 16.792, "C1C1_dist": 9.678, "N1N9_dist": 7.186, "C6C8_dist": 6.277, "CNNC_torsion": 170.590, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.70],N3(imino)-N7[2.95]", "interBase_angle": 16.128, "planarity": 0.215, "simple_Shear": 4.544, "simple_Stretch": 1.051, "simple_Buckle": -15.767, "simple_Propeller": 3.390, "bp_simpleParams": [ 4.544, 1.051, 1.448, -15.767, 3.390, -91.549 ], "bp_params": [ 4.097, -2.228, 1.448, -9.566, 12.984, -91.718 ], "frame": { "rmsd": null, "origin": [ 16.719, 26.153, 26.401 ], "x_axis": [ 0.932, 0.298, 0.206 ], "y_axis": [ -0.231, 0.051, 0.972 ], "z_axis": [ 0.280, -0.953, 0.116 ], "quaternion": [ 0.724, 0.664, 0.025, 0.183 ] } }, { "index": 8, "nt1": "///B/908", "nt2": "///B/921", "bp": "U+A", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "intra_chain": true, "chi1": -165.512, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 99.859, "chi2": -162.929, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.460, "C1C1_dist": 8.232, "N1N9_dist": 8.059, "C6C8_dist": 10.293, "CNNC_torsion": 157.766, "hbonds_num": 1, "hbonds_desc": "O2'(hydroxyl)-N1[2.47]", "interBase_angle": 23.385, "planarity": 0.269, "simple_Shear": 6.636, "simple_Stretch": 4.174, "simple_Buckle": -6.007, "simple_Propeller": -22.600, "bp_simpleParams": [ 6.636, 4.174, 0.356, -6.007, -22.600, -134.773 ], "bp_params": [ -2.064, -7.563, 0.356, -10.927, 20.675, -135.247 ], "frame": { "rmsd": null, "origin": [ 17.813, 25.998, 29.535 ], "x_axis": [ 0.794, 0.254, 0.552 ], "y_axis": [ -0.541, -0.120, 0.833 ], "z_axis": [ 0.278, -0.960, 0.042 ], "quaternion": [ 0.655, 0.684, -0.105, 0.303 ] } }, { "index": 9, "nt1": "///B/910", "nt2": "///B/925", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.851, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.928, "chi2": -167.360, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.438, "C1C1_dist": 10.461, "N1N9_dist": 8.799, "C6C8_dist": 9.743, "CNNC_torsion": -6.759, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.79],N1(imino)-N3[2.79],N2(amino)-O2(carbonyl)[2.71]", "interBase_angle": 13.475, "planarity": 0.156, "simple_Shear": -0.270, "simple_Stretch": -0.275, "simple_Buckle": -6.984, "simple_Propeller": -11.524, "bp_simpleParams": [ -0.270, -0.275, -0.427, -6.984, -11.524, 0.913 ], "bp_params": [ -0.264, -0.280, -0.427, -6.748, -11.664, 0.917 ], "frame": { "rmsd": null, "origin": [ 22.297, 15.098, 29.141 ], "x_axis": [ -0.992, 0.123, 0.017 ], "y_axis": [ 0.051, 0.277, 0.959 ], "z_axis": [ 0.113, 0.953, -0.281 ], "quaternion": [ 0.030, 0.055, 0.799, 0.599 ] } }, { "index": 10, "nt1": "///B/910", "nt2": "///B/945", "bp": "G+G", "name": "--", "Saenger": "06-VI", "LW": "cHW", "DSSR": "cM+W", "intra_chain": true, "chi1": -173.851, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.120, "chi2": -168.317, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 100.152, "C1C1_dist": 9.035, "N1N9_dist": 8.367, "C6C8_dist": 8.320, "CNNC_torsion": 1.726, "hbonds_num": 3, "hbonds_desc": "OP1-O2'(hydroxyl)[3.47],N7-N2(amino)[2.55],O6(carbonyl)-N2(amino)[2.91]", "interBase_angle": 16.247, "planarity": 0.236, "simple_Shear": -0.947, "simple_Stretch": 5.965, "simple_Buckle": -12.755, "simple_Propeller": -10.062, "bp_simpleParams": [ -0.947, 5.965, -0.272, -12.755, -10.062, 29.258 ], "bp_params": [ -5.180, -3.104, -0.272, 14.090, -8.089, 29.117 ], "frame": { "rmsd": null, "origin": [ 19.567, 15.441, 29.941 ], "x_axis": [ -0.968, 0.091, -0.233 ], "y_axis": [ -0.218, 0.149, 0.964 ], "z_axis": [ 0.123, 0.985, -0.124 ], "quaternion": [ 0.119, -0.042, 0.749, 0.651 ] } }, { "index": 11, "nt1": "///B/911", "nt2": "///B/924", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.326, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.003, "chi2": -170.164, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.683, "C1C1_dist": 10.533, "N1N9_dist": 8.819, "C6C8_dist": 9.739, "CNNC_torsion": -14.261, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.84],N3-N1(imino)[2.82],N4(amino)-O6(carbonyl)[2.80]", "interBase_angle": 15.008, "planarity": 0.201, "simple_Shear": 0.432, "simple_Stretch": -0.271, "simple_Buckle": -1.927, "simple_Propeller": -14.884, "bp_simpleParams": [ 0.432, -0.271, -0.000, -1.927, -14.884, -0.779 ], "bp_params": [ 0.421, -0.288, -0.000, -2.510, -14.797, -0.786 ], "frame": { "rmsd": null, "origin": [ 22.512, 17.633, 26.527 ], "x_axis": [ -0.784, 0.233, 0.575 ], "y_axis": [ 0.614, 0.155, 0.774 ], "z_axis": [ 0.091, 0.960, -0.264 ], "quaternion": [ -0.163, 0.285, 0.742, 0.584 ] } }, { "index": 12, "nt1": "///B/912", "nt2": "///B/923", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -170.625, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.901, "chi2": -174.666, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 57.450, "C1C1_dist": 10.545, "N1N9_dist": 8.915, "C6C8_dist": 9.948, "CNNC_torsion": -4.449, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.62],N3-N1(imino)[2.90],N4(amino)-O6(carbonyl)[3.05]", "interBase_angle": 6.275, "planarity": 0.092, "simple_Shear": -0.142, "simple_Stretch": -0.053, "simple_Buckle": 5.933, "simple_Propeller": -2.044, "bp_simpleParams": [ -0.142, -0.053, 0.081, 5.933, -2.044, 4.069 ], "bp_params": [ -0.141, -0.056, 0.081, 5.972, -1.927, 4.064 ], "frame": { "rmsd": null, "origin": [ 20.395, 20.419, 25.273 ], "x_axis": [ -0.482, 0.151, 0.863 ], "y_axis": [ 0.876, 0.091, 0.473 ], "z_axis": [ -0.007, 0.984, -0.176 ], "quaternion": [ -0.329, 0.388, 0.661, 0.551 ] } }, { "index": 13, "nt1": "///B/913", "nt2": "///B/922", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -146.513, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 98.280, "chi2": -178.203, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 12.324, "C1C1_dist": 9.510, "N1N9_dist": 8.363, "C6C8_dist": 8.899, "CNNC_torsion": -53.823, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[2.94],N3-N6(amino)[2.59]", "interBase_angle": 12.144, "planarity": 0.163, "simple_Shear": 7.094, "simple_Stretch": 2.169, "simple_Buckle": 12.080, "simple_Propeller": -1.241, "bp_simpleParams": [ 7.094, 2.169, -0.323, 12.080, -1.241, 1.617 ], "bp_params": [ 6.465, -3.637, -0.323, 7.443, -9.596, 1.620 ], "frame": { "rmsd": null, "origin": [ 19.487, 23.672, 25.264 ], "x_axis": [ 0.527, 0.162, 0.835 ], "y_axis": [ 0.821, 0.157, -0.549 ], "z_axis": [ -0.220, 0.974, -0.050 ], "quaternion": [ 0.639, -0.596, -0.413, -0.258 ] } }, { "index": 14, "nt1": "///B/913", "nt2": "///B/946", "bp": "A+G", "name": "--", "Saenger": "--", "LW": "tW.", "DSSR": "tW+.", "intra_chain": true, "chi1": -146.513, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 25.020, "chi2": -121.167, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 86.140, "C1C1_dist": 12.154, "N1N9_dist": 10.935, "C6C8_dist": 12.217, "CNNC_torsion": 166.162, "hbonds_num": 1, "hbonds_desc": "N1-N2(amino)[2.92]", "interBase_angle": 8.492, "planarity": 0.163, "simple_Shear": 3.005, "simple_Stretch": 4.383, "simple_Buckle": 5.482, "simple_Propeller": -6.485, "bp_simpleParams": [ 3.005, 4.383, 0.457, 5.482, -6.485, 116.230 ], "bp_params": [ -3.013, 4.378, 0.457, 8.021, 2.789, 116.119 ], "frame": { "rmsd": null, "origin": [ 17.247, 22.928, 29.474 ], "x_axis": [ -0.410, -0.030, 0.912 ], "y_axis": [ 0.878, 0.256, 0.404 ], "z_axis": [ -0.245, 0.966, -0.079 ], "quaternion": [ -0.438, 0.321, 0.660, 0.519 ] } }, { "index": 15, "nt1": "///B/914", "nt2": "///B/921", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": true, "chi1": -172.594, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 33.193, "chi2": -162.929, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 117.091, "C1C1_dist": 9.803, "N1N9_dist": 9.262, "C6C8_dist": 10.521, "CNNC_torsion": -16.324, "hbonds_num": 2, "hbonds_desc": "N6(amino)-N3[3.03],N1-O2'(hydroxyl)[2.90]", "interBase_angle": 8.484, "planarity": 0.113, "simple_Shear": -5.705, "simple_Stretch": 3.395, "simple_Buckle": -6.086, "simple_Propeller": -5.910, "bp_simpleParams": [ -5.705, 3.395, 0.317, -6.086, -5.910, 42.678 ], "bp_params": [ -6.576, -0.914, 0.317, -1.059, -8.417, 42.781 ], "frame": { "rmsd": null, "origin": [ 15.444, 26.134, 30.112 ], "x_axis": [ 0.190, -0.027, 0.981 ], "y_axis": [ 0.964, 0.195, -0.181 ], "z_axis": [ -0.186, 0.980, 0.063 ], "quaternion": [ 0.602, -0.483, -0.485, -0.412 ] } }, { "index": 16, "nt1": "///B/915", "nt2": "///B/948", "bp": "G+U", "name": "rWobble", "Saenger": "27-XXVII", "LW": "tWW", "DSSR": "tW+W", "intra_chain": true, "chi1": -150.512, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 15.203, "chi2": -166.634, "conf2": "anti", "pucker2": "----", "lambda2": 37.008, "C1C1_dist": 11.739, "N1N9_dist": 9.250, "C6C8_dist": 9.556, "CNNC_torsion": 158.925, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N3(imino)[2.78],N1(imino)-O4(carbonyl)[2.80]", "interBase_angle": 11.284, "planarity": 0.156, "simple_Shear": -0.962, "simple_Stretch": -0.246, "simple_Buckle": -11.255, "simple_Propeller": 0.807, "bp_simpleParams": [ -0.962, -0.246, -0.786, -11.255, 0.807, 161.342 ], "bp_params": [ 0.341, -0.933, -0.786, 0.319, -11.280, 161.430 ], "frame": { "rmsd": null, "origin": [ 14.026, 29.567, 28.960 ], "x_axis": [ -0.130, -0.279, 0.951 ], "y_axis": [ 0.957, 0.214, 0.194 ], "z_axis": [ -0.257, 0.936, 0.240 ], "quaternion": [ 0.575, -0.323, -0.525, -0.538 ] } }, { "index": 17, "nt1": "///B/918", "nt2": "///B/955", "bp": "G+U", "name": "--", "Saenger": "--", "LW": "tWS", "DSSR": "tW+m", "intra_chain": true, "chi1": -120.110, "conf1": "anti", "pucker1": "pucker-CHK", "lambda1": 32.411, "chi2": -143.880, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 113.854, "C1C1_dist": 8.227, "N1N9_dist": 7.857, "C6C8_dist": 9.420, "CNNC_torsion": -147.272, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)*O4'[3.33],N1(imino)-O2(carbonyl)[2.70],N2(amino)-O2(carbonyl)[2.38]", "interBase_angle": 17.157, "planarity": 0.313, "simple_Shear": 4.580, "simple_Stretch": 3.800, "simple_Buckle": -7.817, "simple_Propeller": 15.273, "bp_simpleParams": [ 4.580, 3.800, -0.451, -7.817, 15.273, 92.470 ], "bp_params": [ -0.034, 5.951, -0.451, -16.759, 3.671, 91.884 ], "frame": { "rmsd": null, "origin": [ 7.556, 41.066, 34.478 ], "x_axis": [ -0.212, 0.801, 0.560 ], "y_axis": [ -0.088, 0.555, -0.827 ], "z_axis": [ -0.973, -0.224, -0.047 ], "quaternion": [ 0.569, -0.265, -0.673, 0.390 ] } }, { "index": 18, "nt1": "///B/919", "nt2": "///B/920", "bp": "G+U", "name": "Platform", "Saenger": "--", "LW": "cSH", "DSSR": "cm+M", "intra_chain": true, "chi1": -102.718, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 162.893, "chi2": 142.263, "conf2": "--", "pucker2": "~C3'-endo", "lambda2": 47.206, "C1C1_dist": 5.204, "N1N9_dist": 5.642, "C6C8_dist": 5.591, "CNNC_torsion": 15.533, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-OP2[2.93],N2(amino)-O4(carbonyl)[3.14]", "interBase_angle": 36.394, "planarity": 0.420, "simple_Shear": 0.476, "simple_Stretch": 8.111, "simple_Buckle": 13.834, "simple_Propeller": 33.662, "bp_simpleParams": [ 0.476, 8.111, -1.566, 13.834, 33.662, 33.745 ], "bp_params": [ 8.046, 1.131, -1.566, 35.786, -6.622, 32.254 ], "frame": { "rmsd": null, "origin": [ 0.972, 35.920, 30.144 ], "x_axis": [ -0.147, 0.840, -0.523 ], "y_axis": [ 0.725, -0.269, -0.635 ], "z_axis": [ -0.673, -0.472, -0.569 ], "quaternion": [ -0.063, 0.650, 0.601, -0.460 ] } }, { "index": 19, "nt1": "///B/919", "nt2": "///B/956", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -102.718, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 62.772, "chi2": -156.397, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.970, "C1C1_dist": 9.935, "N1N9_dist": 8.467, "C6C8_dist": 9.575, "CNNC_torsion": -30.121, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.02],N1(imino)-N3[2.61],N2(amino)-O2(carbonyl)[2.27]", "interBase_angle": 31.708, "planarity": 0.384, "simple_Shear": -0.198, "simple_Stretch": -0.253, "simple_Buckle": -21.748, "simple_Propeller": -23.074, "bp_simpleParams": [ -0.198, -0.253, 0.094, -21.748, -23.074, 8.226 ], "bp_params": [ -0.199, -0.253, 0.094, -21.816, -23.010, 8.249 ], "frame": { "rmsd": null, "origin": [ 1.416, 39.520, 27.991 ], "x_axis": [ 0.095, 0.768, -0.633 ], "y_axis": [ 0.342, -0.622, -0.704 ], "z_axis": [ -0.935, -0.150, -0.322 ], "quaternion": [ -0.194, 0.714, 0.389, -0.549 ] } }, { "index": 20, "nt1": "///B/926", "nt2": "///B/944", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.682, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 41.822, "chi2": -167.978, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.963, "C1C1_dist": 12.334, "N1N9_dist": 10.505, "C6C8_dist": 11.028, "CNNC_torsion": -12.582, "hbonds_num": 1, "hbonds_desc": "N6(amino)-N1[2.75]", "interBase_angle": 33.880, "planarity": 0.457, "simple_Shear": -1.417, "simple_Stretch": 1.677, "simple_Buckle": 23.811, "simple_Propeller": -24.102, "bp_simpleParams": [ -1.417, 1.677, 0.042, 23.811, -24.102, -11.366 ], "bp_params": [ -1.683, 1.410, 0.042, 27.580, -19.677, -11.214 ], "frame": { "rmsd": null, "origin": [ 18.232, 12.753, 31.045 ], "x_axis": [ -0.668, -0.018, -0.744 ], "y_axis": [ 0.740, -0.116, -0.662 ], "z_axis": [ -0.074, -0.993, 0.091 ], "quaternion": [ -0.277, -0.299, -0.605, 0.685 ] } }, { "index": 21, "nt1": "///B/927", "nt2": "///B/943", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -163.656, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.567, "chi2": -168.335, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.675, "C1C1_dist": 10.656, "N1N9_dist": 8.919, "C6C8_dist": 9.783, "CNNC_torsion": -3.939, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.84],N3-N1(imino)[2.86],N4(amino)-O6(carbonyl)[2.77]", "interBase_angle": 22.772, "planarity": 0.249, "simple_Shear": -0.061, "simple_Stretch": -0.109, "simple_Buckle": 19.309, "simple_Propeller": -12.073, "bp_simpleParams": [ -0.061, -0.109, -0.335, 19.309, -12.073, -2.085 ], "bp_params": [ -0.059, -0.111, -0.335, 19.571, -11.642, -2.066 ], "frame": { "rmsd": null, "origin": [ 16.139, 9.639, 30.856 ], "x_axis": [ -0.042, 0.046, -0.998 ], "y_axis": [ 0.994, -0.096, -0.047 ], "z_axis": [ -0.098, -0.994, -0.041 ], "quaternion": [ -0.453, -0.523, -0.497, 0.524 ] } }, { "index": 22, "nt1": "///B/928", "nt2": "///B/942", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.591, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.757, "chi2": -177.402, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.732, "C1C1_dist": 10.090, "N1N9_dist": 8.532, "C6C8_dist": 9.573, "CNNC_torsion": 4.553, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.35],N3-N1(imino)[2.59],N4(amino)-O6(carbonyl)[2.74]", "interBase_angle": 9.522, "planarity": 0.102, "simple_Shear": 0.331, "simple_Stretch": -0.415, "simple_Buckle": 9.493, "simple_Propeller": -0.736, "bp_simpleParams": [ 0.331, -0.415, -0.376, 9.493, -0.736, 4.215 ], "bp_params": [ 0.319, -0.424, -0.376, 9.469, -1.002, 4.201 ], "frame": { "rmsd": null, "origin": [ 14.055, 6.111, 29.621 ], "x_axis": [ 0.550, 0.037, -0.834 ], "y_axis": [ 0.834, -0.071, 0.547 ], "z_axis": [ -0.039, -0.997, -0.070 ], "quaternion": [ 0.594, 0.650, 0.335, -0.336 ] } }, { "index": 23, "nt1": "///B/929", "nt2": "///B/941", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 170.313, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.478, "chi2": 173.772, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.440, "C1C1_dist": 11.082, "N1N9_dist": 9.194, "C6C8_dist": 9.965, "CNNC_torsion": -3.742, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.76],N1(imino)-N3[3.00],N2(amino)-O2(carbonyl)[3.11]", "interBase_angle": 12.234, "planarity": 0.131, "simple_Shear": 0.573, "simple_Stretch": -0.006, "simple_Buckle": -7.649, "simple_Propeller": -9.549, "bp_simpleParams": [ 0.573, -0.006, -0.145, -7.649, -9.549, -6.577 ], "bp_params": [ 0.572, -0.043, -0.145, -8.243, -9.041, -6.581 ], "frame": { "rmsd": null, "origin": [ 12.492, 2.987, 27.552 ], "x_axis": [ 0.921, 0.112, -0.372 ], "y_axis": [ 0.388, -0.206, 0.898 ], "z_axis": [ 0.024, -0.972, -0.233 ], "quaternion": [ 0.609, 0.768, 0.163, -0.113 ] } }, { "index": 24, "nt1": "///B/930", "nt2": "///B/940", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -177.507, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 51.660, "chi2": 174.105, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 73.589, "C1C1_dist": 10.019, "N1N9_dist": 8.700, "C6C8_dist": 9.929, "CNNC_torsion": 2.295, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)*N3[3.20],N1(imino)-O2(carbonyl)[2.68],N2(amino)-O2(carbonyl)[2.81]", "unusual_base2base_hbonds": 1, "interBase_angle": 3.757, "planarity": 0.075, "simple_Shear": -2.069, "simple_Stretch": 0.198, "simple_Buckle": 3.521, "simple_Propeller": 1.310, "bp_simpleParams": [ -2.069, 0.198, 0.354, 3.521, 1.310, 15.215 ], "bp_params": [ -2.066, -0.225, 0.354, 3.184, 1.995, 15.211 ], "frame": { "rmsd": null, "origin": [ 13.232, 1.031, 24.580 ], "x_axis": [ 0.988, 0.155, 0.016 ], "y_axis": [ 0.008, -0.152, 0.988 ], "z_axis": [ 0.156, -0.976, -0.151 ], "quaternion": [ 0.649, 0.757, 0.054, 0.057 ] } }, { "index": 25, "nt1": "///B/931", "nt2": "///B/939", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.436, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 59.877, "chi2": -172.314, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.960, "C1C1_dist": 9.996, "N1N9_dist": 8.572, "C6C8_dist": 9.754, "CNNC_torsion": 7.310, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[3.28],N1-N3(imino)[2.86]", "interBase_angle": 17.748, "planarity": 0.290, "simple_Shear": -0.079, "simple_Stretch": -0.097, "simple_Buckle": -12.421, "simple_Propeller": 12.677, "bp_simpleParams": [ -0.079, -0.097, 0.579, -12.421, 12.677, 12.489 ], "bp_params": [ -0.078, -0.098, 0.579, -12.513, 12.587, 12.490 ], "frame": { "rmsd": null, "origin": [ 14.025, -1.998, 22.121 ], "x_axis": [ 0.745, 0.007, 0.667 ], "y_axis": [ -0.646, -0.242, 0.724 ], "z_axis": [ 0.166, -0.970, -0.176 ], "quaternion": [ 0.576, 0.735, -0.217, 0.283 ] } }, { "index": 26, "nt1": "///B/932", "nt2": "///B/938", "bp": "U-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": 178.265, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.805, "chi2": 170.120, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 21.157, "C1C1_dist": 11.054, "N1N9_dist": 8.946, "C6C8_dist": 9.332, "CNNC_torsion": 9.637, "hbonds_num": 1, "hbonds_desc": "N3(imino)-O4(carbonyl)[3.15]", "interBase_angle": 11.412, "planarity": 0.132, "simple_Shear": 3.836, "simple_Stretch": 0.318, "simple_Buckle": -7.634, "simple_Propeller": 8.483, "bp_simpleParams": [ 3.836, 0.318, 0.409, -7.634, 8.483, -28.837 ], "bp_params": [ 3.656, -1.205, 0.409, -3.716, 10.790, -28.945 ], "frame": { "rmsd": null, "origin": [ 15.582, -4.208, 19.251 ], "x_axis": [ 0.073, -0.219, 0.973 ], "y_axis": [ -0.953, -0.303, 0.003 ], "z_axis": [ 0.294, -0.927, -0.231 ], "quaternion": [ 0.367, 0.634, -0.463, 0.500 ] } }, { "index": 27, "nt1": "///B/933", "nt2": "///B/937", "bp": "U-A", "name": "--", "Saenger": "--", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -154.958, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 79.934, "chi2": -170.184, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 1.899, "C1C1_dist": 8.939, "N1N9_dist": 7.364, "C6C8_dist": 7.470, "CNNC_torsion": 175.051, "hbonds_num": 1, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.80]", "interBase_angle": 20.315, "planarity": 0.239, "simple_Shear": 7.545, "simple_Stretch": 1.567, "simple_Buckle": -14.941, "simple_Propeller": 13.765, "bp_simpleParams": [ 7.545, 1.567, 0.428, -14.941, 13.765, -31.014 ], "bp_params": [ 5.881, -4.979, 0.428, 1.635, 20.249, -31.477 ], "frame": { "rmsd": null, "origin": [ 19.037, -6.179, 19.251 ], "x_axis": [ -0.686, -0.385, 0.617 ], "y_axis": [ -0.566, -0.252, -0.785 ], "z_axis": [ 0.458, -0.888, -0.045 ], "quaternion": [ 0.066, 0.391, -0.608, 0.688 ] } }, { "index": 28, "nt1": "///B/949", "nt2": "///B/965", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -166.775, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.219, "chi2": 166.089, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 49.469, "C1C1_dist": 10.389, "N1N9_dist": 8.624, "C6C8_dist": 9.524, "CNNC_torsion": -5.012, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.60],N3-N1(imino)[2.71],N4(amino)-O6(carbonyl)[2.76]", "interBase_angle": 18.419, "planarity": 0.208, "simple_Shear": 0.710, "simple_Stretch": -0.385, "simple_Buckle": 15.815, "simple_Propeller": -9.443, "bp_simpleParams": [ 0.710, -0.385, -0.180, 15.815, -9.443, 0.039 ], "bp_params": [ 0.685, -0.428, -0.180, 15.231, -10.359, 0.038 ], "frame": { "rmsd": null, "origin": [ 25.202, 37.214, 39.806 ], "x_axis": [ -0.145, 0.405, -0.903 ], "y_axis": [ -0.219, -0.903, -0.370 ], "z_axis": [ -0.965, 0.144, 0.219 ], "quaternion": [ 0.207, -0.620, -0.075, 0.753 ] } }, { "index": 29, "nt1": "///B/950", "nt2": "///B/964", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.777, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.886, "chi2": -150.500, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 51.122, "C1C1_dist": 10.344, "N1N9_dist": 8.651, "C6C8_dist": 9.596, "CNNC_torsion": -9.717, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.69],N1(imino)-N3[2.58],N2(amino)-O2(carbonyl)[2.50]", "interBase_angle": 20.289, "planarity": 0.238, "simple_Shear": 0.452, "simple_Stretch": -0.369, "simple_Buckle": -10.519, "simple_Propeller": -17.350, "bp_simpleParams": [ 0.452, -0.369, 0.032, -10.519, -17.350, 0.506 ], "bp_params": [ 0.430, -0.394, 0.032, -11.448, -16.751, 0.509 ], "frame": { "rmsd": null, "origin": [ 21.831, 39.833, 41.340 ], "x_axis": [ -0.119, -0.090, -0.989 ], "y_axis": [ -0.192, -0.975, 0.112 ], "z_axis": [ -0.974, 0.203, 0.099 ], "quaternion": [ 0.034, -0.663, 0.106, 0.740 ] } }, { "index": 30, "nt1": "///B/951", "nt2": "///B/963", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -149.728, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.947, "chi2": -148.874, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.996, "C1C1_dist": 10.016, "N1N9_dist": 8.420, "C6C8_dist": 9.444, "CNNC_torsion": -10.286, "hbonds_num": 2, "hbonds_desc": "N6(amino)-O4(carbonyl)[2.69],N1-N3(imino)[2.44]", "interBase_angle": 18.931, "planarity": 0.215, "simple_Shear": -0.085, "simple_Stretch": -0.468, "simple_Buckle": -10.079, "simple_Propeller": -16.025, "bp_simpleParams": [ -0.085, -0.468, -0.164, -10.079, -16.025, 4.375 ], "bp_params": [ -0.086, -0.468, -0.164, -10.099, -16.013, 4.401 ], "frame": { "rmsd": null, "origin": [ 18.910, 41.302, 40.217 ], "x_axis": [ -0.081, -0.633, -0.770 ], "y_axis": [ -0.226, -0.741, 0.633 ], "z_axis": [ -0.971, 0.225, -0.083 ], "quaternion": [ 0.154, 0.660, -0.325, -0.659 ] } }, { "index": 31, "nt1": "///B/952", "nt2": "///B/962", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -169.371, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 57.605, "chi2": -166.183, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 54.292, "C1C1_dist": 10.349, "N1N9_dist": 8.715, "C6C8_dist": 9.726, "CNNC_torsion": -4.522, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.79],N1(imino)-N3[2.67],N2(amino)-O2(carbonyl)[2.55]", "interBase_angle": 12.672, "planarity": 0.179, "simple_Shear": 0.217, "simple_Stretch": -0.297, "simple_Buckle": 0.676, "simple_Propeller": -12.654, "bp_simpleParams": [ 0.217, -0.297, -0.205, 0.676, -12.654, 3.313 ], "bp_params": [ 0.209, -0.303, -0.205, 0.342, -12.667, 3.334 ], "frame": { "rmsd": null, "origin": [ 16.190, 42.509, 38.096 ], "x_axis": [ -0.099, -0.911, -0.399 ], "y_axis": [ -0.179, -0.378, 0.908 ], "z_axis": [ -0.979, 0.162, -0.125 ], "quaternion": [ 0.315, 0.592, -0.460, -0.581 ] } }, { "index": 32, "nt1": "///B/953", "nt2": "///B/961", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -168.061, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.453, "chi2": -169.704, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.959, "C1C1_dist": 10.602, "N1N9_dist": 8.950, "C6C8_dist": 9.922, "CNNC_torsion": -3.101, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[3.04],N1(imino)-N3[2.95],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 15.305, "planarity": 0.183, "simple_Shear": -0.306, "simple_Stretch": -0.038, "simple_Buckle": -13.439, "simple_Propeller": -7.324, "bp_simpleParams": [ -0.306, -0.038, -0.029, -13.439, -7.324, 2.130 ], "bp_params": [ -0.305, -0.045, -0.029, -13.285, -7.600, 2.121 ], "frame": { "rmsd": null, "origin": [ 13.407, 42.647, 35.276 ], "x_axis": [ -0.031, -0.986, 0.161 ], "y_axis": [ -0.190, 0.164, 0.968 ], "z_axis": [ -0.981, -0.001, -0.192 ], "quaternion": [ -0.485, -0.499, 0.589, 0.411 ] } }, { "index": 33, "nt1": "///B/954", "nt2": "///B/958", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "intra_chain": true, "chi1": -165.068, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 46.243, "chi2": -115.046, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 12.040, "C1C1_dist": 9.329, "N1N9_dist": 7.011, "C6C8_dist": 6.421, "CNNC_torsion": -157.965, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N6(amino)[2.57],N3(imino)-N7[3.03]", "interBase_angle": 19.521, "planarity": 0.273, "simple_Shear": 5.580, "simple_Stretch": 0.793, "simple_Buckle": -11.376, "simple_Propeller": 15.864, "bp_simpleParams": [ 5.580, 0.793, 1.426, -11.376, 15.864, -73.724 ], "bp_params": [ 4.483, -3.416, 1.426, 3.334, 19.235, -74.481 ], "frame": { "rmsd": null, "origin": [ 10.585, 42.021, 32.811 ], "x_axis": [ -0.124, 0.134, 0.983 ], "y_axis": [ 0.084, 0.989, -0.124 ], "z_axis": [ -0.989, 0.067, -0.134 ], "quaternion": [ 0.658, -0.073, -0.749, 0.019 ] } } ], "num_multiplets": 4, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "UAA", "nts_long": "///B/908,///B/914,///B/921", "planarity": 0.229 }, { "index": 2, "num_nts": 3, "nts_short": "GCG", "nts_long": "///B/910,///B/925,///B/945", "planarity": 0.243 }, { "index": 3, "num_nts": 3, "nts_short": "AAG", "nts_long": "///B/913,///B/922,///B/946", "planarity": 0.230 }, { "index": 4, "num_nts": 3, "nts_short": "GUC", "nts_long": "///B/919,///B/920,///B/956", "planarity": 0.599 } ], "num_helices": 2, "helices": [ { "index": 1, "num_stems": 2, "strand1": "GGGGUACGAGGUUC", "strand2": "CCCCAUGCUCCAGG", "bp_type": "|||||||||||..|", "helix_form": "AA.AAxA..Axx.", "helical_rise": 3.097, "helical_rise_std": 0.693, "helical_radius": 8.922, "helical_radius_std": 2.425, "helical_axis": [ -0.986, 0.163, -0.022 ], "point1": [ 42.492, 36.452, 36.961 ], "point2": [ 2.843, 43.020, 36.070 ], "num_pairs": 14, "pairs": [ { "index": 1, "nt1": "///B/902", "nt2": "///B/971", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.762, -0.419, -0.326, -11.435, 1.370, -9.182 ], "step_params": [ 0.182, -1.648, 3.263, -1.317, 3.515, 34.689 ], "heli_params": [ -3.267, -0.497, 3.078, 5.873, 2.200, 34.886 ], "bp2_params": [ -0.109, -0.513, -0.390, -2.548, -5.906, 0.323 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.263, "simple_Twist": 31.352, "simple_hRise": 3.055, "simple_hTwist": 31.570 }, { "index": 2, "nt1": "///B/903", "nt2": "///B/970", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.109, -0.513, -0.390, -2.548, -5.906, 0.323 ], "step_params": [ 0.169, -1.790, 3.288, -0.979, 0.765, 33.757 ], "heli_params": [ -3.203, -0.449, 3.242, 1.317, 1.685, 33.779 ], "bp2_params": [ -0.133, -0.426, 0.047, -1.913, -13.738, -0.328 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.288, "simple_Twist": 33.651, "simple_hRise": 3.242, "simple_hTwist": 33.673 }, { "index": 3, "nt1": "///B/904", "nt2": "///B/969", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.133, -0.426, 0.047, -1.913, -13.738, -0.328 ], "step_params": [ 0.855, -2.204, 3.501, 6.305, 11.753, 27.030 ], "heli_params": [ -6.571, -0.399, 2.484, 23.421, -12.565, 30.087 ], "bp2_params": [ -0.190, -0.322, -0.134, -13.821, -14.597, -2.210 ], "groove_widths": [ 16.191, null, 16.286, null ], "simple_Rise": 3.501, "simple_Twist": 27.192, "simple_hRise": 2.491, "simple_hTwist": 30.232 }, { "index": 4, "nt1": "///B/905", "nt2": "///B/968", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.190, -0.322, -0.134, -13.821, -14.597, -2.210 ], "step_params": [ 0.194, -1.460, 3.383, 1.176, 4.728, 34.791 ], "heli_params": [ -3.131, -0.145, 3.169, 7.859, -1.955, 35.120 ], "bp2_params": [ 0.264, -0.413, 0.090, -13.998, -11.549, -0.146 ], "groove_widths": [ 17.211, 15.388, 16.838, 14.129 ], "simple_Rise": 3.383, "simple_Twist": 32.227, "simple_hRise": 3.148, "simple_hTwist": 32.583 }, { "index": 5, "nt1": "///B/906", "nt2": "///B/967", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.264, -0.413, 0.090, -13.998, -11.549, -0.146 ], "step_params": [ 0.083, -1.634, 2.799, 6.019, 9.576, 29.710 ], "heli_params": [ -4.365, 0.715, 2.157, 17.880, -11.238, 31.745 ], "bp2_params": [ 0.027, -0.355, -0.101, 2.442, -8.191, -9.318 ], "groove_widths": [ 17.290, 15.618, 17.803, 16.721 ], "simple_Rise": 2.799, "simple_Twist": 31.409, "simple_hRise": 2.199, "simple_hTwist": 33.335 }, { "index": 6, "nt1": "///B/907", "nt2": "///B/966", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.027, -0.355, -0.101, 2.442, -8.191, -9.318 ], "step_params": [ -0.556, -1.319, 2.986, -0.890, -2.874, 43.770 ], "heli_params": [ -1.512, 0.665, 3.072, -3.849, 1.192, 43.868 ], "bp2_params": [ 0.685, -0.428, -0.180, 15.231, -10.359, 0.038 ], "groove_widths": [ 15.914, 14.672, 16.577, 15.800 ], "simple_Rise": 2.986, "simple_Twist": 40.406, "simple_hRise": 3.080, "simple_hTwist": 40.514 }, { "index": 7, "nt1": "///B/949", "nt2": "///B/965", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.685, -0.428, -0.180, 15.231, -10.359, 0.038 ], "step_params": [ -0.631, -2.091, 3.976, 2.271, 7.389, 28.232 ], "heli_params": [ -5.948, 1.805, 3.275, 14.801, -4.549, 29.250 ], "bp2_params": [ 0.430, -0.394, 0.032, -11.448, -16.751, 0.509 ], "groove_widths": [ 15.941, 14.671, 16.124, 15.525 ], "simple_Rise": 3.976, "simple_Twist": 28.994, "simple_hRise": 3.296, "simple_hTwist": 29.985 }, { "index": 8, "nt1": "///B/950", "nt2": "///B/964", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.430, -0.394, 0.032, -11.448, -16.751, 0.509 ], "step_params": [ 0.741, -1.190, 3.160, 5.257, 9.128, 32.948 ], "heli_params": [ -3.327, -0.485, 2.822, 15.604, -8.987, 34.546 ], "bp2_params": [ -0.086, -0.468, -0.164, -10.099, -16.013, 4.401 ], "groove_widths": [ 16.679, 15.422, 15.282, 10.903 ], "simple_Rise": 3.160, "simple_Twist": 35.845, "simple_hRise": 2.860, "simple_hTwist": 37.312 }, { "index": 9, "nt1": "///B/951", "nt2": "///B/963", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.086, -0.468, -0.164, -10.099, -16.013, 4.401 ], "step_params": [ 0.570, -1.835, 3.109, -0.287, 4.373, 26.470 ], "heli_params": [ -4.978, -1.295, 2.769, 9.468, 0.622, 26.824 ], "bp2_params": [ 0.209, -0.303, -0.205, 0.342, -12.667, 3.334 ], "groove_widths": [ 16.693, 15.149, 16.508, 11.977 ], "simple_Rise": 3.109, "simple_Twist": 25.277, "simple_hRise": 2.750, "simple_hTwist": 25.648 }, { "index": 10, "nt1": "///B/952", "nt2": "///B/962", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.209, -0.303, -0.205, 0.342, -12.667, 3.334 ], "step_params": [ 0.383, -2.310, 3.198, 2.695, 9.724, 31.676 ], "heli_params": [ -5.478, -0.273, 2.426, 17.275, -4.788, 33.205 ], "bp2_params": [ -0.305, -0.045, -0.029, -13.285, -7.600, 2.121 ], "groove_widths": [ 16.412, 14.487, 14.790, 9.455 ], "simple_Rise": 3.198, "simple_Twist": 34.183, "simple_hRise": 2.491, "simple_hTwist": 35.599 }, { "index": 11, "nt1": "///B/953", "nt2": "///B/961", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.305, -0.045, -0.029, -13.285, -7.600, 2.121 ], "step_params": [ -1.153, -1.757, 3.165, -5.135, 0.405, 88.377 ], "heli_params": [ -1.267, 0.721, 3.208, 0.290, 3.681, 88.496 ], "bp2_params": [ 4.483, -3.416, 1.426, 3.334, 19.235, -74.481 ], "groove_widths": [ 17.647, null, 25.347, null ], "simple_Rise": 3.165, "simple_Twist": 57.306, "simple_hRise": 3.237, "simple_hTwist": 57.517 }, { "index": 12, "nt1": "///B/954", "nt2": "///B/958", "bp": "U-A", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tWH", "DSSR": "tW-M", "bp1_params": [ 4.483, -3.416, 1.426, 3.334, 19.235, -74.481 ], "step_params": [ 1.279, -1.627, 2.930, 16.894, -4.546, 47.201 ], "heli_params": [ -1.595, -0.306, 3.312, -5.463, -20.301, 50.165 ], "bp2_params": [ 0.034, -5.951, 0.451, 16.759, -3.671, -91.884 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.930, "simple_Twist": -30.562, "simple_hRise": 1.754, "simple_hTwist": -35.111 }, { "index": 13, "nt1": "///B/955", "nt2": "///B/918", "bp": "U+G", "name": "--", "Saenger": "--", "LW": "tSW", "DSSR": "tm+W", "bp1_params": [ 0.034, -5.951, 0.451, 16.759, -3.671, -91.884 ], "step_params": [ -5.208, 0.036, 7.419, -4.901, -15.755, -103.239 ], "heli_params": [ 0.478, -3.456, 7.201, 10.006, -3.112, -104.175 ], "bp2_params": [ 0.199, -0.253, 0.094, 21.816, -23.010, 8.249 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 7.419, "simple_Twist": 4.172, "simple_hRise": 3.291, "simple_hTwist": 17.015 }, { "index": 14, "nt1": "///B/956", "nt2": "///B/919", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "num_stems": 2, "strand1": "AUUCCGGAGCCAAG", "strand2": "UUAGGCCACGGAUU", "bp_type": "..|||||.|||...", "helix_form": "....AA.xAA.xx", "helical_rise": 2.734, "helical_rise_std": 0.603, "helical_radius": 9.336, "helical_radius_std": 2.709, "helical_axis": [ -0.087, 0.996, -0.009 ], "point1": [ 19.352, -5.839, 26.841 ], "point2": [ 16.269, 29.372, 26.507 ], "num_pairs": 14, "pairs": [ { "index": 1, "nt1": "///B/937", "nt2": "///B/933", "bp": "A-U", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -5.881, -4.979, 0.428, -1.635, 20.249, -31.477 ], "step_params": [ 0.679, -2.383, 3.111, -13.337, 5.489, 50.649 ], "heli_params": [ -3.013, -1.547, 2.614, 6.272, 15.238, 52.531 ], "bp2_params": [ -3.656, -1.205, 0.409, 3.716, 10.790, -28.945 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.111, "simple_Twist": 28.184, "simple_hRise": 2.096, "simple_hTwist": 31.593 }, { "index": 2, "nt1": "///B/938", "nt2": "///B/932", "bp": "U-U", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -3.656, -1.205, 0.409, 3.716, 10.790, -28.945 ], "step_params": [ 1.700, -1.835, 3.048, -8.345, 0.129, 45.585 ], "heli_params": [ -2.344, -2.791, 2.708, 0.165, 10.664, 46.302 ], "bp2_params": [ 0.078, -0.098, 0.579, 12.513, 12.587, 12.490 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.048, "simple_Twist": 25.488, "simple_hRise": 2.372, "simple_hTwist": 26.798 }, { "index": 3, "nt1": "///B/939", "nt2": "///B/931", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.078, -0.098, 0.579, 12.513, 12.587, 12.490 ], "step_params": [ 0.443, -1.887, 3.478, -1.552, 0.088, 41.632 ], "heli_params": [ -2.663, -0.797, 3.456, 0.124, 2.183, 41.659 ], "bp2_params": [ 2.066, -0.225, 0.354, -3.184, 1.995, 15.211 ], "groove_widths": [ 16.709, null, 14.402, null ], "simple_Rise": 3.478, "simple_Twist": 30.360, "simple_hRise": 3.446, "simple_hTwist": 30.399 }, { "index": 4, "nt1": "///B/940", "nt2": "///B/930", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.066, -0.225, 0.354, -3.184, 1.995, 15.211 ], "step_params": [ -1.018, -2.380, 2.551, 6.099, 6.496, 21.918 ], "heli_params": [ -7.188, 3.779, 1.462, 16.246, -15.254, 23.639 ], "bp2_params": [ -0.572, -0.043, -0.145, 8.243, -9.041, -6.581 ], "groove_widths": [ 16.236, 14.410, 16.935, 12.131 ], "simple_Rise": 2.551, "simple_Twist": 37.029, "simple_hRise": 1.935, "simple_hTwist": 38.049 }, { "index": 5, "nt1": "///B/941", "nt2": "///B/929", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.572, -0.043, -0.145, 8.243, -9.041, -6.581 ], "step_params": [ 0.182, -2.188, 3.415, -5.004, 8.807, 33.691 ], "heli_params": [ -4.887, -1.019, 2.720, 14.785, 8.400, 35.138 ], "bp2_params": [ -0.319, -0.424, -0.376, -9.469, -1.002, 4.201 ], "groove_widths": [ 15.551, 14.295, 16.472, 11.041 ], "simple_Rise": 3.415, "simple_Twist": 32.592, "simple_hRise": 2.693, "simple_hTwist": 34.089 }, { "index": 6, "nt1": "///B/942", "nt2": "///B/928", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.319, -0.424, -0.376, -9.469, -1.002, 4.201 ], "step_params": [ -0.508, -2.044, 3.726, 2.813, 2.473, 35.744 ], "heli_params": [ -3.706, 1.270, 3.532, 4.016, -4.568, 35.934 ], "bp2_params": [ 0.059, -0.111, -0.335, -19.571, -11.642, -2.066 ], "groove_widths": [ 16.765, 13.800, 16.168, 12.360 ], "simple_Rise": 3.726, "simple_Twist": 33.038, "simple_hRise": 3.513, "simple_hTwist": 33.244 }, { "index": 7, "nt1": "///B/943", "nt2": "///B/927", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.059, -0.111, -0.335, -19.571, -11.642, -2.066 ], "step_params": [ -0.936, -1.581, 3.278, 1.619, 7.530, 38.993 ], "heli_params": [ -3.162, 1.557, 2.896, 11.148, -2.397, 39.717 ], "bp2_params": [ 1.683, 1.410, 0.042, -27.580, -19.677, -11.214 ], "groove_widths": [ 17.576, 13.636, 15.500, 12.867 ], "simple_Rise": 3.278, "simple_Twist": 30.549, "simple_hRise": 2.767, "simple_hTwist": 31.483 }, { "index": 8, "nt1": "///B/944", "nt2": "///B/926", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 1.683, 1.410, 0.042, -27.580, -19.677, -11.214 ], "step_params": [ -2.959, -2.776, 3.032, 11.182, 2.193, 49.815 ], "heli_params": [ -3.347, 4.071, 2.246, 2.565, -13.078, 51.021 ], "bp2_params": [ -0.264, -0.280, -0.427, -6.748, -11.664, 0.917 ], "groove_widths": [ 16.508, 14.081, 14.101, 11.887 ], "simple_Rise": 3.032, "simple_Twist": 60.215, "simple_hRise": 2.408, "simple_hTwist": 61.184 }, { "index": 9, "nt1": "///B/910", "nt2": "///B/925", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.264, -0.280, -0.427, -6.748, -11.664, 0.917 ], "step_params": [ -0.536, -1.742, 3.160, -0.548, 1.573, 35.217 ], "heli_params": [ -3.100, 0.807, 3.089, 2.598, 0.905, 35.255 ], "bp2_params": [ 0.421, -0.288, -0.000, -2.510, -14.797, -0.786 ], "groove_widths": [ 16.574, 14.914, 15.335, 14.763 ], "simple_Rise": 3.160, "simple_Twist": 31.479, "simple_hRise": 3.080, "simple_hTwist": 31.522 }, { "index": 10, "nt1": "///B/911", "nt2": "///B/924", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.421, -0.288, -0.000, -2.510, -14.797, -0.786 ], "step_params": [ 0.991, -2.099, 2.902, 0.915, 7.625, 23.349 ], "heli_params": [ -6.798, -2.105, 2.155, 18.220, -2.187, 24.563 ], "bp2_params": [ -0.141, -0.056, 0.081, 5.972, -1.927, 4.064 ], "groove_widths": [ 16.815, 15.405, 15.899, 11.918 ], "simple_Rise": 2.902, "simple_Twist": 26.659, "simple_hRise": 2.258, "simple_hTwist": 27.724 }, { "index": 11, "nt1": "///B/912", "nt2": "///B/923", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.141, -0.056, 0.081, 5.972, -1.927, 4.064 ], "step_params": [ 0.348, -0.543, 3.316, 12.514, 6.740, 60.645 ], "heli_params": [ -0.842, 0.249, 3.254, 6.578, -12.213, 62.134 ], "bp2_params": [ 6.465, -3.637, -0.323, 7.443, -9.596, 1.620 ], "groove_widths": [ 16.588, null, 8.967, null ], "simple_Rise": 3.316, "simple_Twist": 17.020, "simple_hRise": 2.587, "simple_hTwist": 22.141 }, { "index": 12, "nt1": "///B/913", "nt2": "///B/922", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "bp1_params": [ 6.465, -3.637, -0.323, 7.443, -9.596, 1.620 ], "step_params": [ -0.913, -2.310, 2.991, -1.088, -5.109, 44.425 ], "heli_params": [ -2.591, 1.105, 3.244, -6.729, 1.433, 44.716 ], "bp2_params": [ -4.097, -2.228, 1.448, 9.566, 12.984, -91.718 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.991, "simple_Twist": 112.012, "simple_hRise": 3.064, "simple_hTwist": 112.092 }, { "index": 13, "nt1": "///B/914", "nt2": "///B/908", "bp": "A-U", "name": "rHoogsteen", "Saenger": "24-XXIV", "LW": "tHW", "DSSR": "tM-W", "bp1_params": [ -4.097, -2.228, 1.448, 9.566, 12.984, -91.718 ], "step_params": [ 1.018, -2.647, 4.173, 10.458, 17.712, -89.626 ], "heli_params": [ 1.388, 0.982, 4.419, -12.432, 7.341, -91.464 ], "bp2_params": [ 0.341, -0.933, -0.786, 0.319, -11.280, 161.430 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 4.173, "simple_Twist": 5.244, "simple_hRise": -0.670, "simple_hTwist": 21.220 }, { "index": 14, "nt1": "///B/915", "nt2": "///B/948", "bp": "G+U", "name": "rWobble", "Saenger": "27-XXVII", "LW": "tWW", "DSSR": "tW+W" } ] } ], "num_stems": 4, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGGGUA", "strand2": "CCCCAU", "bp_type": "||||||", "helix_form": "AA.AA", "helical_rise": 2.708, "helical_rise_std": 0.265, "helical_radius": 9.471, "helical_radius_std": 0.533, "helical_axis": [ -0.975, 0.179, -0.134 ], "point1": [ 42.139, 38.323, 37.695 ], "point2": [ 29.036, 40.724, 35.890 ], "num_pairs": 6, "pairs": [ { "index": 1, "nt1": "///B/902", "nt2": "///B/971", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.762, -0.419, -0.326, -11.435, 1.370, -9.182 ], "step_params": [ 0.182, -1.648, 3.263, -1.317, 3.515, 34.689 ], "heli_params": [ -3.267, -0.497, 3.078, 5.873, 2.200, 34.886 ], "bp2_params": [ -0.109, -0.513, -0.390, -2.548, -5.906, 0.323 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.263, "simple_Twist": 31.352, "simple_hRise": 3.055, "simple_hTwist": 31.570 }, { "index": 2, "nt1": "///B/903", "nt2": "///B/970", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.109, -0.513, -0.390, -2.548, -5.906, 0.323 ], "step_params": [ 0.169, -1.790, 3.288, -0.979, 0.765, 33.757 ], "heli_params": [ -3.203, -0.449, 3.242, 1.317, 1.685, 33.779 ], "bp2_params": [ -0.133, -0.426, 0.047, -1.913, -13.738, -0.328 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.288, "simple_Twist": 33.651, "simple_hRise": 3.242, "simple_hTwist": 33.673 }, { "index": 3, "nt1": "///B/904", "nt2": "///B/969", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.133, -0.426, 0.047, -1.913, -13.738, -0.328 ], "step_params": [ 0.855, -2.204, 3.501, 6.305, 11.753, 27.030 ], "heli_params": [ -6.571, -0.399, 2.484, 23.421, -12.565, 30.087 ], "bp2_params": [ -0.190, -0.322, -0.134, -13.821, -14.597, -2.210 ], "groove_widths": [ 16.191, null, 16.286, null ], "simple_Rise": 3.501, "simple_Twist": 27.192, "simple_hRise": 2.491, "simple_hTwist": 30.232 }, { "index": 4, "nt1": "///B/905", "nt2": "///B/968", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.190, -0.322, -0.134, -13.821, -14.597, -2.210 ], "step_params": [ 0.194, -1.460, 3.383, 1.176, 4.728, 34.791 ], "heli_params": [ -3.131, -0.145, 3.169, 7.859, -1.955, 35.120 ], "bp2_params": [ 0.264, -0.413, 0.090, -13.998, -11.549, -0.146 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.383, "simple_Twist": 32.227, "simple_hRise": 3.148, "simple_hTwist": 32.583 }, { "index": 5, "nt1": "///B/906", "nt2": "///B/967", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.264, -0.413, 0.090, -13.998, -11.549, -0.146 ], "step_params": [ 0.083, -1.634, 2.799, 6.019, 9.576, 29.710 ], "heli_params": [ -4.365, 0.715, 2.157, 17.880, -11.238, 31.745 ], "bp2_params": [ 0.027, -0.355, -0.101, 2.442, -8.191, -9.318 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.799, "simple_Twist": 31.409, "simple_hRise": 2.199, "simple_hTwist": 33.335 }, { "index": 6, "nt1": "///B/907", "nt2": "///B/966", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 2, "strand1": "GCC", "strand2": "CGG", "bp_type": "|||", "helix_form": "AA", "helical_rise": 2.555, "helical_rise_std": 0.228, "helical_radius": 9.467, "helical_radius_std": 0.555, "helical_axis": [ 0.182, 0.983, 0.013 ], "point1": [ 17.993, 15.698, 29.181 ], "point2": [ 18.921, 20.696, 29.248 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///B/910", "nt2": "///B/925", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.264, -0.280, -0.427, -6.748, -11.664, 0.917 ], "step_params": [ -0.536, -1.742, 3.160, -0.548, 1.573, 35.217 ], "heli_params": [ -3.100, 0.807, 3.089, 2.598, 0.905, 35.255 ], "bp2_params": [ 0.421, -0.288, -0.000, -2.510, -14.797, -0.786 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.160, "simple_Twist": 31.479, "simple_hRise": 3.080, "simple_hTwist": 31.522 }, { "index": 2, "nt1": "///B/911", "nt2": "///B/924", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.421, -0.288, -0.000, -2.510, -14.797, -0.786 ], "step_params": [ 0.991, -2.099, 2.902, 0.915, 7.625, 23.349 ], "heli_params": [ -6.798, -2.105, 2.155, 18.220, -2.187, 24.563 ], "bp2_params": [ -0.141, -0.056, 0.081, 5.972, -1.927, 4.064 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.902, "simple_Twist": 26.659, "simple_hRise": 2.258, "simple_hTwist": 27.724 }, { "index": 3, "nt1": "///B/912", "nt2": "///B/923", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 2, "strand1": "CCGGA", "strand2": "GGCCU", "bp_type": "|||||", "helix_form": "AA..", "helical_rise": 2.390, "helical_rise_std": 0.358, "helical_radius": 9.448, "helical_radius_std": 0.484, "helical_axis": [ 0.176, -0.984, -0.014 ], "point1": [ 16.223, 8.733, 25.342 ], "point2": [ 17.877, -0.490, 25.214 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///B/927", "nt2": "///B/943", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.059, -0.111, -0.335, 19.571, -11.642, -2.066 ], "step_params": [ 0.508, -2.044, 3.726, -2.813, 2.473, 35.744 ], "heli_params": [ -3.706, -1.270, 3.532, 4.016, 4.568, 35.934 ], "bp2_params": [ 0.319, -0.424, -0.376, 9.469, -1.002, 4.201 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.726, "simple_Twist": 33.038, "simple_hRise": 3.513, "simple_hTwist": 33.244 }, { "index": 2, "nt1": "///B/928", "nt2": "///B/942", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.319, -0.424, -0.376, 9.469, -1.002, 4.201 ], "step_params": [ -0.182, -2.188, 3.415, 5.004, 8.807, 33.691 ], "heli_params": [ -4.887, 1.019, 2.720, 14.785, -8.400, 35.138 ], "bp2_params": [ 0.572, -0.043, -0.145, -8.243, -9.041, -6.581 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.415, "simple_Twist": 32.592, "simple_hRise": 2.693, "simple_hTwist": 34.089 }, { "index": 3, "nt1": "///B/929", "nt2": "///B/941", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.572, -0.043, -0.145, -8.243, -9.041, -6.581 ], "step_params": [ 1.018, -2.380, 2.551, -6.099, 6.496, 21.918 ], "heli_params": [ -7.188, -3.779, 1.462, 16.246, 15.254, 23.639 ], "bp2_params": [ -2.066, -0.225, 0.354, 3.184, 1.995, 15.211 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.551, "simple_Twist": 37.029, "simple_hRise": 1.935, "simple_hTwist": 38.049 }, { "index": 4, "nt1": "///B/930", "nt2": "///B/940", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.066, -0.225, 0.354, 3.184, 1.995, 15.211 ], "step_params": [ -0.443, -1.887, 3.478, 1.552, 0.088, 41.632 ], "heli_params": [ -2.663, 0.797, 3.456, 0.124, -2.183, 41.659 ], "bp2_params": [ -0.078, -0.098, 0.579, -12.513, 12.587, 12.490 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.478, "simple_Twist": 30.360, "simple_hRise": 3.446, "simple_hTwist": 30.399 }, { "index": 5, "nt1": "///B/931", "nt2": "///B/939", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 4, "helix_index": 1, "strand1": "CGAGG", "strand2": "GCUCC", "bp_type": "|||||", "helix_form": "A..A", "helical_rise": 2.264, "helical_rise_std": 0.366, "helical_radius": 9.123, "helical_radius_std": 0.806, "helical_axis": [ -0.987, -0.124, 0.098 ], "point1": [ 23.903, 39.458, 36.131 ], "point2": [ 15.146, 38.357, 36.998 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///B/949", "nt2": "///B/965", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.685, -0.428, -0.180, 15.231, -10.359, 0.038 ], "step_params": [ -0.631, -2.091, 3.976, 2.271, 7.389, 28.232 ], "heli_params": [ -5.948, 1.805, 3.275, 14.801, -4.549, 29.250 ], "bp2_params": [ 0.430, -0.394, 0.032, -11.448, -16.751, 0.509 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.976, "simple_Twist": 28.994, "simple_hRise": 3.296, "simple_hTwist": 29.985 }, { "index": 2, "nt1": "///B/950", "nt2": "///B/964", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.430, -0.394, 0.032, -11.448, -16.751, 0.509 ], "step_params": [ 0.741, -1.190, 3.160, 5.257, 9.128, 32.948 ], "heli_params": [ -3.327, -0.485, 2.822, 15.604, -8.987, 34.546 ], "bp2_params": [ -0.086, -0.468, -0.164, -10.099, -16.013, 4.401 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.160, "simple_Twist": 35.845, "simple_hRise": 2.860, "simple_hTwist": 37.312 }, { "index": 3, "nt1": "///B/951", "nt2": "///B/963", "bp": "A-U", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.086, -0.468, -0.164, -10.099, -16.013, 4.401 ], "step_params": [ 0.570, -1.835, 3.109, -0.287, 4.373, 26.470 ], "heli_params": [ -4.978, -1.295, 2.769, 9.468, 0.622, 26.824 ], "bp2_params": [ 0.209, -0.303, -0.205, 0.342, -12.667, 3.334 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.109, "simple_Twist": 25.277, "simple_hRise": 2.750, "simple_hTwist": 25.648 }, { "index": 4, "nt1": "///B/952", "nt2": "///B/962", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.209, -0.303, -0.205, 0.342, -12.667, 3.334 ], "step_params": [ 0.383, -2.310, 3.198, 2.695, 9.724, 31.676 ], "heli_params": [ -5.478, -0.273, 2.426, 17.275, -4.788, 33.205 ], "bp2_params": [ -0.305, -0.045, -0.029, -13.285, -7.600, 2.121 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.198, "simple_Twist": 34.183, "simple_hRise": 2.491, "simple_hTwist": 35.599 }, { "index": 5, "nt1": "///B/953", "nt2": "///B/961", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_isoCanonPairs": 1, "isoCanonPairs": [ { "index": -1, "helix_index": 1, "nt1": "///B/919", "nt2": "///B/956", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ], "num_coaxStacks": 2, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 2, "stem_indices": [ 1, 4 ] }, { "index": 2, "helix_index": 2, "num_stems": 2, "stem_indices": [ 3, 2 ] } ], "num_stacks": 13, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "AC", "nts_long": "///B/907,///B/949" }, { "index": 2, "num_nts": 2, "nts_short": "CR", "nts_long": "///B/934,///A/410" }, { "index": 3, "num_nts": 2, "nts_short": "GU", "nts_long": "///B/965,///B/966" }, { "index": 4, "num_nts": 3, "nts_short": "UAC", "nts_long": "///B/908,///B/913,///B/912" }, { "index": 5, "num_nts": 3, "nts_short": "GAC", "nts_long": "///B/910,///B/926,///B/927" }, { "index": 6, "num_nts": 3, "nts_short": "AUU", "nts_long": "///B/931,///B/932,///B/933" }, { "index": 7, "num_nts": 3, "nts_short": "GUU", "nts_long": "///B/953,///B/954,///B/955" }, { "index": 8, "num_nts": 3, "nts_short": "HaR", "nts_long": "///A/43,///A/998,///A/260" }, { "index": 9, "num_nts": 4, "nts_short": "UAUU", "nts_long": "///B/935,///B/937,///B/938,///B/939" }, { "index": 10, "num_nts": 4, "nts_short": "GCAY", "nts_long": "///B/973,///B/975,///B/976,///A/211" }, { "index": 11, "num_nts": 5, "nts_short": "CGGAC", "nts_long": "///B/956,///B/957,///B/918,///B/958,///B/961" }, { "index": 12, "num_nts": 6, "nts_short": "GAAGAU", "nts_long": "///B/923,///B/922,///B/914,///B/915,///B/959,///B/960" }, { "index": 13, "num_nts": 7, "nts_short": "GAGCGAU", "nts_long": "///B/943,///B/944,///B/945,///B/909,///B/946,///B/921,///B/948" } ], "nonStack": { "num_nts": 4, "nts_short": "CUGC", "nts_long": "///B/916,///B/920,///B/936,///B/974" }, "num_atom2bases": 2, "atom2bases": [ { "index": 1, "type": "other", "atom": "///B/957/P", "nt": "///B/955", "vert_dist": 3.321 }, { "index": 2, "type": "phosphate", "atom": "///B/957/OP2", "nt": "///B/955", "vert_dist": 2.481 } ], "num_hairpins": 3, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 9 ], "stem_indices": [ 2 ], "summary": "[1] 9 [B.912 B.923] 3", "num_nts": 11, "nts_short": "CAAGCGGUAAG", "nts_long": "///B/912,///B/913,///B/914,///B/915,///B/916,///B/918,///B/919,///B/920,///B/921,///B/922,///B/923", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 9, "nts_short": "AAGCGGUAA", "nts_long": "///B/913,///B/914,///B/915,///B/916,///B/918,///B/919,///B/920,///B/921,///B/922" } ] }, { "index": 2, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 3 ], "summary": "[1] 7 [B.931 B.939] 5", "num_nts": 9, "nts_short": "AUUCUGAUU", "nts_long": "///B/931,///B/932,///B/933,///B/934,///B/935,///B/936,///B/937,///B/938,///B/939", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUCUGAU", "nts_long": "///B/932,///B/933,///B/934,///B/935,///B/936,///B/937,///B/938" } ] }, { "index": 3, "type": "hairpin loop", "bridging_nts": [ 7 ], "stem_indices": [ 4 ], "summary": "[1] 7 [B.953 B.961] 5", "num_nts": 9, "nts_short": "GUUCGAAUC", "nts_long": "///B/953,///B/954,///B/955,///B/956,///B/957,///B/958,///B/959,///B/960,///B/961", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 7, "nts_short": "UUCGAAU", "nts_long": "///B/954,///B/955,///B/956,///B/957,///B/958,///B/959,///B/960" } ] } ], "num_junctions": 1, "junctions": [ { "index": 1, "type": "4-way junction", "bridging_nts": [ 2, 1, 4, 0 ], "stem_indices": [ 1, 2, 3, 4 ], "summary": "[4] 2 1 4 0 [B.907 B.966 B.910 B.925 B.927 B.943 B.949 B.965] 6 3 5 5", "num_nts": 15, "nts_short": "AUCGCACGAGGUCGU", "nts_long": "///B/907,///B/908,///B/909,///B/910,///B/925,///B/926,///B/927,///B/943,///B/944,///B/945,///B/946,///B/948,///B/949,///B/965,///B/966", "num_stems": 4, "bridges": [ { "index": 1, "num_nts": 2, "nts_short": "UC", "nts_long": "///B/908,///B/909" }, { "index": 2, "num_nts": 1, "nts_short": "A", "nts_long": "///B/926" }, { "index": 3, "num_nts": 4, "nts_short": "AGGU", "nts_long": "///B/944,///B/945,///B/946,///B/948" }, { "index": 4, "num_nts": 0, "nts_short": "", "nts_long": "" } ] } ], "num_ssSegments": 2, "ssSegments": [ { "index": 1, "num_nts": 5, "nts_short": "AGCCA", "nts_long": "///B/972,///B/973,///B/974,///B/975,///B/976" }, { "index": 2, "num_nts": 1, "nts_short": "a", "nts_long": "///A/998" } ], "num_kissingLoops": 1, "kissingLoops": [ { "index": 1, "stem_index": -1, "is_isoCanonPair": true, "hairpin_indices": [ 1, 3 ] } ], "num_riboseZippers": 1, "riboseZippers": [ { "index": 1, "num_nts": 4, "nts_short": "UCGG", "nts_long": "///B/908,///B/909,///B/945,///B/946" } ], "num_splayUnits": 6, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "AU", "nts_long": "///B/907,///B/908" }, { "index": 2, "num_nts": 3, "nts_short": "GCG", "nts_long": "///B/915,///B/916,///B/918" }, { "index": 3, "num_nts": 2, "nts_short": "UA", "nts_long": "///B/920,///B/921" }, { "index": 4, "num_nts": 5, "nts_short": "UCUGA", "nts_long": "///B/933,///B/934,///B/935,///B/936,///B/937" }, { "index": 5, "num_nts": 2, "nts_short": "UC", "nts_long": "///B/948,///B/949" }, { "index": 6, "num_nts": 4, "nts_short": "AGCC", "nts_long": "///B/972,///B/973,///B/974,///B/975" } ], "pseudoknot_order": 1, "pseudoknot_nts": [ { "index": 1, "symbols": "[]", "num_nts": 2, "nts_short": "GC", "nts_long": "///B/919,///B/956" } ], "dbn": { "all_chains": { "num_nts": 74, "num_chars": 75, "bseq": "GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGAGGUCGAGGUUCGAAUCCUCGUACCCCAGCCA&a", "bseqUP": "GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGAGGUCGAGGUUCGAAUCCUCGUACCCCAGCCA&A", "sstr": "((((((..(((.....[...))).(((((.......)))))....(((((..]....))))))))))).....&.", "form": "AA.AA...A...A.......AA.AAAAAAA......A.AAAB...AA.A........AAAAAAAAAA.....-&-" }, "chain_B": { "num_nts": 73, "num_chars": 73, "bseq": "GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGAGGUCGAGGUUCGAAUCCUCGUACCCCAGCCA", "bseqUP": "GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGAGGUCGAGGUUCGAAUCCUCGUACCCCAGCCA", "sstr": "((((((..(((.....[...))).(((((.......)))))....(((((..]....))))))))))).....", "form": "AA.AA...A...A.......AA.AAAAAAA......A.AAAB...AA.A........AAAAAAAAAA.....-" } }, "chains": { "chain_B": { "num_nts": 73, "bseq": "GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGAGGUCGAGGUUCGAAUCCUCGUACCCCAGCCA", "sstr": "((((((..(((.....[...))).(((((.......)))))....(((((..]....))))))))))).....", "form": "AA.AA...A...A.......AA.AAAAAAA......A.AAAB...AA.A........AAAAAAAAAA.....-", "helical_rise": 0.175, "helical_rise_std": 3.291, "helical_axis": [ -0.030, 0.354, -0.935 ], "point1": [ 25.442, 26.664, 29.302 ], "point2": [ 25.065, 31.110, 17.578 ], "num_chars": 217, "suite": "G1aG1aG1cG1aU!!A!!U!!C!!G1aC1cC1aA1cA1aG1mC!!G!!G3aU!!A!!A1aG1aG1aC1aA1aC1aC1cG1aG1mA1cU1aU7dC!!U!!G!!A1aU1aU1aC!!C1aG1aG!!A!!G1aG1eU!!C1aG1aA1fG1aG1aU1aU1gC1aG1aA!!A1cU!!C1aC1aU1aC1cG1LU1aA1aC1aC1aC1aC1mA!!G!!C5jC1aA" } }, "num_nts": 74, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "B", "nt_resnum": 902, "nt_name": "G", "nt_code": "G", "nt_id": "///B/902", "linked_nts": [ null, "///B/903" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": 174.168, "delta": 89.265, "epsilon": -134.708, "zeta": -66.767, "epsilon_zeta": -67.941, "bb_type": "BI", "chi": 175.236, "glyco_bond": "anti", "C5prime_xyz": [ -1.051, 7.946, 2.035 ], "P_xyz": [ null, null, null ], "form": "A", "ssZp": 4.610, "Dp": 4.698, "splay_angle": 24.054, "splay_distance": 3.778, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 14.906, "v1": -32.716, "v2": 37.616, "v3": -29.810, "v4": 9.368, "amplitude": 37.716, "phase_angle": 355.828, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.010, "frame": { "rmsd": 0.010, "origin": [ 43.168, 41.716, 33.641 ], "x_axis": [ -0.075, -0.797, 0.599 ], "y_axis": [ -0.145, 0.603, 0.784 ], "z_axis": [ -0.987, -0.029, -0.161 ], "quaternion": [ 0.585, 0.348, -0.678, -0.279 ] } }, { "index": 2, "index_chain": 2, "chain_name": "B", "nt_resnum": 903, "nt_name": "G", "nt_code": "G", "nt_id": "///B/903", "linked_nts": [ "///B/902", "///B/904" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.944, "beta": 179.914, "gamma": 53.213, "delta": 81.599, "epsilon": -166.269, "zeta": -63.673, "epsilon_zeta": -102.596, "bb_type": "BI", "chi": -165.047, "glyco_bond": "anti", "C5prime_xyz": [ -1.426, 8.696, 0.683 ], "P_xyz": [ 1.129, 9.141, 1.006 ], "form": "A", "ssZp": 4.400, "Dp": 4.540, "splay_angle": 25.278, "splay_distance": 3.950, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 158.975, "theta": -148.584, "eta_prime": -179.085, "theta_prime": -147.142, "eta_base": -128.532, "theta_base": -120.747, "v0": 0.938, "v1": -26.736, "v2": 41.158, "v3": -41.656, "v4": 25.610, "amplitude": 43.121, "phase_angle": 17.357, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.757, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 40.262, 39.540, 32.595 ], "x_axis": [ -0.202, -0.235, 0.951 ], "y_axis": [ -0.113, 0.970, 0.215 ], "z_axis": [ -0.973, -0.064, -0.222 ], "quaternion": [ 0.622, 0.112, -0.774, -0.049 ] } }, { "index": 3, "index_chain": 3, "chain_name": "B", "nt_resnum": 904, "nt_name": "G", "nt_code": "G", "nt_id": "///B/904", "linked_nts": [ "///B/903", "///B/905" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -61.773, "beta": -177.511, "gamma": 53.808, "delta": 81.142, "epsilon": -156.415, "zeta": -69.091, "epsilon_zeta": -87.324, "bb_type": "BI", "chi": -159.273, "glyco_bond": "anti", "C5prime_xyz": [ -1.283, 8.784, 0.346 ], "P_xyz": [ 1.294, 9.126, 0.702 ], "form": ".", "ssZp": 4.249, "Dp": 4.575, "splay_angle": 22.348, "splay_distance": 4.151, "splay_ratio": 0.213, "d22": null, "d64": null, "eta": 178.283, "theta": -117.147, "eta_prime": -167.910, "theta_prime": -126.664, "eta_base": -128.352, "theta_base": -107.992, "v0": 1.087, "v1": -26.336, "v2": 40.632, "v3": -40.765, "v4": 24.897, "amplitude": 42.489, "phase_angle": 17.003, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.763, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 36.903, 37.471, 32.409 ], "x_axis": [ -0.300, 0.332, 0.895 ], "y_axis": [ -0.001, 0.938, -0.348 ], "z_axis": [ -0.954, -0.105, -0.281 ], "quaternion": [ 0.582, -0.104, -0.793, 0.143 ] } }, { "index": 4, "index_chain": 4, "chain_name": "B", "nt_resnum": 905, "nt_name": "G", "nt_code": "G", "nt_id": "///B/905", "linked_nts": [ "///B/904", "///B/906" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 145.496, "beta": -164.310, "gamma": -172.823, "delta": 79.207, "epsilon": -139.766, "zeta": -68.619, "epsilon_zeta": -71.147, "bb_type": "BI", "chi": -174.792, "glyco_bond": "anti", "C5prime_xyz": [ -1.552, 8.528, 1.287 ], "P_xyz": [ -0.371, 10.614, 0.228 ], "form": "A", "ssZp": 4.493, "Dp": 4.685, "splay_angle": 23.556, "splay_distance": 3.831, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 164.458, "theta": -169.878, "eta_prime": -178.420, "theta_prime": -162.900, "eta_base": -137.508, "theta_base": -128.330, "v0": 4.943, "v1": -29.582, "v2": 42.186, "v3": -40.293, "v4": 22.247, "amplitude": 43.157, "phase_angle": 12.176, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.821, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 33.494, 35.946, 34.222 ], "x_axis": [ -0.126, 0.723, 0.679 ], "y_axis": [ 0.033, 0.687, -0.726 ], "z_axis": [ -0.992, -0.069, -0.110 ], "quaternion": [ 0.602, -0.273, -0.693, 0.287 ] } }, { "index": 5, "index_chain": 5, "chain_name": "B", "nt_resnum": 906, "nt_name": "U", "nt_code": "U", "nt_id": "///B/906", "linked_nts": [ "///B/905", "///B/907" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -60.169, "beta": 178.649, "gamma": 47.805, "delta": 80.970, "epsilon": 175.754, "zeta": -82.703, "epsilon_zeta": -101.543, "bb_type": "BI", "chi": -158.034, "glyco_bond": "anti", "C5prime_xyz": [ -1.573, 8.794, 0.301 ], "P_xyz": [ 0.940, 9.515, 0.502 ], "form": "A", "ssZp": 4.247, "Dp": 4.339, "splay_angle": 18.371, "splay_distance": 3.098, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 163.040, "theta": -145.972, "eta_prime": -177.720, "theta_prime": -142.601, "eta_base": -129.060, "theta_base": -125.881, "v0": -1.228, "v1": -25.090, "v2": 40.610, "v3": -42.266, "v4": 27.182, "amplitude": 43.227, "phase_angle": 20.038, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.900, "filter_rmsd": 0.098, "frame": { "rmsd": 0.010, "origin": [ 30.165, 35.727, 36.105 ], "x_axis": [ -0.075, 0.989, 0.125 ], "y_axis": [ 0.007, 0.126, -0.992 ], "z_axis": [ -0.997, -0.074, -0.016 ], "quaternion": [ 0.509, -0.451, -0.552, 0.483 ] } }, { "index": 6, "index_chain": 6, "chain_name": "B", "nt_resnum": 907, "nt_name": "A", "nt_code": "A", "nt_id": "///B/907", "linked_nts": [ "///B/906", "///B/908" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart", "alpha": -172.628, "beta": -130.162, "gamma": 164.684, "delta": 112.386, "epsilon": -69.294, "zeta": -73.277, "epsilon_zeta": 3.983, "bb_type": "--", "chi": -157.025, "glyco_bond": "anti", "C5prime_xyz": [ -2.519, 8.839, -0.175 ], "P_xyz": [ -0.114, 9.542, -1.027 ], "form": ".", "ssZp": 0.517, "Dp": 1.079, "splay_angle": 139.784, "splay_distance": 18.183, "splay_ratio": 0.939, "d22": null, "d64": null, "eta": -119.333, "theta": -87.712, "eta_prime": -122.519, "theta_prime": -79.935, "eta_base": -108.082, "theta_base": -47.368, "v0": -26.098, "v1": 16.443, "v2": -1.264, "v3": -13.683, "v4": 24.791, "amplitude": 26.353, "phase_angle": 92.748, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.013, "origin": [ 27.811, 36.274, 38.045 ], "x_axis": [ 0.050, 0.947, -0.318 ], "y_axis": [ -0.271, -0.293, -0.917 ], "z_axis": [ -0.961, 0.132, 0.242 ], "quaternion": [ 0.500, -0.525, -0.322, 0.609 ] } }, { "index": 7, "index_chain": 7, "chain_name": "B", "nt_resnum": 908, "nt_name": "U", "nt_code": "U", "nt_id": "///B/908", "linked_nts": [ "///B/907", "///B/909" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,ribose-zipper,phosphate,splayed-apart", "alpha": -39.097, "beta": -162.561, "gamma": 53.733, "delta": 83.739, "epsilon": -122.933, "zeta": -151.801, "epsilon_zeta": 28.869, "bb_type": "--", "chi": -165.512, "glyco_bond": "anti", "C5prime_xyz": [ -1.263, 8.591, 0.839 ], "P_xyz": [ 1.228, 8.825, 1.652 ], "form": ".", "ssZp": 4.437, "Dp": 4.757, "splay_angle": 63.929, "splay_distance": 10.155, "splay_ratio": 0.531, "d22": 9.430, "d64": 10.703, "eta": -167.558, "theta": -174.751, "eta_prime": -134.748, "theta_prime": -159.887, "eta_base": -128.428, "theta_base": 178.525, "v0": 3.893, "v1": -27.735, "v2": 39.722, "v3": -38.509, "v4": 21.914, "amplitude": 40.809, "phase_angle": 13.253, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.103, "frame": { "rmsd": 0.005, "origin": [ 19.088, 26.018, 25.824 ], "x_axis": [ 0.809, 0.189, -0.557 ], "y_axis": [ 0.463, 0.379, 0.801 ], "z_axis": [ 0.363, -0.906, 0.219 ], "quaternion": [ 0.776, 0.550, 0.297, -0.088 ] } }, { "index": 8, "index_chain": 8, "chain_name": "B", "nt_resnum": 909, "nt_name": "C", "nt_code": "C", "nt_id": "///B/909", "linked_nts": [ "///B/908", "///B/910" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-pair-contact,junction-loop,ribose-zipper,phosphate", "alpha": 161.813, "beta": -147.150, "gamma": -172.973, "delta": 86.455, "epsilon": -167.014, "zeta": 44.418, "epsilon_zeta": 148.569, "bb_type": "--", "chi": -121.468, "glyco_bond": "anti", "C5prime_xyz": [ -3.122, 8.429, -1.930 ], "P_xyz": [ -2.634, 8.624, -4.473 ], "form": ".", "ssZp": 2.041, "Dp": 2.592, "splay_angle": 54.342, "splay_distance": 8.958, "splay_ratio": 0.460, "d22": null, "d64": null, "eta": -142.820, "theta": -70.781, "eta_prime": -170.257, "theta_prime": -103.345, "eta_base": 153.265, "theta_base": -97.216, "v0": -29.711, "v1": 9.185, "v2": 13.299, "v3": -31.026, "v4": 38.241, "amplitude": 37.577, "phase_angle": 69.272, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.006, "origin": [ 14.484, 18.577, 30.979 ], "x_axis": [ 0.180, -0.152, -0.972 ], "y_axis": [ 0.980, 0.113, 0.164 ], "z_axis": [ 0.085, -0.982, 0.169 ], "quaternion": [ 0.605, 0.474, 0.437, -0.468 ] } }, { "index": 9, "index_chain": 9, "chain_name": "B", "nt_resnum": 910, "nt_name": "G", "nt_code": "G", "nt_id": "///B/910", "linked_nts": [ "///B/909", "///B/911" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,phosphate", "alpha": 157.998, "beta": 151.238, "gamma": 52.488, "delta": 79.143, "epsilon": -155.755, "zeta": -67.368, "epsilon_zeta": -88.387, "bb_type": "BI", "chi": -173.851, "glyco_bond": "anti", "C5prime_xyz": [ -1.797, 8.665, 1.157 ], "P_xyz": [ 0.751, 9.045, 1.398 ], "form": "A", "ssZp": 4.422, "Dp": 4.545, "splay_angle": 23.632, "splay_distance": 3.790, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 35.805, "theta": -143.585, "eta_prime": 93.948, "theta_prime": -144.856, "eta_base": 133.787, "theta_base": -121.353, "v0": -5.246, "v1": -21.825, "v2": 39.318, "v3": -43.360, "v4": 30.527, "amplitude": 43.504, "phase_angle": 25.342, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.013, "frame": { "rmsd": 0.013, "origin": [ 22.397, 14.840, 29.065 ], "x_axis": [ -0.975, 0.222, -0.001 ], "y_axis": [ 0.049, 0.219, 0.974 ], "z_axis": [ 0.216, 0.950, -0.225 ], "quaternion": [ 0.070, 0.087, 0.778, 0.619 ] } }, { "index": 10, "index_chain": 10, "chain_name": "B", "nt_resnum": 911, "nt_name": "C", "nt_code": "C", "nt_id": "///B/911", "linked_nts": [ "///B/910", "///B/912" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.392, "beta": -172.286, "gamma": 49.200, "delta": 80.740, "epsilon": -158.469, "zeta": -71.955, "epsilon_zeta": -86.514, "bb_type": "BI", "chi": -154.326, "glyco_bond": "anti", "C5prime_xyz": [ -1.414, 8.774, -0.015 ], "P_xyz": [ 1.075, 9.386, 0.361 ], "form": ".", "ssZp": 4.127, "Dp": 4.585, "splay_angle": 19.687, "splay_distance": 3.606, "splay_ratio": 0.185, "d22": 3.907, "d64": 4.500, "eta": 172.965, "theta": -124.730, "eta_prime": -176.262, "theta_prime": -134.454, "eta_base": -138.693, "theta_base": -114.373, "v0": -0.566, "v1": -25.208, "v2": 39.846, "v3": -41.333, "v4": 26.489, "amplitude": 42.244, "phase_angle": 19.398, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.871, "filter_rmsd": 0.063, "frame": { "rmsd": 0.013, "origin": [ 22.258, 17.660, 26.536 ], "x_axis": [ -0.769, 0.354, 0.532 ], "y_axis": [ 0.605, 0.136, 0.784 ], "z_axis": [ 0.205, 0.925, -0.319 ], "quaternion": [ -0.110, 0.322, 0.746, 0.573 ] } }, { "index": 11, "index_chain": 11, "chain_name": "B", "nt_resnum": 912, "nt_name": "C", "nt_code": "C", "nt_id": "///B/912", "linked_nts": [ "///B/911", "///B/913" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop,phosphate", "alpha": 148.190, "beta": -165.226, "gamma": 178.348, "delta": 85.289, "epsilon": -129.826, "zeta": -63.489, "epsilon_zeta": -66.337, "bb_type": "BI", "chi": -170.625, "glyco_bond": "anti", "C5prime_xyz": [ -1.326, 8.600, 1.068 ], "P_xyz": [ -0.004, 10.431, -0.293 ], "form": ".", "ssZp": 4.481, "Dp": 4.697, "splay_angle": 32.495, "splay_distance": 5.064, "splay_ratio": 0.281, "d22": null, "d64": null, "eta": 160.777, "theta": -146.867, "eta_prime": 175.492, "theta_prime": -136.752, "eta_base": -145.612, "theta_base": -78.955, "v0": 4.665, "v1": -29.052, "v2": 41.499, "v3": -39.601, "v4": 21.952, "amplitude": 42.474, "phase_angle": 12.295, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.963, "filter_rmsd": 0.063, "frame": { "rmsd": 0.008, "origin": [ 20.405, 20.445, 25.192 ], "x_axis": [ -0.451, 0.172, 0.876 ], "y_axis": [ 0.891, 0.136, 0.432 ], "z_axis": [ -0.045, 0.976, -0.215 ], "quaternion": [ -0.343, 0.396, 0.671, 0.524 ] } }, { "index": 12, "index_chain": 12, "chain_name": "B", "nt_resnum": 913, "nt_name": "A", "nt_code": "A", "nt_id": "///B/913", "linked_nts": [ "///B/912", "///B/914" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,phosphate", "alpha": -53.095, "beta": 161.131, "gamma": 56.684, "delta": 82.219, "epsilon": -176.308, "zeta": -82.701, "epsilon_zeta": -93.606, "bb_type": "BI", "chi": -146.513, "glyco_bond": "anti", "C5prime_xyz": [ -1.527, 8.754, -0.412 ], "P_xyz": [ 1.040, 9.133, -0.748 ], "form": ".", "ssZp": 3.724, "Dp": 4.259, "splay_angle": 36.417, "splay_distance": 6.272, "splay_ratio": 0.318, "d22": null, "d64": null, "eta": 166.043, "theta": -150.059, "eta_prime": -159.338, "theta_prime": -168.673, "eta_base": -83.471, "theta_base": -177.309, "v0": -0.482, "v1": -22.122, "v2": 35.126, "v3": -36.512, "v4": 23.405, "amplitude": 37.262, "phase_angle": 19.498, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.692, "filter_rmsd": 0.037, "frame": { "rmsd": 0.012, "origin": [ 19.731, 23.754, 28.967 ], "x_axis": [ 0.515, 0.246, 0.821 ], "y_axis": [ 0.797, 0.216, -0.565 ], "z_axis": [ -0.316, 0.945, -0.084 ], "quaternion": [ 0.642, -0.588, -0.443, -0.215 ] } }, { "index": 13, "index_chain": 13, "chain_name": "B", "nt_resnum": 914, "nt_name": "A", "nt_code": "A", "nt_id": "///B/914", "linked_nts": [ "///B/913", "///B/915" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop", "alpha": 157.242, "beta": 174.964, "gamma": 178.036, "delta": 87.522, "epsilon": -138.128, "zeta": -80.245, "epsilon_zeta": -57.883, "bb_type": "BI", "chi": -172.594, "glyco_bond": "anti", "C5prime_xyz": [ -1.146, 8.383, 1.270 ], "P_xyz": [ 0.081, 10.465, 0.222 ], "form": "A", "ssZp": 4.601, "Dp": 4.699, "splay_angle": 21.737, "splay_distance": 3.457, "splay_ratio": 0.192, "d22": null, "d64": null, "eta": 167.002, "theta": -172.203, "eta_prime": 163.381, "theta_prime": -160.092, "eta_base": 166.277, "theta_base": -120.782, "v0": 9.781, "v1": -31.450, "v2": 39.890, "v3": -35.369, "v4": 16.217, "amplitude": 40.031, "phase_angle": 4.821, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.696, "filter_rmsd": 0.039, "frame": { "rmsd": 0.006, "origin": [ 14.350, 26.289, 26.978 ], "x_axis": [ 0.516, 0.110, 0.849 ], "y_axis": [ 0.835, 0.156, -0.528 ], "z_axis": [ -0.191, 0.982, -0.011 ], "quaternion": [ 0.645, -0.585, -0.403, -0.281 ] } }, { "index": 14, "index_chain": 14, "chain_name": "B", "nt_resnum": 915, "nt_name": "G", "nt_code": "G", "nt_id": "///B/915", "linked_nts": [ "///B/914", "///B/916" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,splayed-apart", "alpha": -38.987, "beta": 159.743, "gamma": 46.338, "delta": 87.435, "epsilon": -114.503, "zeta": -31.285, "epsilon_zeta": -83.218, "bb_type": "--", "chi": -150.512, "glyco_bond": "anti", "C5prime_xyz": [ -1.505, 8.862, -0.111 ], "P_xyz": [ 1.068, 9.271, 0.240 ], "form": ".", "ssZp": 3.362, "Dp": 4.327, "splay_angle": 114.123, "splay_distance": 13.631, "splay_ratio": 0.851, "d22": null, "d64": null, "eta": -171.776, "theta": -75.679, "eta_prime": -155.499, "theta_prime": -69.631, "eta_base": -114.146, "theta_base": -32.491, "v0": -3.655, "v1": -17.775, "v2": 31.061, "v3": -34.307, "v4": 23.997, "amplitude": 34.218, "phase_angle": 24.806, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.385, "filter_rmsd": 0.015, "frame": { "rmsd": 0.015, "origin": [ 13.658, 29.052, 28.937 ], "x_axis": [ 0.919, 0.183, 0.348 ], "y_axis": [ 0.307, 0.219, -0.926 ], "z_axis": [ -0.246, 0.958, 0.145 ], "quaternion": [ 0.755, -0.624, -0.197, -0.041 ] } }, { "index": 15, "index_chain": 15, "chain_name": "B", "nt_resnum": 916, "nt_name": "C", "nt_code": "C", "nt_id": "///B/916", "linked_nts": [ "///B/915", "///B/918" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,kissing-loop,splayed-apart", "alpha": -59.081, "beta": -145.330, "gamma": 48.335, "delta": 85.284, "epsilon": 140.708, "zeta": -106.881, "epsilon_zeta": -112.411, "bb_type": "--", "chi": 95.561, "glyco_bond": "syn", "C5prime_xyz": [ -4.104, 4.831, 2.963 ], "P_xyz": [ -3.910, 2.370, 3.857 ], "form": ".", "ssZp": -1.039, "Dp": 3.552, "splay_angle": 149.666, "splay_distance": 18.527, "splay_ratio": 0.966, "d22": null, "d64": null, "eta": -173.413, "theta": 131.725, "eta_prime": -131.285, "theta_prime": 115.409, "eta_base": -93.588, "theta_base": 108.822, "v0": 9.437, "v1": -27.627, "v2": 33.836, "v3": -29.937, "v4": 13.071, "amplitude": 33.891, "phase_angle": 3.267, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.139, "filter_rmsd": 0.064, "frame": { "rmsd": 0.007, "origin": [ 17.686, 36.139, 18.013 ], "x_axis": [ 0.945, -0.325, 0.019 ], "y_axis": [ -0.038, -0.054, 0.998 ], "z_axis": [ -0.324, -0.944, -0.064 ], "quaternion": [ 0.676, 0.718, -0.127, -0.106 ] } }, { "index": 16, "index_chain": 16, "chain_name": "B", "nt_resnum": 918, "nt_name": "G", "nt_code": "G", "nt_id": "///B/918", "linked_nts": [ "///B/916", "///B/919" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,BII,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": 13.916, "beta": -140.521, "gamma": 40.450, "delta": 85.474, "epsilon": -4.569, "zeta": 136.516, "epsilon_zeta": 218.915, "bb_type": "BII", "chi": -120.110, "glyco_bond": "anti", "C5prime_xyz": [ -3.253, 8.337, -1.966 ], "P_xyz": [ -2.086, 10.682, -2.055 ], "form": ".", "ssZp": 0.675, "Dp": 1.409, "splay_angle": 48.613, "splay_distance": 8.001, "splay_ratio": 0.415, "d22": null, "d64": null, "eta": -60.012, "theta": -177.372, "eta_prime": -78.326, "theta_prime": -156.846, "eta_base": -103.416, "theta_base": -123.109, "v0": -23.393, "v1": -2.682, "v2": 25.567, "v3": -39.980, "v4": 39.965, "amplitude": 41.513, "phase_angle": 51.984, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.009, "frame": { "rmsd": 0.009, "origin": [ 7.517, 42.753, 32.017 ], "x_axis": [ -0.085, 0.977, -0.193 ], "y_axis": [ 0.168, -0.177, -0.970 ], "z_axis": [ -0.982, -0.115, -0.149 ], "quaternion": [ -0.384, 0.557, 0.514, -0.528 ] } }, { "index": 17, "index_chain": 17, "chain_name": "B", "nt_resnum": 919, "nt_name": "G", "nt_code": "G", "nt_id": "///B/919", "linked_nts": [ "///B/918", "///B/920" ], "nt_type": "RNA", "dbn": "[", "summary": "pseudoknotted,anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,kissing-loop,phosphate", "alpha": -110.490, "beta": 150.031, "gamma": 55.342, "delta": 97.722, "epsilon": -160.436, "zeta": 178.578, "epsilon_zeta": 20.986, "bb_type": "--", "chi": -102.718, "glyco_bond": "anti", "C5prime_xyz": [ -2.652, 7.758, -2.818 ], "P_xyz": [ -0.224, 8.227, -3.719 ], "form": ".", "ssZp": 0.982, "Dp": 3.037, "splay_angle": 50.443, "splay_distance": 8.275, "splay_ratio": 0.437, "d22": null, "d64": null, "eta": -169.775, "theta": 123.191, "eta_prime": -155.621, "theta_prime": 109.063, "eta_base": -130.582, "theta_base": 143.574, "v0": -12.193, "v1": -4.735, "v2": 18.555, "v3": -26.570, "v4": 24.233, "amplitude": 26.507, "phase_angle": 45.574, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.029, "frame": { "rmsd": 0.029, "origin": [ 1.320, 39.516, 28.127 ], "x_axis": [ -0.049, 0.669, -0.742 ], "y_axis": [ 0.518, -0.618, -0.591 ], "z_axis": [ -0.854, -0.413, -0.316 ], "quaternion": [ -0.065, 0.687, 0.432, -0.581 ] } }, { "index": 18, "index_chain": 18, "chain_name": "B", "nt_resnum": 920, "nt_name": "U", "nt_code": "U", "nt_id": "///B/920", "linked_nts": [ "///B/919", "///B/921" ], "nt_type": "RNA", "dbn": ".", "summary": "~C3'-endo,non-stack,non-canonical,multiplet,hairpin-loop,kissing-loop,phosphate,splayed-apart", "alpha": -49.747, "beta": 103.821, "gamma": 58.638, "delta": 87.213, "epsilon": -145.444, "zeta": 178.945, "epsilon_zeta": 35.610, "bb_type": "--", "chi": 142.263, "glyco_bond": "--", "C5prime_xyz": [ -3.459, 7.780, 2.502 ], "P_xyz": [ -1.281, 7.401, 3.894 ], "form": ".", "ssZp": 2.058, "Dp": 3.490, "splay_angle": 125.108, "splay_distance": 17.167, "splay_ratio": 0.888, "d22": null, "d64": null, "eta": 162.544, "theta": 103.142, "eta_prime": 169.000, "theta_prime": 92.327, "eta_base": -157.760, "theta_base": 99.274, "v0": -18.891, "v1": -3.461, "v2": 22.966, "v3": -34.745, "v4": 33.660, "amplitude": 35.629, "phase_angle": 49.866, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "3a", "suiteness": 0.010, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 0.625, 32.324, 32.161 ], "x_axis": [ -0.359, 0.866, -0.347 ], "y_axis": [ 0.831, 0.127, -0.542 ], "z_axis": [ -0.426, -0.483, -0.765 ], "quaternion": [ -0.026, 0.565, 0.750, -0.342 ] } }, { "index": 19, "index_chain": 19, "chain_name": "B", "nt_resnum": 921, "nt_name": "A", "nt_code": "A", "nt_id": "///B/921", "linked_nts": [ "///B/920", "///B/922" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,splayed-apart", "alpha": -113.179, "beta": 101.035, "gamma": 154.611, "delta": 87.541, "epsilon": -160.081, "zeta": -123.836, "epsilon_zeta": -36.245, "bb_type": "BI", "chi": -162.929, "glyco_bond": "anti", "C5prime_xyz": [ -1.665, 8.785, 0.672 ], "P_xyz": [ -1.383, 10.315, -1.469 ], "form": ".", "ssZp": 3.901, "Dp": 4.083, "splay_angle": 77.526, "splay_distance": 12.230, "splay_ratio": 0.627, "d22": null, "d64": null, "eta": -124.289, "theta": 97.192, "eta_prime": -144.223, "theta_prime": 121.195, "eta_base": -165.669, "theta_base": 136.499, "v0": -3.296, "v1": -16.474, "v2": 28.769, "v3": -31.791, "v4": 22.086, "amplitude": 31.663, "phase_angle": 24.687, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 16.539, 25.979, 33.246 ], "x_axis": [ -0.162, -0.166, 0.973 ], "y_axis": [ -0.970, -0.154, -0.187 ], "z_axis": [ 0.181, -0.974, -0.136 ], "quaternion": [ 0.370, 0.531, -0.535, 0.543 ] } }, { "index": 20, "index_chain": 20, "chain_name": "B", "nt_resnum": 922, "nt_name": "A", "nt_code": "A", "nt_id": "///B/922", "linked_nts": [ "///B/921", "///B/923" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop", "alpha": -165.392, "beta": 145.838, "gamma": 161.061, "delta": 88.792, "epsilon": -120.424, "zeta": -63.241, "epsilon_zeta": -57.182, "bb_type": "--", "chi": -178.203, "glyco_bond": "anti", "C5prime_xyz": [ -1.159, 8.077, 1.654 ], "P_xyz": [ 0.175, 10.164, 0.871 ], "form": ".", "ssZp": 4.537, "Dp": 4.722, "splay_angle": 33.669, "splay_distance": 5.093, "splay_ratio": 0.290, "d22": null, "d64": null, "eta": -169.350, "theta": -149.475, "eta_prime": 165.693, "theta_prime": -138.522, "eta_base": 152.005, "theta_base": -78.909, "v0": 13.871, "v1": -32.494, "v2": 37.906, "v3": -31.160, "v4": 10.881, "amplitude": 37.932, "phase_angle": 357.877, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.042, "frame": { "rmsd": 0.014, "origin": [ 19.243, 23.591, 21.560 ], "x_axis": [ 0.529, 0.078, 0.845 ], "y_axis": [ -0.840, -0.094, 0.535 ], "z_axis": [ 0.122, -0.992, 0.016 ], "quaternion": [ 0.602, 0.634, -0.300, 0.381 ] } }, { "index": 21, "index_chain": 21, "chain_name": "B", "nt_resnum": 923, "nt_name": "G", "nt_code": "G", "nt_id": "///B/923", "linked_nts": [ "///B/922", "///B/924" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop", "alpha": -54.173, "beta": 164.678, "gamma": 40.580, "delta": 82.167, "epsilon": -142.424, "zeta": -87.126, "epsilon_zeta": -55.297, "bb_type": "BI", "chi": -174.666, "glyco_bond": "anti", "C5prime_xyz": [ -1.236, 8.423, 1.401 ], "P_xyz": [ 1.306, 8.480, 2.016 ], "form": "A", "ssZp": 4.671, "Dp": 4.711, "splay_angle": 24.286, "splay_distance": 3.843, "splay_ratio": 0.217, "d22": null, "d64": null, "eta": 153.583, "theta": -151.566, "eta_prime": -177.819, "theta_prime": -148.954, "eta_base": -97.402, "theta_base": -140.500, "v0": 5.727, "v1": -29.078, "v2": 40.168, "v3": -38.143, "v4": 20.352, "amplitude": 40.899, "phase_angle": 10.848, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.401, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 20.386, 20.392, 25.355 ], "x_axis": [ -0.513, 0.133, 0.848 ], "y_axis": [ -0.858, -0.045, -0.512 ], "z_axis": [ -0.030, -0.990, 0.137 ], "quaternion": [ 0.381, 0.314, -0.577, 0.651 ] } }, { "index": 22, "index_chain": 22, "chain_name": "B", "nt_resnum": 924, "nt_name": "G", "nt_code": "G", "nt_id": "///B/924", "linked_nts": [ "///B/923", "///B/925" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -56.854, "beta": 159.815, "gamma": 56.419, "delta": 77.935, "epsilon": -140.840, "zeta": -73.339, "epsilon_zeta": -67.500, "bb_type": "BI", "chi": -170.164, "glyco_bond": "anti", "C5prime_xyz": [ -1.577, 8.712, 1.062 ], "P_xyz": [ 0.977, 9.234, 1.021 ], "form": "A", "ssZp": 4.595, "Dp": 4.687, "splay_angle": 21.866, "splay_distance": 3.561, "splay_ratio": 0.195, "d22": null, "d64": null, "eta": 172.385, "theta": -140.819, "eta_prime": -178.333, "theta_prime": -140.767, "eta_base": -159.080, "theta_base": -108.215, "v0": -1.318, "v1": -25.654, "v2": 41.666, "v3": -43.323, "v4": 28.064, "amplitude": 44.383, "phase_angle": 20.149, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.739, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 22.765, 17.607, 26.517 ], "x_axis": [ -0.784, 0.108, 0.611 ], "y_axis": [ -0.620, -0.175, -0.765 ], "z_axis": [ 0.024, -0.979, 0.205 ], "quaternion": [ 0.248, 0.216, -0.593, 0.736 ] } }, { "index": 23, "index_chain": 23, "chain_name": "B", "nt_resnum": 925, "nt_name": "C", "nt_code": "C", "nt_id": "///B/925", "linked_nts": [ "///B/924", "///B/926" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop", "alpha": -63.307, "beta": 161.835, "gamma": 57.665, "delta": 74.322, "epsilon": -146.637, "zeta": -64.434, "epsilon_zeta": -82.203, "bb_type": "BI", "chi": -167.360, "glyco_bond": "anti", "C5prime_xyz": [ -1.631, 8.808, 0.871 ], "P_xyz": [ 0.912, 9.483, 0.642 ], "form": ".", "ssZp": 4.574, "Dp": 4.684, "splay_angle": 28.120, "splay_distance": 4.416, "splay_ratio": 0.247, "d22": null, "d64": null, "eta": 161.234, "theta": -139.785, "eta_prime": 178.066, "theta_prime": -138.764, "eta_base": -129.359, "theta_base": -101.622, "v0": -4.345, "v1": -22.470, "v2": 39.824, "v3": -42.996, "v4": 29.597, "amplitude": 43.579, "phase_angle": 23.960, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.807, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 22.197, 15.357, 29.218 ], "x_axis": [ -0.999, 0.024, 0.041 ], "y_axis": [ -0.047, -0.333, -0.942 ], "z_axis": [ -0.009, -0.943, 0.334 ], "quaternion": [ 0.022, 0.010, -0.577, 0.816 ] } }, { "index": 24, "index_chain": 24, "chain_name": "B", "nt_resnum": 926, "nt_name": "A", "nt_code": "A", "nt_id": "///B/926", "linked_nts": [ "///B/925", "///B/927" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop", "alpha": -68.318, "beta": -174.845, "gamma": 52.088, "delta": 77.132, "epsilon": -149.251, "zeta": -65.908, "epsilon_zeta": -83.343, "bb_type": "BI", "chi": -158.682, "glyco_bond": "anti", "C5prime_xyz": [ -1.269, 8.716, 0.465 ], "P_xyz": [ 1.291, 9.258, 0.395 ], "form": "A", "ssZp": 4.503, "Dp": 4.733, "splay_angle": 27.640, "splay_distance": 4.311, "splay_ratio": 0.243, "d22": null, "d64": null, "eta": 167.112, "theta": -143.118, "eta_prime": -179.118, "theta_prime": -137.887, "eta_base": -124.834, "theta_base": -101.516, "v0": 1.537, "v1": -28.170, "v2": 42.968, "v3": -42.812, "v4": 26.046, "amplitude": 44.811, "phase_angle": 16.492, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.800, "filter_rmsd": 0.040, "frame": { "rmsd": 0.015, "origin": [ 19.314, 12.666, 31.206 ], "x_axis": [ -0.753, -0.149, -0.641 ], "y_axis": [ 0.644, -0.364, -0.672 ], "z_axis": [ -0.133, -0.919, 0.370 ], "quaternion": [ -0.252, -0.246, -0.505, 0.788 ] } }, { "index": 25, "index_chain": 25, "chain_name": "B", "nt_resnum": 927, "nt_name": "C", "nt_code": "C", "nt_id": "///B/927", "linked_nts": [ "///B/926", "///B/928" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -57.856, "beta": 178.445, "gamma": 50.226, "delta": 82.318, "epsilon": -148.535, "zeta": -69.109, "epsilon_zeta": -79.426, "bb_type": "BI", "chi": -163.656, "glyco_bond": "anti", "C5prime_xyz": [ -1.372, 8.739, 0.730 ], "P_xyz": [ 1.194, 9.121, 1.163 ], "form": "A", "ssZp": 4.507, "Dp": 4.626, "splay_angle": 27.546, "splay_distance": 4.358, "splay_ratio": 0.240, "d22": 4.167, "d64": 4.322, "eta": 174.135, "theta": -140.176, "eta_prime": -169.826, "theta_prime": -137.820, "eta_base": -120.131, "theta_base": -106.984, "v0": 0.061, "v1": -24.457, "v2": 38.225, "v3": -39.293, "v4": 24.605, "amplitude": 40.310, "phase_angle": 18.507, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.898, "filter_rmsd": 0.062, "frame": { "rmsd": 0.003, "origin": [ 16.101, 9.809, 30.895 ], "x_axis": [ -0.078, -0.049, -0.996 ], "y_axis": [ 0.962, -0.264, -0.062 ], "z_axis": [ -0.260, -0.963, 0.068 ], "quaternion": [ -0.426, -0.529, -0.432, 0.594 ] } }, { "index": 26, "index_chain": 26, "chain_name": "B", "nt_resnum": 928, "nt_name": "C", "nt_code": "C", "nt_id": "///B/928", "linked_nts": [ "///B/927", "///B/929" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.303, "beta": -178.517, "gamma": 42.313, "delta": 78.831, "epsilon": -157.260, "zeta": -103.684, "epsilon_zeta": -53.576, "bb_type": "BI", "chi": -162.591, "glyco_bond": "anti", "C5prime_xyz": [ -1.314, 8.716, 0.615 ], "P_xyz": [ 1.193, 9.195, 1.209 ], "form": "A", "ssZp": 4.454, "Dp": 4.644, "splay_angle": 25.454, "splay_distance": 3.960, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 166.577, "theta": -146.267, "eta_prime": -179.720, "theta_prime": -148.392, "eta_base": -133.435, "theta_base": -123.683, "v0": 2.549, "v1": -27.255, "v2": 40.334, "v3": -39.953, "v4": 23.563, "amplitude": 41.795, "phase_angle": 15.194, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.753, "filter_rmsd": 0.062, "frame": { "rmsd": 0.010, "origin": [ 13.973, 6.319, 29.385 ], "x_axis": [ 0.580, 0.023, -0.815 ], "y_axis": [ 0.807, -0.154, 0.570 ], "z_axis": [ -0.112, -0.988, -0.108 ], "quaternion": [ 0.574, 0.678, 0.306, -0.342 ] } }, { "index": 27, "index_chain": 27, "chain_name": "B", "nt_resnum": 929, "nt_name": "G", "nt_code": "G", "nt_id": "///B/929", "linked_nts": [ "///B/928", "///B/930" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 149.063, "beta": -137.246, "gamma": 169.129, "delta": 85.206, "epsilon": -118.723, "zeta": -86.245, "epsilon_zeta": -32.478, "bb_type": "--", "chi": 170.313, "glyco_bond": "anti", "C5prime_xyz": [ -1.117, 7.811, 2.248 ], "P_xyz": [ 0.909, 9.070, 1.133 ], "form": "A", "ssZp": 4.906, "Dp": 4.853, "splay_angle": 24.442, "splay_distance": 3.875, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 163.569, "theta": -147.001, "eta_prime": 176.461, "theta_prime": -149.901, "eta_base": -142.592, "theta_base": -134.029, "v0": 13.675, "v1": -33.487, "v2": 39.839, "v3": -33.009, "v4": 12.179, "amplitude": 39.844, "phase_angle": 359.078, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.201, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 12.746, 3.093, 27.443 ], "x_axis": [ 0.898, 0.042, -0.438 ], "y_axis": [ 0.440, -0.133, 0.888 ], "z_axis": [ -0.021, -0.990, -0.138 ], "quaternion": [ 0.638, 0.736, 0.164, -0.156 ] } }, { "index": 28, "index_chain": 28, "chain_name": "B", "nt_resnum": 930, "nt_name": "G", "nt_code": "G", "nt_id": "///B/930", "linked_nts": [ "///B/929", "///B/931" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -73.098, "beta": 169.032, "gamma": 56.640, "delta": 79.396, "epsilon": -176.459, "zeta": -58.113, "epsilon_zeta": -118.346, "bb_type": "BI", "chi": -177.507, "glyco_bond": "anti", "C5prime_xyz": [ -1.629, 8.538, 1.595 ], "P_xyz": [ 0.933, 9.105, 1.728 ], "form": "A", "ssZp": 4.662, "Dp": 4.507, "splay_angle": 29.740, "splay_distance": 4.256, "splay_ratio": 0.260, "d22": null, "d64": null, "eta": 151.123, "theta": -152.879, "eta_prime": 168.756, "theta_prime": -150.395, "eta_base": -152.204, "theta_base": -120.567, "v0": -0.109, "v1": -25.995, "v2": 41.014, "v3": -41.819, "v4": 26.397, "amplitude": 43.258, "phase_angle": 18.539, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.467, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 12.239, 0.715, 24.426 ], "x_axis": [ 0.978, 0.147, 0.149 ], "y_axis": [ -0.118, -0.200, 0.973 ], "z_axis": [ 0.172, -0.969, -0.178 ], "quaternion": [ 0.632, 0.768, 0.009, 0.105 ] } }, { "index": 29, "index_chain": 29, "chain_name": "B", "nt_resnum": 931, "nt_name": "A", "nt_code": "A", "nt_id": "///B/931", "linked_nts": [ "///B/930", "///B/932" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -81.522, "beta": -141.109, "gamma": 47.850, "delta": 82.775, "epsilon": -169.441, "zeta": -91.683, "epsilon_zeta": -77.758, "bb_type": "BI", "chi": -164.436, "glyco_bond": "anti", "C5prime_xyz": [ -1.017, 8.428, 0.888 ], "P_xyz": [ 1.320, 8.187, 2.049 ], "form": "A", "ssZp": 4.610, "Dp": 4.580, "splay_angle": 21.959, "splay_distance": 3.427, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": -179.910, "theta": -140.664, "eta_prime": -175.488, "theta_prime": -141.116, "eta_base": -137.962, "theta_base": -122.709, "v0": 8.305, "v1": -30.269, "v2": 39.928, "v3": -36.191, "v4": 17.531, "amplitude": 40.231, "phase_angle": 7.028, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.303, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 14.076, -2.267, 22.008 ], "x_axis": [ 0.650, 0.099, 0.754 ], "y_axis": [ -0.740, -0.147, 0.657 ], "z_axis": [ 0.176, -0.984, -0.022 ], "quaternion": [ 0.609, 0.674, -0.238, 0.345 ] } }, { "index": 30, "index_chain": 30, "chain_name": "B", "nt_resnum": 932, "nt_name": "U", "nt_code": "U", "nt_id": "///B/932", "linked_nts": [ "///B/931", "///B/933" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop", "alpha": 157.440, "beta": -139.337, "gamma": 165.627, "delta": 83.352, "epsilon": -135.761, "zeta": -59.582, "epsilon_zeta": -76.179, "bb_type": "BI", "chi": 178.265, "glyco_bond": "anti", "C5prime_xyz": [ -1.106, 8.024, 1.875 ], "P_xyz": [ 0.967, 9.076, 0.670 ], "form": "A", "ssZp": 4.779, "Dp": 4.787, "splay_angle": 24.144, "splay_distance": 3.736, "splay_ratio": 0.216, "d22": 4.027, "d64": 3.696, "eta": 165.175, "theta": -132.076, "eta_prime": -178.300, "theta_prime": -135.509, "eta_base": -140.321, "theta_base": -95.030, "v0": 13.067, "v1": -33.029, "v2": 39.818, "v3": -33.258, "v4": 12.713, "amplitude": 39.818, "phase_angle": 359.941, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.391, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ 16.349, -4.617, 20.981 ], "x_axis": [ 0.285, -0.059, 0.957 ], "y_axis": [ -0.920, -0.296, 0.256 ], "z_axis": [ 0.268, -0.953, -0.138 ], "quaternion": [ 0.461, 0.656, -0.373, 0.467 ] } }, { "index": 31, "index_chain": 31, "chain_name": "B", "nt_resnum": 933, "nt_name": "U", "nt_code": "U", "nt_id": "///B/933", "linked_nts": [ "///B/932", "///B/934" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart", "alpha": -72.633, "beta": -166.891, "gamma": 45.170, "delta": 82.271, "epsilon": -119.224, "zeta": -111.925, "epsilon_zeta": -7.298, "bb_type": "--", "chi": -154.958, "glyco_bond": "anti", "C5prime_xyz": [ -1.161, 8.649, 0.248 ], "P_xyz": [ 1.372, 8.978, 0.887 ], "form": ".", "ssZp": 4.065, "Dp": 4.801, "splay_angle": 106.899, "splay_distance": 16.213, "splay_ratio": 0.805, "d22": 11.676, "d64": 15.026, "eta": 169.083, "theta": -134.534, "eta_prime": -175.696, "theta_prime": -162.120, "eta_base": -118.568, "theta_base": -172.921, "v0": 5.647, "v1": -28.492, "v2": 39.262, "v3": -37.121, "v4": 19.900, "amplitude": 39.959, "phase_angle": 10.723, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.683, "filter_rmsd": 0.105, "frame": { "rmsd": 0.003, "origin": [ 18.526, -6.874, 23.012 ], "x_axis": [ -0.576, -0.143, 0.805 ], "y_axis": [ -0.744, -0.315, -0.589 ], "z_axis": [ 0.338, -0.938, 0.075 ], "quaternion": [ 0.214, 0.407, -0.544, 0.701 ] } }, { "index": 32, "index_chain": 32, "chain_name": "B", "nt_resnum": 934, "nt_name": "C", "nt_code": "C", "nt_id": "///B/934", "linked_nts": [ "///B/933", "///B/935" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,BII,hairpin-loop,splayed-apart", "alpha": 84.691, "beta": -153.810, "gamma": 64.643, "delta": 104.032, "epsilon": -103.225, "zeta": -177.971, "epsilon_zeta": 74.746, "bb_type": "BII", "chi": -154.668, "glyco_bond": "anti", "C5prime_xyz": [ -2.938, 8.929, -0.673 ], "P_xyz": [ -1.668, 10.719, 0.808 ], "form": ".", "ssZp": 1.100, "Dp": 1.560, "splay_angle": 92.053, "splay_distance": 14.501, "splay_ratio": 0.720, "d22": 11.048, "d64": 13.377, "eta": 1.164, "theta": 177.452, "eta_prime": 9.053, "theta_prime": -165.868, "eta_base": -18.177, "theta_base": -139.093, "v0": -33.786, "v1": 18.489, "v2": 2.561, "v3": -21.908, "v4": 34.667, "amplitude": 35.460, "phase_angle": 85.858, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33p", "cluster": "7d", "suiteness": 0.098, "filter_rmsd": 0.061, "frame": { "rmsd": 0.014, "origin": [ 23.295, -19.036, 13.409 ], "x_axis": [ -0.523, -0.724, -0.450 ], "y_axis": [ -0.851, 0.413, 0.325 ], "z_axis": [ -0.050, 0.553, -0.832 ], "quaternion": [ 0.120, -0.473, 0.832, 0.264 ] } }, { "index": 33, "index_chain": 33, "chain_name": "B", "nt_resnum": 935, "nt_name": "U", "nt_code": "U", "nt_id": "///B/935", "linked_nts": [ "///B/934", "///B/936" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-pair-contact,hairpin-loop,phosphate,splayed-apart", "alpha": -8.364, "beta": 144.466, "gamma": 56.570, "delta": 100.859, "epsilon": -84.321, "zeta": -33.991, "epsilon_zeta": -50.330, "bb_type": "--", "chi": -145.440, "glyco_bond": "anti", "C5prime_xyz": [ -2.528, 8.849, -0.743 ], "P_xyz": [ -0.033, 9.772, -0.767 ], "form": ".", "ssZp": 1.810, "Dp": 2.602, "splay_angle": 152.405, "splay_distance": 18.313, "splay_ratio": 0.972, "d22": null, "d64": null, "eta": -93.432, "theta": -53.522, "eta_prime": -102.299, "theta_prime": -108.478, "eta_base": -102.363, "theta_base": -168.184, "v0": -21.781, "v1": 4.040, "v2": 13.783, "v3": -26.806, "v4": 30.350, "amplitude": 30.280, "phase_angle": 62.922, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.105, "frame": { "rmsd": 0.012, "origin": [ 26.244, -4.839, 13.308 ], "x_axis": [ -0.715, 0.313, -0.625 ], "y_axis": [ -0.681, -0.513, 0.522 ], "z_axis": [ -0.157, 0.799, 0.580 ], "quaternion": [ 0.297, -0.233, 0.394, 0.838 ] } }, { "index": 34, "index_chain": 34, "chain_name": "B", "nt_resnum": 936, "nt_name": "G", "nt_code": "G", "nt_id": "///B/936", "linked_nts": [ "///B/935", "///B/937" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,non-stack,hairpin-loop,phosphate,splayed-apart", "alpha": -64.893, "beta": -88.946, "gamma": 148.199, "delta": 105.371, "epsilon": -136.413, "zeta": 24.166, "epsilon_zeta": 199.421, "bb_type": "--", "chi": -116.291, "glyco_bond": "anti", "C5prime_xyz": [ -3.189, 8.237, -2.059 ], "P_xyz": [ -0.806, 7.723, -3.094 ], "form": ".", "ssZp": 1.543, "Dp": 2.037, "splay_angle": 119.900, "splay_distance": 16.737, "splay_ratio": 0.866, "d22": null, "d64": null, "eta": -54.725, "theta": -9.709, "eta_prime": 25.357, "theta_prime": -28.011, "eta_base": 71.647, "theta_base": 13.778, "v0": -29.480, "v1": 17.909, "v2": -0.515, "v3": -16.321, "v4": 28.564, "amplitude": 29.986, "phase_angle": 90.985, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 24.572, -10.974, 30.481 ], "x_axis": [ 0.914, -0.399, -0.071 ], "y_axis": [ 0.130, 0.455, -0.881 ], "z_axis": [ 0.384, 0.796, 0.468 ], "quaternion": [ 0.842, -0.498, 0.135, -0.157 ] } }, { "index": 35, "index_chain": 35, "chain_name": "B", "nt_resnum": 937, "nt_name": "A", "nt_code": "A", "nt_id": "///B/937", "linked_nts": [ "///B/936", "///B/938" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart", "alpha": -102.672, "beta": -158.000, "gamma": 54.121, "delta": 81.760, "epsilon": -143.608, "zeta": -62.411, "epsilon_zeta": -81.197, "bb_type": "BI", "chi": -170.184, "glyco_bond": "anti", "C5prime_xyz": [ -1.514, 8.522, 1.124 ], "P_xyz": [ 0.926, 8.627, 2.101 ], "form": ".", "ssZp": 4.648, "Dp": 4.704, "splay_angle": 36.306, "splay_distance": 5.419, "splay_ratio": 0.312, "d22": null, "d64": null, "eta": 158.723, "theta": -128.253, "eta_prime": -159.577, "theta_prime": -121.794, "eta_base": -151.893, "theta_base": -82.873, "v0": 5.289, "v1": -29.369, "v2": 41.129, "v3": -39.052, "v4": 21.286, "amplitude": 41.967, "phase_angle": 11.468, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.007, "origin": [ 19.548, -5.483, 15.490 ], "x_axis": [ -0.729, -0.580, 0.364 ], "y_axis": [ 0.390, 0.085, 0.917 ], "z_axis": [ -0.563, 0.810, 0.164 ], "quaternion": [ -0.361, -0.074, 0.642, 0.672 ] } }, { "index": 36, "index_chain": 36, "chain_name": "B", "nt_resnum": 938, "nt_name": "U", "nt_code": "U", "nt_id": "///B/938", "linked_nts": [ "///B/937", "///B/939" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop", "alpha": -51.559, "beta": 163.284, "gamma": 56.322, "delta": 82.789, "epsilon": -128.467, "zeta": -59.927, "epsilon_zeta": -68.540, "bb_type": "--", "chi": 170.120, "glyco_bond": "anti", "C5prime_xyz": [ -1.777, 8.113, 2.168 ], "P_xyz": [ 0.727, 8.328, 2.893 ], "form": ".", "ssZp": 4.695, "Dp": 4.710, "splay_angle": 34.623, "splay_distance": 5.215, "splay_ratio": 0.300, "d22": 3.526, "d64": 3.529, "eta": 177.918, "theta": -114.136, "eta_prime": -158.935, "theta_prime": -111.378, "eta_base": -95.954, "theta_base": -60.183, "v0": 4.264, "v1": -27.680, "v2": 39.112, "v3": -37.888, "v4": 21.224, "amplitude": 40.096, "phase_angle": 12.718, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.788, "filter_rmsd": 0.103, "frame": { "rmsd": 0.004, "origin": [ 14.815, -3.800, 17.522 ], "x_axis": [ -0.138, -0.379, 0.915 ], "y_axis": [ 0.939, 0.245, 0.243 ], "z_axis": [ -0.316, 0.892, 0.322 ], "quaternion": [ 0.598, -0.272, -0.515, -0.551 ] } }, { "index": 37, "index_chain": 37, "chain_name": "B", "nt_resnum": 939, "nt_name": "U", "nt_code": "U", "nt_id": "///B/939", "linked_nts": [ "///B/938", "///B/940" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -68.440, "beta": 176.397, "gamma": 48.242, "delta": 86.156, "epsilon": -153.304, "zeta": -70.808, "epsilon_zeta": -82.496, "bb_type": "BI", "chi": -172.314, "glyco_bond": "anti", "C5prime_xyz": [ -1.505, 8.517, 1.260 ], "P_xyz": [ 0.994, 8.731, 2.103 ], "form": "A", "ssZp": 4.514, "Dp": 4.548, "splay_angle": 26.495, "splay_distance": 3.972, "splay_ratio": 0.229, "d22": 3.661, "d64": 3.894, "eta": 155.023, "theta": -140.456, "eta_prime": -177.079, "theta_prime": -138.809, "eta_base": -97.414, "theta_base": -96.933, "v0": 3.496, "v1": -25.357, "v2": 36.223, "v3": -35.312, "v4": 20.031, "amplitude": 37.231, "phase_angle": 13.367, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.695, "filter_rmsd": 0.104, "frame": { "rmsd": 0.006, "origin": [ 13.975, -1.728, 22.233 ], "x_axis": [ 0.827, -0.060, 0.560 ], "y_axis": [ 0.542, 0.354, -0.762 ], "z_axis": [ -0.153, 0.933, 0.325 ], "quaternion": [ 0.792, -0.535, -0.225, -0.190 ] } }, { "index": 38, "index_chain": 38, "chain_name": "B", "nt_resnum": 940, "nt_name": "C", "nt_code": "C", "nt_id": "///B/940", "linked_nts": [ "///B/939", "///B/941" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -62.392, "beta": 163.858, "gamma": 54.925, "delta": 84.694, "epsilon": -108.775, "zeta": -147.609, "epsilon_zeta": 38.834, "bb_type": "--", "chi": 174.105, "glyco_bond": "anti", "C5prime_xyz": [ -1.567, 8.243, 1.938 ], "P_xyz": [ 0.991, 8.251, 2.633 ], "form": ".", "ssZp": 4.613, "Dp": 4.713, "splay_angle": 24.097, "splay_distance": 3.856, "splay_ratio": 0.212, "d22": 4.991, "d64": 5.393, "eta": 176.513, "theta": -144.177, "eta_prime": -168.396, "theta_prime": -148.542, "eta_base": -110.132, "theta_base": -155.791, "v0": 6.301, "v1": -28.302, "v2": 38.430, "v3": -35.864, "v4": 18.606, "amplitude": 38.969, "phase_angle": 9.535, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.884, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 14.226, 1.347, 24.734 ], "x_axis": [ 0.981, 0.153, -0.118 ], "y_axis": [ -0.135, 0.105, -0.985 ], "z_axis": [ -0.139, 0.983, 0.124 ], "quaternion": [ 0.743, -0.662, -0.007, 0.097 ] } }, { "index": 39, "index_chain": 39, "chain_name": "B", "nt_resnum": 941, "nt_name": "C", "nt_code": "C", "nt_id": "///B/941", "linked_nts": [ "///B/940", "///B/942" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 105.840, "beta": -105.181, "gamma": 179.051, "delta": 82.637, "epsilon": -129.945, "zeta": -69.053, "epsilon_zeta": -60.892, "bb_type": "BI", "chi": 173.772, "glyco_bond": "anti", "C5prime_xyz": [ -1.618, 8.269, 2.037 ], "P_xyz": [ 0.098, 9.423, 0.444 ], "form": "A", "ssZp": 4.652, "Dp": 4.653, "splay_angle": 25.716, "splay_distance": 4.190, "splay_ratio": 0.230, "d22": null, "d64": null, "eta": 159.563, "theta": -141.961, "eta_prime": 171.555, "theta_prime": -149.356, "eta_base": 178.078, "theta_base": -121.521, "v0": 2.805, "v1": -25.912, "v2": 38.175, "v3": -37.653, "v4": 21.849, "amplitude": 39.464, "phase_angle": 14.682, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 12.239, 2.880, 27.661 ], "x_axis": [ 0.939, 0.171, -0.299 ], "y_axis": [ -0.338, 0.285, -0.897 ], "z_axis": [ -0.068, 0.943, 0.326 ], "quaternion": [ 0.798, -0.576, 0.072, 0.159 ] } }, { "index": 40, "index_chain": 40, "chain_name": "B", "nt_resnum": 942, "nt_name": "G", "nt_code": "G", "nt_id": "///B/942", "linked_nts": [ "///B/941", "///B/943" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.435, "beta": 179.442, "gamma": 41.907, "delta": 78.371, "epsilon": -156.880, "zeta": -77.911, "epsilon_zeta": -78.968, "bb_type": "BI", "chi": -177.402, "glyco_bond": "anti", "C5prime_xyz": [ -1.911, 8.585, 1.512 ], "P_xyz": [ 0.351, 9.297, 2.577 ], "form": "A", "ssZp": 4.715, "Dp": 4.575, "splay_angle": 27.425, "splay_distance": 4.219, "splay_ratio": 0.241, "d22": null, "d64": null, "eta": 152.951, "theta": -160.375, "eta_prime": 169.687, "theta_prime": -154.781, "eta_base": -139.202, "theta_base": -126.039, "v0": -4.961, "v1": -21.072, "v2": 37.441, "v3": -41.606, "v4": 29.311, "amplitude": 41.461, "phase_angle": 25.436, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.653, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 14.136, 5.902, 29.857 ], "x_axis": [ 0.519, 0.045, -0.853 ], "y_axis": [ -0.854, -0.013, -0.520 ], "z_axis": [ -0.035, 0.999, 0.032 ], "quaternion": [ 0.620, -0.612, 0.330, 0.363 ] } }, { "index": 41, "index_chain": 41, "chain_name": "B", "nt_resnum": 943, "nt_name": "G", "nt_code": "G", "nt_id": "///B/943", "linked_nts": [ "///B/942", "///B/944" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -56.669, "beta": 176.476, "gamma": 50.898, "delta": 70.295, "epsilon": 83.538, "zeta": 54.694, "epsilon_zeta": 28.844, "bb_type": "--", "chi": -168.335, "glyco_bond": "anti", "C5prime_xyz": [ -1.294, 8.632, 1.032 ], "P_xyz": [ 1.276, 8.955, 1.378 ], "form": "A", "ssZp": 3.576, "Dp": 3.524, "splay_angle": 20.945, "splay_distance": 3.510, "splay_ratio": 0.184, "d22": null, "d64": null, "eta": -161.614, "theta": -122.588, "eta_prime": -148.913, "theta_prime": -135.833, "eta_base": -117.091, "theta_base": -108.397, "v0": 6.222, "v1": -29.676, "v2": 40.931, "v3": -38.313, "v4": 20.299, "amplitude": 41.591, "phase_angle": 10.221, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.641, "filter_rmsd": 0.007, "frame": { "rmsd": 0.007, "origin": [ 16.176, 9.468, 30.817 ], "x_axis": [ -0.023, 0.148, -0.989 ], "y_axis": [ -0.997, -0.071, 0.012 ], "z_axis": [ -0.069, 0.986, 0.149 ], "quaternion": [ 0.514, -0.474, 0.448, 0.558 ] } }, { "index": 42, "index_chain": 42, "chain_name": "B", "nt_resnum": 944, "nt_name": "A", "nt_code": "A", "nt_id": "///B/944", "linked_nts": [ "///B/943", "///B/945" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate", "alpha": 96.240, "beta": -176.396, "gamma": 162.946, "delta": 92.158, "epsilon": -85.680, "zeta": -135.741, "epsilon_zeta": 50.061, "bb_type": "--", "chi": -167.978, "glyco_bond": "anti", "C5prime_xyz": [ -1.097, 8.370, 1.059 ], "P_xyz": [ 0.786, 9.783, -0.102 ], "form": "B", "ssZp": 3.846, "Dp": 4.502, "splay_angle": 19.581, "splay_distance": 3.228, "splay_ratio": 0.171, "d22": null, "d64": null, "eta": 163.704, "theta": -146.341, "eta_prime": -178.873, "theta_prime": -147.529, "eta_base": -135.897, "theta_base": -116.987, "v0": 9.832, "v1": -28.664, "v2": 35.367, "v3": -31.100, "v4": 13.419, "amplitude": 35.421, "phase_angle": 3.167, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.038, "frame": { "rmsd": 0.008, "origin": [ 17.149, 12.841, 30.885 ], "x_axis": [ -0.585, 0.164, -0.794 ], "y_axis": [ -0.811, -0.108, 0.575 ], "z_axis": [ 0.008, 0.981, 0.196 ], "quaternion": [ 0.355, -0.286, 0.566, 0.687 ] } }, { "index": 43, "index_chain": 43, "chain_name": "B", "nt_resnum": 945, "nt_name": "G", "nt_code": "G", "nt_id": "///B/945", "linked_nts": [ "///B/944", "///B/946" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,ribose-zipper", "alpha": 86.995, "beta": -97.269, "gamma": -177.052, "delta": 85.414, "epsilon": -103.050, "zeta": -93.198, "epsilon_zeta": -9.852, "bb_type": "--", "chi": -168.317, "glyco_bond": "anti", "C5prime_xyz": [ -1.133, 8.519, 1.057 ], "P_xyz": [ 0.168, 9.145, -1.118 ], "form": ".", "ssZp": 4.135, "Dp": 4.674, "splay_angle": 40.300, "splay_distance": 6.428, "splay_ratio": 0.345, "d22": null, "d64": null, "eta": 156.977, "theta": -149.271, "eta_prime": 176.664, "theta_prime": -144.045, "eta_base": -142.069, "theta_base": -124.568, "v0": 7.182, "v1": -28.153, "v2": 37.596, "v3": -34.584, "v4": 17.156, "amplitude": 37.972, "phase_angle": 8.070, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 16.737, 16.042, 30.817 ], "x_axis": [ -0.885, 0.014, -0.465 ], "y_axis": [ -0.465, 0.031, 0.885 ], "z_axis": [ 0.027, 0.999, -0.021 ], "quaternion": [ 0.177, -0.162, 0.696, 0.677 ] } }, { "index": 44, "index_chain": 44, "chain_name": "B", "nt_resnum": 946, "nt_name": "G", "nt_code": "G", "nt_id": "///B/946", "linked_nts": [ "///B/945", "///B/948" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,ribose-zipper", "alpha": -55.175, "beta": -179.474, "gamma": 47.586, "delta": 80.952, "epsilon": -160.227, "zeta": -71.849, "epsilon_zeta": -88.378, "bb_type": "BI", "chi": -121.167, "glyco_bond": "anti", "C5prime_xyz": [ -1.808, 8.496, -1.638 ], "P_xyz": [ 0.647, 8.913, -2.494 ], "form": ".", "ssZp": 2.698, "Dp": 4.526, "splay_angle": 45.732, "splay_distance": 8.052, "splay_ratio": 0.392, "d22": null, "d64": null, "eta": 172.338, "theta": -156.990, "eta_prime": -174.883, "theta_prime": -158.902, "eta_base": -150.451, "theta_base": -166.735, "v0": -4.632, "v1": -20.854, "v2": 37.161, "v3": -40.625, "v4": 28.434, "amplitude": 40.935, "phase_angle": 24.796, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.104, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 14.762, 22.102, 29.982 ], "x_axis": [ -0.978, -0.163, 0.134 ], "y_axis": [ 0.120, 0.094, 0.988 ], "z_axis": [ -0.173, 0.982, -0.072 ], "quaternion": [ -0.105, -0.015, 0.732, 0.673 ] } }, { "index": 45, "index_chain": 45, "chain_name": "B", "nt_resnum": 948, "nt_name": "U", "nt_code": "U", "nt_id": "///B/948", "linked_nts": [ "///B/946", "///B/949" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart", "alpha": -99.475, "beta": 148.705, "gamma": 156.766, "delta": 96.010, "epsilon": -175.102, "zeta": 136.066, "epsilon_zeta": 48.832, "bb_type": "--", "chi": -166.634, "glyco_bond": "anti", "C5prime_xyz": [ -2.726, 8.887, 0.217 ], "P_xyz": [ -1.460, 10.687, -1.223 ], "form": ".", "ssZp": 1.978, "Dp": 2.595, "splay_angle": 140.063, "splay_distance": 16.910, "splay_ratio": 0.940, "d22": 11.587, "d64": 14.018, "eta": -110.277, "theta": 21.152, "eta_prime": -121.406, "theta_prime": 21.594, "eta_base": -135.898, "theta_base": -157.484, "v0": -25.517, "v1": 10.456, "v2": 7.379, "v3": -22.517, "v4": 30.082, "amplitude": 29.710, "phase_angle": 75.619, "puckering": "O4'-endo", "sugar_class": "--", "bin": "33t", "cluster": "1e", "suiteness": 0.010, "filter_rmsd": 0.107, "frame": { "rmsd": 0.012, "origin": [ 14.394, 30.082, 28.983 ], "x_axis": [ -0.962, -0.268, -0.042 ], "y_axis": [ 0.052, -0.331, 0.942 ], "z_axis": [ -0.266, 0.905, 0.333 ], "quaternion": [ -0.099, -0.095, 0.570, 0.810 ] } }, { "index": 46, "index_chain": 46, "chain_name": "B", "nt_resnum": 949, "nt_name": "C", "nt_code": "C", "nt_id": "///B/949", "linked_nts": [ "///B/948", "///B/950" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart", "alpha": 19.370, "beta": -170.517, "gamma": 48.359, "delta": 87.834, "epsilon": -144.111, "zeta": -78.768, "epsilon_zeta": -65.343, "bb_type": "BI", "chi": -166.775, "glyco_bond": "anti", "C5prime_xyz": [ -0.920, 8.429, 1.027 ], "P_xyz": [ 1.543, 8.218, 1.919 ], "form": "A", "ssZp": 4.530, "Dp": 4.654, "splay_angle": 28.953, "splay_distance": 4.527, "splay_ratio": 0.251, "d22": null, "d64": null, "eta": -72.327, "theta": -139.378, "eta_prime": -62.007, "theta_prime": -134.090, "eta_base": 134.140, "theta_base": -114.582, "v0": 9.499, "v1": -29.406, "v2": 37.235, "v3": -32.858, "v4": 14.811, "amplitude": 37.343, "phase_angle": 4.373, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.063, "frame": { "rmsd": 0.006, "origin": [ 25.286, 37.533, 39.556 ], "x_axis": [ -0.230, 0.422, -0.877 ], "y_axis": [ -0.343, -0.879, -0.332 ], "z_axis": [ -0.911, 0.225, 0.347 ], "quaternion": [ 0.244, -0.570, -0.034, 0.783 ] } }, { "index": 47, "index_chain": 47, "chain_name": "B", "nt_resnum": 950, "nt_name": "G", "nt_code": "G", "nt_id": "///B/950", "linked_nts": [ "///B/949", "///B/951" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -49.581, "beta": 169.189, "gamma": 46.133, "delta": 84.765, "epsilon": -152.811, "zeta": -63.872, "epsilon_zeta": -88.939, "bb_type": "BI", "chi": -164.777, "glyco_bond": "anti", "C5prime_xyz": [ -1.523, 8.712, 0.841 ], "P_xyz": [ 1.032, 9.040, 1.350 ], "form": "A", "ssZp": 4.479, "Dp": 4.507, "splay_angle": 19.718, "splay_distance": 3.303, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": 174.558, "theta": -134.607, "eta_prime": -170.268, "theta_prime": -134.501, "eta_base": -138.228, "theta_base": -104.512, "v0": -1.987, "v1": -21.560, "v2": 35.724, "v3": -37.870, "v4": 24.997, "amplitude": 38.394, "phase_angle": 21.493, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.680, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 21.828, 40.009, 41.107 ], "x_axis": [ -0.261, -0.071, -0.963 ], "y_axis": [ -0.094, -0.991, 0.099 ], "z_axis": [ -0.961, 0.116, 0.252 ], "quaternion": [ 0.007, -0.608, 0.068, 0.791 ] } }, { "index": 48, "index_chain": 48, "chain_name": "B", "nt_resnum": 951, "nt_name": "A", "nt_code": "A", "nt_id": "///B/951", "linked_nts": [ "///B/950", "///B/952" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -67.362, "beta": 178.556, "gamma": 49.050, "delta": 78.296, "epsilon": -175.745, "zeta": -37.789, "epsilon_zeta": -137.957, "bb_type": "BI", "chi": -149.728, "glyco_bond": "anti", "C5prime_xyz": [ -1.764, 8.872, -0.150 ], "P_xyz": [ 0.707, 9.726, -0.107 ], "form": ".", "ssZp": 4.126, "Dp": 4.396, "splay_angle": 19.989, "splay_distance": 3.633, "splay_ratio": 0.187, "d22": null, "d64": null, "eta": 162.041, "theta": -128.275, "eta_prime": -179.461, "theta_prime": -142.680, "eta_base": -131.040, "theta_base": -120.923, "v0": -5.076, "v1": -20.982, "v2": 37.759, "v3": -41.403, "v4": 29.383, "amplitude": 41.758, "phase_angle": 25.279, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.905, "filter_rmsd": 0.040, "frame": { "rmsd": 0.005, "origin": [ 19.046, 41.484, 40.109 ], "x_axis": [ -0.222, -0.629, -0.745 ], "y_axis": [ -0.132, -0.738, 0.662 ], "z_axis": [ -0.966, 0.245, 0.080 ], "quaternion": [ -0.174, -0.599, 0.318, 0.714 ] } }, { "index": 49, "index_chain": 49, "chain_name": "B", "nt_resnum": 952, "nt_name": "G", "nt_code": "G", "nt_id": "///B/952", "linked_nts": [ "///B/951", "///B/953" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": 178.351, "beta": 148.870, "gamma": 160.408, "delta": 83.975, "epsilon": -147.425, "zeta": -68.566, "epsilon_zeta": -78.859, "bb_type": "BI", "chi": -169.371, "glyco_bond": "anti", "C5prime_xyz": [ -0.893, 8.350, 1.188 ], "P_xyz": [ -0.028, 10.389, -0.221 ], "form": "A", "ssZp": 4.822, "Dp": 4.749, "splay_angle": 24.855, "splay_distance": 3.957, "splay_ratio": 0.223, "d22": null, "d64": null, "eta": 160.352, "theta": -175.760, "eta_prime": 171.793, "theta_prime": -167.794, "eta_base": -145.395, "theta_base": -141.279, "v0": 9.707, "v1": -29.966, "v2": 37.875, "v3": -33.598, "v4": 15.142, "amplitude": 37.989, "phase_angle": 4.448, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1f", "suiteness": 0.305, "filter_rmsd": 0.014, "frame": { "rmsd": 0.014, "origin": [ 16.306, 42.455, 37.929 ], "x_axis": [ -0.212, -0.899, -0.384 ], "y_axis": [ -0.176, -0.352, 0.920 ], "z_axis": [ -0.961, 0.262, -0.083 ], "quaternion": [ -0.297, -0.553, 0.486, 0.608 ] } }, { "index": 50, "index_chain": 50, "chain_name": "B", "nt_resnum": 953, "nt_name": "G", "nt_code": "G", "nt_id": "///B/953", "linked_nts": [ "///B/952", "///B/954" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop", "alpha": -54.994, "beta": 178.564, "gamma": 42.129, "delta": 79.071, "epsilon": -155.705, "zeta": -67.780, "epsilon_zeta": -87.925, "bb_type": "BI", "chi": -168.061, "glyco_bond": "anti", "C5prime_xyz": [ -1.451, 8.728, 0.999 ], "P_xyz": [ 1.072, 9.198, 1.634 ], "form": ".", "ssZp": 4.629, "Dp": 4.627, "splay_angle": 31.118, "splay_distance": 4.500, "splay_ratio": 0.268, "d22": null, "d64": null, "eta": 166.774, "theta": -147.852, "eta_prime": -178.400, "theta_prime": -140.552, "eta_base": -139.770, "theta_base": -94.507, "v0": 0.916, "v1": -26.641, "v2": 41.308, "v3": -41.466, "v4": 25.386, "amplitude": 43.236, "phase_angle": 17.175, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.722, "filter_rmsd": 0.006, "frame": { "rmsd": 0.006, "origin": [ 13.430, 42.793, 35.232 ], "x_axis": [ -0.098, -0.981, 0.170 ], "y_axis": [ -0.074, 0.178, 0.981 ], "z_axis": [ -0.993, 0.083, -0.089 ], "quaternion": [ -0.498, -0.451, 0.584, 0.456 ] } }, { "index": 51, "index_chain": 51, "chain_name": "B", "nt_resnum": 954, "nt_name": "U", "nt_code": "U", "nt_id": "///B/954", "linked_nts": [ "///B/953", "///B/955" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop", "alpha": -63.872, "beta": -172.803, "gamma": 50.714, "delta": 86.265, "epsilon": -140.032, "zeta": -68.327, "epsilon_zeta": -71.704, "bb_type": "BI", "chi": -165.068, "glyco_bond": "anti", "C5prime_xyz": [ -0.898, 8.370, 0.893 ], "P_xyz": [ 1.684, 8.115, 1.408 ], "form": ".", "ssZp": 4.592, "Dp": 4.758, "splay_angle": 18.795, "splay_distance": 2.905, "splay_ratio": 0.165, "d22": 4.012, "d64": 3.666, "eta": 178.632, "theta": -127.781, "eta_prime": -169.116, "theta_prime": -124.078, "eta_base": -114.192, "theta_base": -78.464, "v0": 11.698, "v1": -31.963, "v2": 39.229, "v3": -33.546, "v4": 13.752, "amplitude": 39.247, "phase_angle": 1.725, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.846, "filter_rmsd": 0.104, "frame": { "rmsd": 0.002, "origin": [ 9.458, 40.680, 35.131 ], "x_axis": [ 0.001, -0.501, 0.865 ], "y_axis": [ 0.070, 0.863, 0.500 ], "z_axis": [ -0.998, 0.060, 0.036 ], "quaternion": [ 0.689, 0.160, -0.676, -0.207 ] } }, { "index": 52, "index_chain": 52, "chain_name": "B", "nt_resnum": 955, "nt_name": "U", "nt_code": "U", "nt_id": "///B/955", "linked_nts": [ "///B/954", "///B/956" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,cap-acceptor", "alpha": -59.280, "beta": 170.260, "gamma": 49.034, "delta": 83.107, "epsilon": -134.830, "zeta": -81.470, "epsilon_zeta": -53.359, "bb_type": "BI", "chi": -143.880, "glyco_bond": "anti", "C5prime_xyz": [ -1.275, 8.681, -0.380 ], "P_xyz": [ 1.325, 8.881, -0.766 ], "form": ".", "ssZp": 3.782, "Dp": 4.735, "splay_angle": 74.639, "splay_distance": 10.933, "splay_ratio": 0.607, "d22": 7.549, "d64": 9.977, "eta": 167.460, "theta": -107.535, "eta_prime": -173.767, "theta_prime": -149.743, "eta_base": -110.425, "theta_base": 143.814, "v0": 4.333, "v1": -27.647, "v2": 39.271, "v3": -37.806, "v4": 21.014, "amplitude": 40.228, "phase_angle": 12.520, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.880, "filter_rmsd": 0.104, "frame": { "rmsd": 0.005, "origin": [ 7.594, 39.378, 36.939 ], "x_axis": [ -0.005, 0.182, 0.983 ], "y_axis": [ -0.333, 0.927, -0.173 ], "z_axis": [ -0.943, -0.328, 0.056 ], "quaternion": [ 0.703, 0.055, -0.685, 0.183 ] } }, { "index": 53, "index_chain": 53, "chain_name": "B", "nt_resnum": 956, "nt_name": "C", "nt_code": "C", "nt_id": "///B/956", "linked_nts": [ "///B/955", "///B/957" ], "nt_type": "RNA", "dbn": "]", "summary": "pseudoknotted,turn,u-turn,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,kissing-loop", "alpha": 155.067, "beta": -167.831, "gamma": 50.184, "delta": 86.342, "epsilon": -146.846, "zeta": -71.571, "epsilon_zeta": -75.274, "bb_type": "BI", "chi": -156.397, "glyco_bond": "anti", "C5prime_xyz": [ -0.894, 8.534, 0.246 ], "P_xyz": [ 1.656, 8.494, 0.885 ], "form": ".", "ssZp": 4.153, "Dp": 4.666, "splay_angle": 27.275, "splay_distance": 4.140, "splay_ratio": 0.238, "d22": null, "d64": null, "eta": 24.064, "theta": -138.160, "eta_prime": 46.107, "theta_prime": -132.600, "eta_base": 20.476, "theta_base": -89.860, "v0": 10.580, "v1": -31.497, "v2": 39.466, "v3": -34.489, "v4": 15.097, "amplitude": 39.541, "phase_angle": 3.538, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1g", "suiteness": 0.492, "filter_rmsd": 0.064, "frame": { "rmsd": 0.012, "origin": [ 1.513, 39.525, 27.854 ], "x_axis": [ 0.272, 0.814, -0.514 ], "y_axis": [ -0.182, 0.568, 0.803 ], "z_axis": [ 0.945, -0.125, 0.302 ], "quaternion": [ 0.732, 0.317, 0.498, 0.340 ] } }, { "index": 54, "index_chain": 54, "chain_name": "B", "nt_resnum": 957, "nt_name": "G", "nt_code": "G", "nt_id": "///B/957", "linked_nts": [ "///B/956", "///B/958" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate", "alpha": -57.794, "beta": 164.268, "gamma": 53.675, "delta": 87.573, "epsilon": -130.869, "zeta": -70.009, "epsilon_zeta": -60.859, "bb_type": "BI", "chi": -161.552, "glyco_bond": "anti", "C5prime_xyz": [ -0.944, 8.461, 0.671 ], "P_xyz": [ 1.666, 8.234, 0.542 ], "form": ".", "ssZp": 4.426, "Dp": 4.766, "splay_angle": 45.098, "splay_distance": 7.129, "splay_ratio": 0.385, "d22": null, "d64": null, "eta": 173.714, "theta": -121.399, "eta_prime": -167.197, "theta_prime": -118.144, "eta_base": -109.986, "theta_base": -104.397, "v0": 9.895, "v1": -30.262, "v2": 37.984, "v3": -33.539, "v4": 14.977, "amplitude": 38.081, "phase_angle": 4.090, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.810, "filter_rmsd": 0.008, "frame": { "rmsd": 0.008, "origin": [ 5.351, 41.015, 28.284 ], "x_axis": [ 0.035, 0.983, 0.180 ], "y_axis": [ -0.309, -0.161, 0.937 ], "z_axis": [ 0.951, -0.088, 0.298 ], "quaternion": [ 0.541, 0.474, 0.356, 0.597 ] } }, { "index": 55, "index_chain": 55, "chain_name": "B", "nt_resnum": 958, "nt_name": "A", "nt_code": "A", "nt_id": "///B/958", "linked_nts": [ "///B/957", "///B/959" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate", "alpha": -38.327, "beta": -166.058, "gamma": 60.469, "delta": 101.285, "epsilon": -158.927, "zeta": -126.447, "epsilon_zeta": -32.480, "bb_type": "--", "chi": -115.046, "glyco_bond": "anti", "C5prime_xyz": [ -2.256, 8.274, -1.983 ], "P_xyz": [ 0.162, 9.316, -2.161 ], "form": ".", "ssZp": 1.992, "Dp": 3.254, "splay_angle": 77.143, "splay_distance": 11.928, "splay_ratio": 0.627, "d22": null, "d64": null, "eta": -145.816, "theta": -155.823, "eta_prime": -126.926, "theta_prime": 169.094, "eta_base": -112.534, "theta_base": 122.124, "v0": -10.200, "v1": -4.715, "v2": 16.748, "v3": -23.398, "v4": 21.103, "amplitude": 23.330, "phase_angle": 44.120, "puckering": "C4'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.061, "filter_rmsd": 0.039, "frame": { "rmsd": 0.008, "origin": [ 11.711, 43.362, 30.491 ], "x_axis": [ -0.161, 0.713, 0.682 ], "y_axis": [ -0.263, -0.697, 0.667 ], "z_axis": [ 0.951, -0.072, 0.300 ], "quaternion": [ 0.332, 0.556, 0.202, 0.735 ] } }, { "index": 56, "index_chain": 56, "chain_name": "B", "nt_resnum": 959, "nt_name": "A", "nt_code": "A", "nt_id": "///B/959", "linked_nts": [ "///B/958", "///B/960" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop", "alpha": 161.176, "beta": -152.198, "gamma": 46.521, "delta": 91.890, "epsilon": -171.762, "zeta": -84.544, "epsilon_zeta": -87.218, "bb_type": "BI", "chi": -160.256, "glyco_bond": "anti", "C5prime_xyz": [ -1.034, 8.448, 0.636 ], "P_xyz": [ 1.140, 8.379, 2.142 ], "form": ".", "ssZp": 3.999, "Dp": 4.250, "splay_angle": 17.497, "splay_distance": 2.809, "splay_ratio": 0.153, "d22": null, "d64": null, "eta": 49.098, "theta": -118.463, "eta_prime": 55.029, "theta_prime": -114.414, "eta_base": 53.248, "theta_base": -74.938, "v0": 10.235, "v1": -26.398, "v2": 31.575, "v3": -26.907, "v4": 10.638, "amplitude": 31.576, "phase_angle": 0.538, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.040, "frame": { "rmsd": 0.009, "origin": [ 11.835, 32.414, 25.758 ], "x_axis": [ -0.960, -0.223, 0.171 ], "y_axis": [ 0.187, -0.051, 0.981 ], "z_axis": [ -0.210, 0.974, 0.091 ], "quaternion": [ -0.141, -0.013, 0.674, 0.725 ] } }, { "index": 57, "index_chain": 57, "chain_name": "B", "nt_resnum": 960, "nt_name": "U", "nt_code": "U", "nt_id": "///B/960", "linked_nts": [ "///B/959", "///B/961" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-pair-contact,hairpin-loop,kissing-loop,phosphate", "alpha": 164.944, "beta": -112.545, "gamma": 156.967, "delta": 97.460, "epsilon": -87.967, "zeta": -58.096, "epsilon_zeta": -29.871, "bb_type": "--", "chi": -162.124, "glyco_bond": "anti", "C5prime_xyz": [ -2.604, 8.901, -0.285 ], "P_xyz": [ -0.065, 9.284, -0.820 ], "form": ".", "ssZp": 1.237, "Dp": 2.158, "splay_angle": 81.605, "splay_distance": 12.860, "splay_ratio": 0.655, "d22": 6.201, "d64": 6.680, "eta": -161.386, "theta": -70.821, "eta_prime": -141.658, "theta_prime": -79.442, "eta_base": -93.308, "theta_base": -47.803, "v0": -23.026, "v1": 4.527, "v2": 14.155, "v3": -28.129, "v4": 32.032, "amplitude": 31.822, "phase_angle": 63.588, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "33t", "cluster": "1c", "suiteness": 0.010, "filter_rmsd": 0.105, "frame": { "rmsd": 0.021, "origin": [ 9.812, 34.341, 26.043 ], "x_axis": [ -0.599, -0.358, 0.716 ], "y_axis": [ 0.630, 0.341, 0.697 ], "z_axis": [ -0.494, 0.869, 0.021 ], "quaternion": [ -0.437, 0.098, 0.693, 0.566 ] } }, { "index": 58, "index_chain": 58, "chain_name": "B", "nt_resnum": 961, "nt_name": "C", "nt_code": "C", "nt_id": "///B/961", "linked_nts": [ "///B/960", "///B/962" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,kissing-loop", "alpha": -98.963, "beta": -164.919, "gamma": 52.334, "delta": 84.580, "epsilon": -158.875, "zeta": -66.609, "epsilon_zeta": -92.266, "bb_type": "BI", "chi": -169.704, "glyco_bond": "anti", "C5prime_xyz": [ -1.435, 8.633, 1.136 ], "P_xyz": [ 1.002, 8.836, 2.153 ], "form": "A", "ssZp": 4.553, "Dp": 4.515, "splay_angle": 25.004, "splay_distance": 3.986, "splay_ratio": 0.220, "d22": 4.431, "d64": 4.637, "eta": 122.781, "theta": -144.447, "eta_prime": 162.991, "theta_prime": -142.037, "eta_base": -157.233, "theta_base": -118.875, "v0": 0.986, "v1": -23.829, "v2": 36.417, "v3": -36.790, "v4": 22.528, "amplitude": 38.104, "phase_angle": 17.111, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.005, "origin": [ 13.384, 42.500, 35.320 ], "x_axis": [ 0.039, -0.986, 0.160 ], "y_axis": [ 0.302, -0.141, -0.943 ], "z_axis": [ 0.953, 0.085, 0.292 ], "quaternion": [ 0.545, -0.471, 0.363, -0.590 ] } }, { "index": 59, "index_chain": 59, "chain_name": "B", "nt_resnum": 962, "nt_name": "C", "nt_code": "C", "nt_id": "///B/962", "linked_nts": [ "///B/961", "///B/963" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.407, "beta": -171.616, "gamma": 44.631, "delta": 80.595, "epsilon": -147.444, "zeta": -74.714, "epsilon_zeta": -72.730, "bb_type": "BI", "chi": -166.183, "glyco_bond": "anti", "C5prime_xyz": [ -1.462, 8.728, 0.860 ], "P_xyz": [ 0.912, 9.192, 1.883 ], "form": "A", "ssZp": 4.477, "Dp": 4.619, "splay_angle": 22.253, "splay_distance": 3.693, "splay_ratio": 0.199, "d22": 4.710, "d64": 4.880, "eta": 170.772, "theta": -147.491, "eta_prime": -179.838, "theta_prime": -142.745, "eta_base": -145.368, "theta_base": -123.503, "v0": -0.636, "v1": -22.798, "v2": 36.393, "v3": -37.849, "v4": 24.149, "amplitude": 38.626, "phase_angle": 19.578, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.765, "filter_rmsd": 0.061, "frame": { "rmsd": 0.005, "origin": [ 16.073, 42.564, 38.262 ], "x_axis": [ 0.014, -0.912, -0.409 ], "y_axis": [ 0.176, 0.405, -0.897 ], "z_axis": [ 0.984, -0.059, 0.166 ], "quaternion": [ 0.630, -0.333, 0.553, -0.432 ] } }, { "index": 60, "index_chain": 60, "chain_name": "B", "nt_resnum": 963, "nt_name": "U", "nt_code": "U", "nt_id": "///B/963", "linked_nts": [ "///B/962", "///B/964" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -55.941, "beta": 175.643, "gamma": 48.250, "delta": 79.509, "epsilon": -171.797, "zeta": -69.480, "epsilon_zeta": -102.318, "bb_type": "BI", "chi": -148.874, "glyco_bond": "anti", "C5prime_xyz": [ -1.716, 8.873, -0.190 ], "P_xyz": [ 0.771, 9.709, -0.164 ], "form": "A", "ssZp": 4.066, "Dp": 4.375, "splay_angle": 22.900, "splay_distance": 3.615, "splay_ratio": 0.199, "d22": 4.495, "d64": 4.129, "eta": 170.988, "theta": -161.618, "eta_prime": -175.485, "theta_prime": -161.242, "eta_base": -146.705, "theta_base": -136.903, "v0": -5.000, "v1": -20.218, "v2": 36.404, "v3": -40.259, "v4": 28.527, "amplitude": 40.351, "phase_angle": 25.553, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.890, "filter_rmsd": 0.103, "frame": { "rmsd": 0.004, "origin": [ 18.773, 41.120, 40.325 ], "x_axis": [ 0.066, -0.635, -0.770 ], "y_axis": [ 0.309, 0.747, -0.589 ], "z_axis": [ 0.949, -0.199, 0.245 ], "quaternion": [ 0.717, -0.136, 0.599, -0.329 ] } }, { "index": 61, "index_chain": 61, "chain_name": "B", "nt_resnum": 964, "nt_name": "C", "nt_code": "C", "nt_id": "///B/964", "linked_nts": [ "///B/963", "///B/965" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -71.042, "beta": -168.556, "gamma": 39.668, "delta": 80.073, "epsilon": -172.668, "zeta": -75.834, "epsilon_zeta": -96.835, "bb_type": "BI", "chi": -150.500, "glyco_bond": "anti", "C5prime_xyz": [ -0.996, 8.652, 0.009 ], "P_xyz": [ 1.584, 8.931, 0.368 ], "form": "A", "ssZp": 4.252, "Dp": 4.554, "splay_angle": 28.485, "splay_distance": 4.551, "splay_ratio": 0.251, "d22": null, "d64": null, "eta": 162.040, "theta": -135.837, "eta_prime": 168.556, "theta_prime": -137.539, "eta_base": -155.871, "theta_base": -115.850, "v0": 5.338, "v1": -29.493, "v2": 41.477, "v3": -39.431, "v4": 21.383, "amplitude": 42.327, "phase_angle": 11.505, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.461, "filter_rmsd": 0.062, "frame": { "rmsd": 0.004, "origin": [ 21.834, 39.657, 41.573 ], "x_axis": [ 0.024, -0.122, -0.992 ], "y_axis": [ 0.289, 0.951, -0.110 ], "z_axis": [ 0.957, -0.284, 0.058 ], "quaternion": [ 0.713, 0.061, 0.684, -0.144 ] } }, { "index": 62, "index_chain": 62, "chain_name": "B", "nt_resnum": 965, "nt_name": "G", "nt_code": "G", "nt_id": "///B/965", "linked_nts": [ "///B/964", "///B/966" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": 156.850, "beta": -148.983, "gamma": 174.783, "delta": 84.102, "epsilon": -106.860, "zeta": -88.498, "epsilon_zeta": -18.363, "bb_type": "--", "chi": 166.089, "glyco_bond": "anti", "C5prime_xyz": [ -1.374, 7.737, 2.526 ], "P_xyz": [ 0.664, 9.285, 2.054 ], "form": "A", "ssZp": 4.855, "Dp": 4.756, "splay_angle": 22.007, "splay_distance": 3.480, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": -178.790, "theta": -148.711, "eta_prime": -166.164, "theta_prime": -142.418, "eta_base": -127.336, "theta_base": -104.907, "v0": 9.888, "v1": -30.234, "v2": 38.380, "v3": -33.848, "v4": 15.070, "amplitude": 38.487, "phase_angle": 4.259, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.821, "filter_rmsd": 0.011, "frame": { "rmsd": 0.011, "origin": [ 25.118, 36.895, 40.056 ], "x_axis": [ -0.056, 0.396, -0.916 ], "y_axis": [ 0.088, 0.916, 0.391 ], "z_axis": [ 0.995, -0.059, -0.086 ], "quaternion": [ 0.666, 0.169, 0.717, 0.116 ] } }, { "index": 63, "index_chain": 63, "chain_name": "B", "nt_resnum": 966, "nt_name": "U", "nt_code": "U", "nt_id": "///B/966", "linked_nts": [ "///B/965", "///B/967" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop", "alpha": -48.345, "beta": 142.310, "gamma": 57.273, "delta": 77.008, "epsilon": -149.410, "zeta": -79.729, "epsilon_zeta": -69.681, "bb_type": "BI", "chi": -170.019, "glyco_bond": "anti", "C5prime_xyz": [ -1.746, 8.741, 1.021 ], "P_xyz": [ 0.770, 9.226, 0.701 ], "form": "A", "ssZp": 4.525, "Dp": 4.590, "splay_angle": 21.506, "splay_distance": 3.385, "splay_ratio": 0.189, "d22": null, "d64": null, "eta": 160.171, "theta": -149.863, "eta_prime": -175.918, "theta_prime": -150.516, "eta_base": -120.038, "theta_base": -125.253, "v0": -4.730, "v1": -23.212, "v2": 41.085, "v3": -44.749, "v4": 31.153, "amplitude": 45.123, "phase_angle": 24.423, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.891, "filter_rmsd": 0.103, "frame": { "rmsd": 0.004, "origin": [ 27.621, 36.137, 37.759 ], "x_axis": [ 0.146, 0.859, -0.490 ], "y_axis": [ 0.246, 0.448, 0.859 ], "z_axis": [ 0.958, -0.246, -0.146 ], "quaternion": [ 0.602, 0.459, 0.602, 0.255 ] } }, { "index": 64, "index_chain": 64, "chain_name": "B", "nt_resnum": 967, "nt_name": "A", "nt_code": "A", "nt_id": "///B/967", "linked_nts": [ "///B/966", "///B/968" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -53.660, "beta": 174.739, "gamma": 43.453, "delta": 83.310, "epsilon": -152.736, "zeta": -75.048, "epsilon_zeta": -77.688, "bb_type": "BI", "chi": -155.056, "glyco_bond": "anti", "C5prime_xyz": [ -1.425, 8.723, 0.219 ], "P_xyz": [ 1.113, 9.137, 0.705 ], "form": "A", "ssZp": 4.150, "Dp": 4.524, "splay_angle": 22.564, "splay_distance": 3.576, "splay_ratio": 0.196, "d22": null, "d64": null, "eta": 171.559, "theta": -147.023, "eta_prime": -178.218, "theta_prime": -144.933, "eta_base": -140.280, "theta_base": -115.873, "v0": 0.503, "v1": -24.881, "v2": 38.653, "v3": -39.464, "v4": 24.366, "amplitude": 40.621, "phase_angle": 17.910, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.722, "filter_rmsd": 0.039, "frame": { "rmsd": 0.010, "origin": [ 30.200, 35.514, 35.657 ], "x_axis": [ 0.124, 0.987, 0.099 ], "y_axis": [ 0.235, -0.126, 0.964 ], "z_axis": [ 0.964, -0.096, -0.248 ], "quaternion": [ 0.433, 0.612, 0.499, 0.434 ] } }, { "index": 65, "index_chain": 65, "chain_name": "B", "nt_resnum": 968, "nt_name": "C", "nt_code": "C", "nt_id": "///B/968", "linked_nts": [ "///B/967", "///B/969" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -59.507, "beta": 170.832, "gamma": 51.003, "delta": 81.576, "epsilon": -159.609, "zeta": -68.111, "epsilon_zeta": -91.498, "bb_type": "BI", "chi": -156.801, "glyco_bond": "anti", "C5prime_xyz": [ -1.304, 8.775, 0.208 ], "P_xyz": [ 1.284, 9.131, 0.249 ], "form": "A", "ssZp": 4.249, "Dp": 4.569, "splay_angle": 26.848, "splay_distance": 4.299, "splay_ratio": 0.234, "d22": 4.276, "d64": 4.605, "eta": 166.925, "theta": -147.592, "eta_prime": -178.900, "theta_prime": -149.223, "eta_base": -135.843, "theta_base": -130.427, "v0": -0.711, "v1": -24.325, "v2": 38.828, "v3": -40.311, "v4": 25.767, "amplitude": 41.206, "phase_angle": 19.562, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.949, "filter_rmsd": 0.063, "frame": { "rmsd": 0.010, "origin": [ 33.333, 36.294, 34.118 ], "x_axis": [ 0.124, 0.763, 0.634 ], "y_axis": [ 0.206, -0.645, 0.736 ], "z_axis": [ 0.971, 0.040, -0.237 ], "quaternion": [ 0.246, 0.708, 0.342, 0.567 ] } }, { "index": 66, "index_chain": 66, "chain_name": "B", "nt_resnum": 969, "nt_name": "C", "nt_code": "C", "nt_id": "///B/969", "linked_nts": [ "///B/968", "///B/970" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -64.129, "beta": -176.910, "gamma": 47.878, "delta": 81.080, "epsilon": -162.595, "zeta": -60.785, "epsilon_zeta": -101.810, "bb_type": "BI", "chi": -166.127, "glyco_bond": "anti", "C5prime_xyz": [ -1.360, 8.747, 0.835 ], "P_xyz": [ 1.112, 9.290, 1.499 ], "form": "A", "ssZp": 4.452, "Dp": 4.531, "splay_angle": 22.145, "splay_distance": 3.552, "splay_ratio": 0.197, "d22": 4.439, "d64": 4.446, "eta": 170.322, "theta": -148.121, "eta_prime": -179.091, "theta_prime": -145.507, "eta_base": -145.764, "theta_base": -118.485, "v0": 3.181, "v1": -28.556, "v2": 41.654, "v3": -40.844, "v4": 23.783, "amplitude": 43.003, "phase_angle": 14.389, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.861, "filter_rmsd": 0.062, "frame": { "rmsd": 0.006, "origin": [ 36.918, 37.920, 32.389 ], "x_axis": [ -0.065, 0.356, 0.932 ], "y_axis": [ 0.033, -0.933, 0.359 ], "z_axis": [ 0.997, 0.054, 0.049 ], "quaternion": [ 0.113, 0.674, 0.144, 0.715 ] } }, { "index": 67, "index_chain": 67, "chain_name": "B", "nt_resnum": 970, "nt_name": "C", "nt_code": "C", "nt_id": "///B/970", "linked_nts": [ "///B/969", "///B/971" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.593, "beta": -167.850, "gamma": 45.214, "delta": 84.295, "epsilon": -164.373, "zeta": -62.993, "epsilon_zeta": -101.380, "bb_type": "BI", "chi": -153.632, "glyco_bond": "anti", "C5prime_xyz": [ -1.211, 8.758, 0.089 ], "P_xyz": [ 1.285, 9.307, 0.661 ], "form": "A", "ssZp": 4.189, "Dp": 4.504, "splay_angle": 22.237, "splay_distance": 3.601, "splay_ratio": 0.195, "d22": 4.370, "d64": 4.371, "eta": 170.443, "theta": -147.630, "eta_prime": -176.756, "theta_prime": -143.607, "eta_base": -138.349, "theta_base": -119.482, "v0": 3.344, "v1": -27.133, "v2": 39.053, "v3": -38.367, "v4": 22.119, "amplitude": 40.252, "phase_angle": 14.019, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.683, "filter_rmsd": 0.063, "frame": { "rmsd": 0.007, "origin": [ 39.794, 39.973, 32.741 ], "x_axis": [ -0.100, -0.230, 0.968 ], "y_axis": [ 0.157, -0.964, -0.213 ], "z_axis": [ 0.982, 0.131, 0.133 ], "quaternion": [ -0.131, 0.658, -0.028, 0.741 ] } }, { "index": 68, "index_chain": 68, "chain_name": "B", "nt_resnum": 971, "nt_name": "C", "nt_code": "C", "nt_id": "///B/971", "linked_nts": [ "///B/970", "///B/972" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": -75.572, "beta": -173.532, "gamma": 54.568, "delta": 81.559, "epsilon": -145.383, "zeta": -74.480, "epsilon_zeta": -70.903, "bb_type": "BI", "chi": -146.557, "glyco_bond": "anti", "C5prime_xyz": [ -1.473, 8.882, -0.292 ], "P_xyz": [ 1.077, 9.441, -0.230 ], "form": ".", "ssZp": 3.847, "Dp": 4.568, "splay_angle": 56.942, "splay_distance": 8.849, "splay_ratio": 0.477, "d22": null, "d64": null, "eta": 173.904, "theta": -149.785, "eta_prime": -174.263, "theta_prime": -139.669, "eta_base": -142.927, "theta_base": -112.809, "v0": -1.659, "v1": -23.691, "v2": 38.869, "v3": -40.628, "v4": 26.807, "amplitude": 41.575, "phase_angle": 20.784, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.736, "filter_rmsd": 0.062, "frame": { "rmsd": 0.005, "origin": [ 42.679, 41.394, 34.363 ], "x_axis": [ -0.135, -0.694, 0.707 ], "y_axis": [ 0.322, -0.706, -0.631 ], "z_axis": [ 0.937, 0.142, 0.319 ], "quaternion": [ -0.346, 0.559, -0.166, 0.735 ] } }, { "index": 69, "index_chain": 69, "chain_name": "B", "nt_resnum": 972, "nt_name": "A", "nt_code": "A", "nt_id": "///B/972", "linked_nts": [ "///B/971", "///B/973" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": -63.918, "beta": -146.804, "gamma": 43.015, "delta": 85.982, "epsilon": -173.144, "zeta": 132.929, "epsilon_zeta": 53.926, "bb_type": "--", "chi": -158.904, "glyco_bond": "anti", "C5prime_xyz": [ -1.009, 8.517, 0.519 ], "P_xyz": [ 1.256, 8.702, 1.815 ], "form": ".", "ssZp": 4.341, "Dp": 4.438, "splay_angle": 105.402, "splay_distance": 13.884, "splay_ratio": 0.796, "d22": null, "d64": null, "eta": -169.522, "theta": 68.733, "eta_prime": -166.852, "theta_prime": 29.429, "eta_base": -146.159, "theta_base": -42.096, "v0": 8.601, "v1": -29.121, "v2": 37.155, "v3": -33.593, "v4": 15.903, "amplitude": 37.351, "phase_angle": 5.879, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1m", "suiteness": 0.597, "filter_rmsd": 0.036, "frame": { "rmsd": 0.006, "origin": [ 50.711, 39.195, 37.352 ], "x_axis": [ -0.677, -0.729, 0.099 ], "y_axis": [ -0.210, 0.064, -0.976 ], "z_axis": [ 0.705, -0.681, -0.196 ], "quaternion": [ 0.218, -0.338, 0.696, -0.595 ] } }, { "index": 70, "index_chain": 70, "chain_name": "B", "nt_resnum": 973, "nt_name": "G", "nt_code": "G", "nt_id": "///B/973", "linked_nts": [ "///B/972", "///B/974" ], "nt_type": "RNA", "dbn": ".", "summary": "syn,BII,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 43.207, "beta": 153.040, "gamma": 167.547, "delta": 112.655, "epsilon": -85.404, "zeta": -150.871, "epsilon_zeta": 65.468, "bb_type": "BII", "chi": 38.364, "glyco_bond": "syn", "C5prime_xyz": [ -5.914, 4.801, 1.047 ], "P_xyz": [ -7.010, 3.811, 3.240 ], "form": ".", "ssZp": -0.713, "Dp": 0.969, "splay_angle": 131.927, "splay_distance": 18.605, "splay_ratio": 0.913, "d22": null, "d64": null, "eta": 78.328, "theta": 167.520, "eta_prime": 90.355, "theta_prime": 147.984, "eta_base": 165.231, "theta_base": 117.187, "v0": -35.293, "v1": 26.174, "v2": -7.752, "v3": -12.163, "v4": 29.407, "amplitude": 34.365, "phase_angle": 103.037, "puckering": "O4'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.012, "frame": { "rmsd": 0.012, "origin": [ 51.328, 31.870, 25.573 ], "x_axis": [ 0.244, -0.895, -0.375 ], "y_axis": [ 0.822, 0.396, -0.410 ], "z_axis": [ 0.515, -0.208, 0.831 ], "quaternion": [ 0.786, -0.064, 0.283, -0.546 ] } }, { "index": 71, "index_chain": 71, "chain_name": "B", "nt_resnum": 974, "nt_name": "C", "nt_code": "C", "nt_id": "///B/974", "linked_nts": [ "///B/973", "///B/975" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 44.787, "beta": -138.320, "gamma": 73.264, "delta": 98.023, "epsilon": -177.297, "zeta": 118.367, "epsilon_zeta": 64.336, "bb_type": "--", "chi": -147.964, "glyco_bond": "anti", "C5prime_xyz": [ -2.237, 8.892, -0.817 ], "P_xyz": [ -0.380, 10.048, 0.648 ], "form": ".", "ssZp": 1.929, "Dp": 2.673, "splay_angle": 154.165, "splay_distance": 20.336, "splay_ratio": 0.975, "d22": 12.168, "d64": 14.979, "eta": -8.965, "theta": 78.740, "eta_prime": 15.359, "theta_prime": 34.666, "eta_base": 30.024, "theta_base": -16.733, "v0": -17.159, "v1": 1.070, "v2": 14.022, "v3": -24.631, "v4": 26.210, "amplitude": 26.463, "phase_angle": 58.004, "puckering": "C4'-exo", "sugar_class": "pucker-CHK", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.065, "frame": { "rmsd": 0.020, "origin": [ 65.503, 42.755, 20.404 ], "x_axis": [ 0.154, 0.695, 0.702 ], "y_axis": [ -0.935, -0.128, 0.332 ], "z_axis": [ 0.320, -0.707, 0.630 ], "quaternion": [ 0.643, 0.404, -0.148, 0.633 ] } }, { "index": 72, "index_chain": 72, "chain_name": "B", "nt_resnum": 975, "nt_name": "C", "nt_code": "C", "nt_id": "///B/975", "linked_nts": [ "///B/974", "///B/976" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart", "alpha": 62.804, "beta": 126.876, "gamma": 174.479, "delta": 82.967, "epsilon": -132.357, "zeta": -79.946, "epsilon_zeta": -52.410, "bb_type": "BI", "chi": -150.487, "glyco_bond": "anti", "C5prime_xyz": [ -1.412, 8.847, -0.234 ], "P_xyz": [ -1.742, 10.637, -2.164 ], "form": ".", "ssZp": 3.815, "Dp": 4.620, "splay_angle": 28.640, "splay_distance": 4.603, "splay_ratio": 0.252, "d22": null, "d64": null, "eta": 60.309, "theta": 168.482, "eta_prime": 75.460, "theta_prime": -172.291, "eta_base": 130.774, "theta_base": -115.787, "v0": 2.383, "v1": -26.767, "v2": 39.391, "v3": -38.985, "v4": 23.377, "amplitude": 40.843, "phase_angle": 15.321, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "5j", "suiteness": 0.026, "filter_rmsd": 0.064, "frame": { "rmsd": 0.008, "origin": [ 48.740, 31.693, 23.594 ], "x_axis": [ -0.387, 0.784, 0.485 ], "y_axis": [ 0.687, 0.596, -0.415 ], "z_axis": [ -0.615, 0.172, -0.770 ], "quaternion": [ -0.331, 0.443, 0.830, -0.073 ] } }, { "index": 73, "index_chain": 73, "chain_name": "B", "nt_resnum": 976, "nt_name": "A", "nt_code": "A", "nt_id": "///B/976", "linked_nts": [ "///B/975", null ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate", "alpha": -58.765, "beta": 152.136, "gamma": 55.765, "delta": 87.535, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -155.711, "glyco_bond": "anti", "C5prime_xyz": [ -1.205, 8.659, 0.293 ], "P_xyz": [ 1.405, 8.566, -0.219 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 4.980, "v1": -25.611, "v2": 35.450, "v3": -33.488, "v4": 18.019, "amplitude": 36.095, "phase_angle": 10.853, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.648, "filter_rmsd": 0.038, "frame": { "rmsd": 0.007, "origin": [ 46.831, 35.505, 21.858 ], "x_axis": [ 0.438, 0.874, 0.211 ], "y_axis": [ 0.652, -0.148, -0.744 ], "z_axis": [ -0.619, 0.463, -0.635 ], "quaternion": [ -0.405, 0.745, 0.512, -0.137 ] } }, { "index": 74, "index_chain": 1, "chain_name": "A", "nt_resnum": 998, "nt_name": "AMP", "nt_code": "a", "is_modified": true, "nt_id": "///A/998", "linked_nts": [ null, null ], "nt_type": "RNA", "dbn": ".", "summary": "modified,anti,~C3'-endo,ss-non-loop,phosphate", "alpha": null, "beta": -158.046, "gamma": 55.116, "delta": 82.521, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -149.955, "glyco_bond": "anti", "C5prime_xyz": [ -1.654, 8.833, -0.196 ], "P_xyz": [ 0.823, 9.644, 0.283 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -2.450, "v1": -21.791, "v2": 36.376, "v3": -38.778, "v4": 25.921, "amplitude": 39.248, "phase_angle": 22.055, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.037, "frame": { "rmsd": 0.006, "origin": [ 38.612, 24.392, 20.088 ], "x_axis": [ 0.697, -0.440, 0.566 ], "y_axis": [ 0.713, 0.348, -0.608 ], "z_axis": [ 0.071, 0.828, 0.557 ], "quaternion": [ 0.807, -0.445, -0.153, -0.358 ] } } ], "num_hbonds": 711, "hbonds": [ { "index": 1, "atom1_serNum": 15, "atom2_serNum": 1447, "donAcc_type": "standard", "distance": 2.580, "atom1_id": "///B/902/O6", "atom2_id": "///B/971/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 16, "atom2_serNum": 1445, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///B/902/N1", "atom2_id": "///B/971/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 18, "atom2_serNum": 1444, "donAcc_type": "standard", "distance": 3.117, "atom1_id": "///B/902/N2", "atom2_id": "///B/971/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 18, "atom2_serNum": 2959, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///B/902/N2", "atom2_id": "///A/181/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 5, "atom1_serNum": 38, "atom2_serNum": 1427, "donAcc_type": "standard", "distance": 2.576, "atom1_id": "///B/903/O6", "atom2_id": "///B/970/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 39, "atom2_serNum": 1425, "donAcc_type": "standard", "distance": 2.548, "atom1_id": "///B/903/N1", "atom2_id": "///B/970/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 41, "atom2_serNum": 1424, "donAcc_type": "standard", "distance": 2.476, "atom1_id": "///B/903/N2", "atom2_id": "///B/970/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 41, "atom2_serNum": 3412, "donAcc_type": "standard", "distance": 3.092, "atom1_id": "///B/903/N2", "atom2_id": "///A/235/OD1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 9, "atom1_serNum": 52, "atom2_serNum": 3443, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///B/904/O3'", "atom2_id": "///A/238/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 10, "atom1_serNum": 61, "atom2_serNum": 1407, "donAcc_type": "standard", "distance": 2.626, "atom1_id": "///B/904/O6", "atom2_id": "///B/969/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 62, "atom2_serNum": 1405, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///B/904/N1", "atom2_id": "///B/969/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 64, "atom2_serNum": 1404, "donAcc_type": "standard", "distance": 2.533, "atom1_id": "///B/904/N2", "atom2_id": "///B/969/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 68, "atom2_serNum": 3432, "donAcc_type": "standard", "distance": 3.919, "atom1_id": "///B/905/OP1", "atom2_id": "///A/237/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 14, "atom1_serNum": 77, "atom2_serNum": 3405, "donAcc_type": "acceptable", "distance": 2.750, "atom1_id": "///B/905/O2'", "atom2_id": "///A/234/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 15, "atom1_serNum": 84, "atom2_serNum": 1387, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///B/905/O6", "atom2_id": "///B/968/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 85, "atom2_serNum": 1385, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///B/905/N1", "atom2_id": "///B/968/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 87, "atom2_serNum": 1384, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///B/905/N2", "atom2_id": "///B/968/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 100, "atom2_serNum": 113, "donAcc_type": "acceptable", "distance": 2.642, "atom1_id": "///B/906/O2'", "atom2_id": "///B/907/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 100, "atom2_serNum": 4111, "donAcc_type": "acceptable", "distance": 3.370, "atom1_id": "///B/906/O2'", "atom2_id": "///A/318/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 20, "atom1_serNum": 105, "atom2_serNum": 1366, "donAcc_type": "standard", "distance": 2.578, "atom1_id": "///B/906/N3", "atom2_id": "///B/967/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 107, "atom2_serNum": 1365, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///B/906/O4", "atom2_id": "///B/967/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 127, "atom2_serNum": 1345, "donAcc_type": "standard", "distance": 2.408, "atom1_id": "///B/907/N6", "atom2_id": "///B/966/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 128, "atom2_serNum": 1343, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///B/907/N1", "atom2_id": "///B/966/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 134, "atom2_serNum": 4111, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///B/908/OP2", "atom2_id": "///A/318/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 25, "atom1_serNum": 138, "atom2_serNum": 957, "donAcc_type": "acceptable", "distance": 2.860, "atom1_id": "///B/908/O4'", "atom2_id": "///B/948/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 140, "atom2_serNum": 934, "donAcc_type": "acceptable", "distance": 2.705, "atom1_id": "///B/908/O3'", "atom2_id": "///B/946/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 142, "atom2_serNum": 406, "donAcc_type": "acceptable", "distance": 2.474, "atom1_id": "///B/908/O2'", "atom2_id": "///B/921/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 142, "atom2_serNum": 934, "donAcc_type": "acceptable", "distance": 2.894, "atom1_id": "///B/908/O2'", "atom2_id": "///B/946/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 142, "atom2_serNum": 953, "donAcc_type": "acceptable", "distance": 3.135, "atom1_id": "///B/908/O2'", "atom2_id": "///B/948/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 146, "atom2_serNum": 274, "donAcc_type": "standard", "distance": 2.698, "atom1_id": "///B/908/O2", "atom2_id": "///B/914/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 147, "atom2_serNum": 271, "donAcc_type": "standard", "distance": 2.947, "atom1_id": "///B/908/N3", "atom2_id": "///B/914/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 154, "atom2_serNum": 252, "donAcc_type": "standard", "distance": 3.245, "atom1_id": "///B/909/OP2", "atom2_id": "///B/913/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 158, "atom2_serNum": 930, "donAcc_type": "questionable", "distance": 2.900, "atom1_id": "///B/909/O4'", "atom2_id": "///B/946/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 162, "atom2_serNum": 173, "donAcc_type": "acceptable", "distance": 2.856, "atom1_id": "///B/909/O2'", "atom2_id": "///B/910/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 162, "atom2_serNum": 911, "donAcc_type": "acceptable", "distance": 2.595, "atom1_id": "///B/909/O2'", "atom2_id": "///B/945/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 186, "atom2_serNum": 921, "donAcc_type": "standard", "distance": 2.546, "atom1_id": "///B/910/N7", "atom2_id": "///B/945/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 189, "atom2_serNum": 495, "donAcc_type": "standard", "distance": 2.788, "atom1_id": "///B/910/O6", "atom2_id": "///B/925/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 189, "atom2_serNum": 921, "donAcc_type": "standard", "distance": 2.914, "atom1_id": "///B/910/O6", "atom2_id": "///B/945/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 190, "atom2_serNum": 493, "donAcc_type": "standard", "distance": 2.786, "atom1_id": "///B/910/N1", "atom2_id": "///B/925/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 192, "atom2_serNum": 492, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///B/910/N2", "atom2_id": "///B/925/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 192, "atom2_serNum": 4150, "donAcc_type": "standard", "distance": 3.131, "atom1_id": "///B/910/N2", "atom2_id": "///A/323/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 42, "atom1_serNum": 205, "atom2_serNum": 4131, "donAcc_type": "acceptable", "distance": 2.995, "atom1_id": "///B/911/O2'", "atom2_id": "///A/321/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 43, "atom1_serNum": 209, "atom2_serNum": 475, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///B/911/O2", "atom2_id": "///B/924/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 210, "atom2_serNum": 473, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///B/911/N3", "atom2_id": "///B/924/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 212, "atom2_serNum": 472, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///B/911/N4", "atom2_id": "///B/924/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 216, "atom2_serNum": 4128, "donAcc_type": "standard", "distance": 3.081, "atom1_id": "///B/912/OP1", "atom2_id": "///A/321/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 47, "atom1_serNum": 225, "atom2_serNum": 4071, "donAcc_type": "acceptable", "distance": 2.931, "atom1_id": "///B/912/O2'", "atom2_id": "///A/313/O", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 48, "atom1_serNum": 229, "atom2_serNum": 452, "donAcc_type": "standard", "distance": 2.624, "atom1_id": "///B/912/O2", "atom2_id": "///B/923/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 230, "atom2_serNum": 450, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///B/912/N3", "atom2_id": "///B/923/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 232, "atom2_serNum": 449, "donAcc_type": "standard", "distance": 3.047, "atom1_id": "///B/912/N4", "atom2_id": "///B/923/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 236, "atom2_serNum": 4092, "donAcc_type": "acceptable", "distance": 2.658, "atom1_id": "///B/913/OP1", "atom2_id": "///A/316/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 52, "atom1_serNum": 245, "atom2_serNum": 260, "donAcc_type": "acceptable", "distance": 2.899, "atom1_id": "///B/913/O2'", "atom2_id": "///B/914/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 245, "atom2_serNum": 427, "donAcc_type": "acceptable", "distance": 2.939, "atom1_id": "///B/913/O2'", "atom2_id": "///B/922/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 253, "atom2_serNum": 944, "donAcc_type": "standard", "distance": 2.919, "atom1_id": "///B/913/N1", "atom2_id": "///B/946/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 255, "atom2_serNum": 427, "donAcc_type": "standard", "distance": 2.591, "atom1_id": "///B/913/N3", "atom2_id": "///B/922/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 274, "atom2_serNum": 408, "donAcc_type": "standard", "distance": 3.030, "atom1_id": "///B/914/N6", "atom2_id": "///B/921/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 275, "atom2_serNum": 398, "donAcc_type": "acceptable", "distance": 2.903, "atom1_id": "///B/914/N1", "atom2_id": "///B/921/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 280, "atom2_serNum": 1611, "donAcc_type": "standard", "distance": 3.835, "atom1_id": "///B/915/OP1", "atom2_id": "///A/13/NE2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 59, "atom1_serNum": 296, "atom2_serNum": 962, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///B/915/O6", "atom2_id": "///B/948/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 297, "atom2_serNum": 964, "donAcc_type": "standard", "distance": 2.796, "atom1_id": "///B/915/N1", "atom2_id": "///B/948/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 308, "atom2_serNum": 1219, "donAcc_type": "questionable", "distance": 2.869, "atom1_id": "///B/916/O4'", "atom2_id": "///B/960/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 312, "atom2_serNum": 324, "donAcc_type": "acceptable", "distance": 2.503, "atom1_id": "///B/916/O2'", "atom2_id": "///B/918/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 312, "atom2_serNum": 325, "donAcc_type": "acceptable", "distance": 2.931, "atom1_id": "///B/916/O2'", "atom2_id": "///B/918/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 312, "atom2_serNum": 1215, "donAcc_type": "acceptable", "distance": 2.568, "atom1_id": "///B/916/O2'", "atom2_id": "///B/960/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 312, "atom2_serNum": 1219, "donAcc_type": "acceptable", "distance": 3.127, "atom1_id": "///B/916/O2'", "atom2_id": "///B/960/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 319, "atom2_serNum": 1610, "donAcc_type": "standard", "distance": 3.212, "atom1_id": "///B/916/N4", "atom2_id": "///A/13/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 67, "atom1_serNum": 332, "atom2_serNum": 351, "donAcc_type": "acceptable", "distance": 2.981, "atom1_id": "///B/918/O2'", "atom2_id": "///B/919/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 332, "atom2_serNum": 1158, "donAcc_type": "acceptable", "distance": 2.324, "atom1_id": "///B/918/O2'", "atom2_id": "///B/957/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 339, "atom2_serNum": 1104, "donAcc_type": "questionable", "distance": 3.326, "atom1_id": "///B/918/O6", "atom2_id": "///B/955/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 340, "atom2_serNum": 1112, "donAcc_type": "standard", "distance": 2.702, "atom1_id": "///B/918/N1", "atom2_id": "///B/955/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 342, "atom2_serNum": 1112, "donAcc_type": "standard", "distance": 2.383, "atom1_id": "///B/918/N2", "atom2_id": "///B/955/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 342, "atom2_serNum": 1167, "donAcc_type": "standard", "distance": 2.778, "atom1_id": "///B/918/N2", "atom2_id": "///B/958/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 346, "atom2_serNum": 1220, "donAcc_type": "standard", "distance": 2.590, "atom1_id": "///B/919/OP1", "atom2_id": "///B/960/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 351, "atom2_serNum": 1158, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///B/919/O4'", "atom2_id": "///B/957/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 355, "atom2_serNum": 370, "donAcc_type": "acceptable", "distance": 2.925, "atom1_id": "///B/919/O2'", "atom2_id": "///B/920/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 362, "atom2_serNum": 1135, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///B/919/O6", "atom2_id": "///B/956/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 363, "atom2_serNum": 1133, "donAcc_type": "standard", "distance": 2.614, "atom1_id": "///B/919/N1", "atom2_id": "///B/956/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 365, "atom2_serNum": 385, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///B/919/N2", "atom2_id": "///B/920/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 365, "atom2_serNum": 1132, "donAcc_type": "standard", "distance": 2.274, "atom1_id": "///B/919/N2", "atom2_id": "///B/956/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 405, "atom2_serNum": 950, "donAcc_type": "standard", "distance": 3.374, "atom1_id": "///B/921/N6", "atom2_id": "///B/948/O5'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 405, "atom2_serNum": 953, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///B/921/N6", "atom2_id": "///B/948/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 412, "atom2_serNum": 941, "donAcc_type": "questionable", "distance": 3.367, "atom1_id": "///B/922/OP2", "atom2_id": "///B/946/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 83, "atom1_serNum": 495, "atom2_serNum": 5839, "donAcc_type": "acceptable", "distance": 3.311, "atom1_id": "///B/925/N4", "atom2_id": "///B/1393/O1", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 84, "atom1_serNum": 515, "atom2_serNum": 897, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///B/926/N6", "atom2_id": "///B/944/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 515, "atom2_serNum": 5840, "donAcc_type": "acceptable", "distance": 2.593, "atom1_id": "///B/926/N6", "atom2_id": "///B/1393/O2", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 86, "atom1_serNum": 522, "atom2_serNum": 5818, "donAcc_type": "standard", "distance": 3.900, "atom1_id": "///B/927/OP2", "atom2_id": "///A/545/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 87, "atom1_serNum": 534, "atom2_serNum": 876, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///B/927/O2", "atom2_id": "///B/943/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 88, "atom1_serNum": 535, "atom2_serNum": 874, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///B/927/N3", "atom2_id": "///B/943/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 89, "atom1_serNum": 537, "atom2_serNum": 873, "donAcc_type": "standard", "distance": 2.773, "atom1_id": "///B/927/N4", "atom2_id": "///B/943/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 90, "atom1_serNum": 554, "atom2_serNum": 853, "donAcc_type": "standard", "distance": 2.347, "atom1_id": "///B/928/O2", "atom2_id": "///B/942/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 91, "atom1_serNum": 555, "atom2_serNum": 851, "donAcc_type": "standard", "distance": 2.593, "atom1_id": "///B/928/N3", "atom2_id": "///B/942/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 92, "atom1_serNum": 557, "atom2_serNum": 850, "donAcc_type": "standard", "distance": 2.745, "atom1_id": "///B/928/N4", "atom2_id": "///B/942/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 93, "atom1_serNum": 577, "atom2_serNum": 830, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///B/929/O6", "atom2_id": "///B/941/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 94, "atom1_serNum": 578, "atom2_serNum": 828, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///B/929/N1", "atom2_id": "///B/941/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 95, "atom1_serNum": 580, "atom2_serNum": 827, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///B/929/N2", "atom2_id": "///B/941/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 96, "atom1_serNum": 600, "atom2_serNum": 808, "donAcc_type": "questionable", "distance": 3.198, "atom1_id": "///B/930/O6", "atom2_id": "///B/940/N3", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 97, "atom1_serNum": 601, "atom2_serNum": 807, "donAcc_type": "standard", "distance": 2.679, "atom1_id": "///B/930/N1", "atom2_id": "///B/940/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 98, "atom1_serNum": 603, "atom2_serNum": 807, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///B/930/N2", "atom2_id": "///B/940/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 99, "atom1_serNum": 623, "atom2_serNum": 790, "donAcc_type": "standard", "distance": 3.283, "atom1_id": "///B/931/N6", "atom2_id": "///B/939/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 100, "atom1_serNum": 624, "atom2_serNum": 788, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///B/931/N1", "atom2_id": "///B/939/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 101, "atom1_serNum": 643, "atom2_serNum": 770, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///B/932/N3", "atom2_id": "///B/938/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 102, "atom1_serNum": 658, "atom2_serNum": 690, "donAcc_type": "acceptable", "distance": 2.468, "atom1_id": "///B/933/O2'", "atom2_id": "///B/935/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 103, "atom1_serNum": 662, "atom2_serNum": 748, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/933/O2", "atom2_id": "///B/937/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 104, "atom1_serNum": 678, "atom2_serNum": 682, "donAcc_type": "acceptable", "distance": 2.869, "atom1_id": "///B/934/O2'", "atom2_id": "///B/934/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 105, "atom1_serNum": 678, "atom2_serNum": 4865, "donAcc_type": "acceptable", "distance": 2.400, "atom1_id": "///B/934/O2'", "atom2_id": "///A/412/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 106, "atom1_serNum": 678, "atom2_serNum": 4866, "donAcc_type": "acceptable", "distance": 2.580, "atom1_id": "///B/934/O2'", "atom2_id": "///A/412/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 107, "atom1_serNum": 682, "atom2_serNum": 4865, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///B/934/O2", "atom2_id": "///A/412/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 108, "atom1_serNum": 682, "atom2_serNum": 4867, "donAcc_type": "standard", "distance": 3.196, "atom1_id": "///B/934/O2", "atom2_id": "///A/413/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 109, "atom1_serNum": 683, "atom2_serNum": 4867, "donAcc_type": "standard", "distance": 3.340, "atom1_id": "///B/934/N3", "atom2_id": "///A/413/N", "atom_pair": "N:N", "residue_pair": "nt:aa" }, { "index": 110, "atom1_serNum": 685, "atom2_serNum": 4878, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///B/934/N4", "atom2_id": "///A/414/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 111, "atom1_serNum": 702, "atom2_serNum": 5609, "donAcc_type": "standard", "distance": 2.948, "atom1_id": "///B/935/O2", "atom2_id": "///A/520/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 112, "atom1_serNum": 703, "atom2_serNum": 5587, "donAcc_type": "standard", "distance": 3.048, "atom1_id": "///B/935/N3", "atom2_id": "///A/517/OE1", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 113, "atom1_serNum": 705, "atom2_serNum": 4290, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///B/935/O4", "atom2_id": "///A/341/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 114, "atom1_serNum": 709, "atom2_serNum": 5618, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///B/936/OP1", "atom2_id": "///A/520/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 115, "atom1_serNum": 710, "atom2_serNum": 4773, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///B/936/OP2", "atom2_id": "///A/401/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 116, "atom1_serNum": 710, "atom2_serNum": 5618, "donAcc_type": "standard", "distance": 3.147, "atom1_id": "///B/936/OP2", "atom2_id": "///A/520/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 117, "atom1_serNum": 725, "atom2_serNum": 4781, "donAcc_type": "standard", "distance": 3.298, "atom1_id": "///B/936/O6", "atom2_id": "///A/402/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 118, "atom1_serNum": 725, "atom2_serNum": 4784, "donAcc_type": "standard", "distance": 2.826, "atom1_id": "///B/936/O6", "atom2_id": "///A/402/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 119, "atom1_serNum": 728, "atom2_serNum": 4747, "donAcc_type": "standard", "distance": 3.153, "atom1_id": "///B/936/N2", "atom2_id": "///A/399/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 120, "atom1_serNum": 763, "atom2_serNum": 4250, "donAcc_type": "acceptable", "distance": 2.950, "atom1_id": "///B/938/O2'", "atom2_id": "///A/336/OD1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 121, "atom1_serNum": 767, "atom2_serNum": 4512, "donAcc_type": "standard", "distance": 3.126, "atom1_id": "///B/938/O2", "atom2_id": "///A/370/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 122, "atom1_serNum": 843, "atom2_serNum": 862, "donAcc_type": "acceptable", "distance": 3.186, "atom1_id": "///B/942/O2'", "atom2_id": "///B/943/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 123, "atom1_serNum": 866, "atom2_serNum": 880, "donAcc_type": "acceptable", "distance": 2.964, "atom1_id": "///B/943/O2'", "atom2_id": "///B/944/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 124, "atom1_serNum": 866, "atom2_serNum": 882, "donAcc_type": "acceptable", "distance": 2.268, "atom1_id": "///B/943/O2'", "atom2_id": "///B/944/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 125, "atom1_serNum": 866, "atom2_serNum": 885, "donAcc_type": "acceptable", "distance": 3.005, "atom1_id": "///B/943/O2'", "atom2_id": "///B/944/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 126, "atom1_serNum": 873, "atom2_serNum": 5842, "donAcc_type": "acceptable", "distance": 3.290, "atom1_id": "///B/943/O6", "atom2_id": "///B/1393/O4", "atom_pair": "O:O", "residue_pair": "nt:ligand" }, { "index": 127, "atom1_serNum": 896, "atom2_serNum": 5839, "donAcc_type": "acceptable", "distance": 3.264, "atom1_id": "///B/944/N6", "atom2_id": "///B/1393/O1", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 128, "atom1_serNum": 896, "atom2_serNum": 5842, "donAcc_type": "acceptable", "distance": 2.817, "atom1_id": "///B/944/N6", "atom2_id": "///B/1393/O4", "atom_pair": "N:O", "residue_pair": "nt:ligand" }, { "index": 129, "atom1_serNum": 957, "atom2_serNum": 961, "donAcc_type": "acceptable", "distance": 2.845, "atom1_id": "///B/948/O2'", "atom2_id": "///B/948/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 130, "atom1_serNum": 957, "atom2_serNum": 969, "donAcc_type": "acceptable", "distance": 2.846, "atom1_id": "///B/948/O2'", "atom2_id": "///B/949/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 131, "atom1_serNum": 981, "atom2_serNum": 1325, "donAcc_type": "standard", "distance": 2.605, "atom1_id": "///B/949/O2", "atom2_id": "///B/965/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 132, "atom1_serNum": 982, "atom2_serNum": 1323, "donAcc_type": "standard", "distance": 2.712, "atom1_id": "///B/949/N3", "atom2_id": "///B/965/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 133, "atom1_serNum": 984, "atom2_serNum": 1322, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///B/949/N4", "atom2_id": "///B/965/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 134, "atom1_serNum": 1004, "atom2_serNum": 1302, "donAcc_type": "standard", "distance": 2.685, "atom1_id": "///B/950/O6", "atom2_id": "///B/964/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 135, "atom1_serNum": 1005, "atom2_serNum": 1300, "donAcc_type": "standard", "distance": 2.576, "atom1_id": "///B/950/N1", "atom2_id": "///B/964/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 136, "atom1_serNum": 1007, "atom2_serNum": 1299, "donAcc_type": "standard", "distance": 2.502, "atom1_id": "///B/950/N2", "atom2_id": "///B/964/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 137, "atom1_serNum": 1027, "atom2_serNum": 1282, "donAcc_type": "standard", "distance": 2.688, "atom1_id": "///B/951/N6", "atom2_id": "///B/963/O4", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 138, "atom1_serNum": 1028, "atom2_serNum": 1280, "donAcc_type": "standard", "distance": 2.435, "atom1_id": "///B/951/N1", "atom2_id": "///B/963/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 139, "atom1_serNum": 1049, "atom2_serNum": 1262, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///B/952/O6", "atom2_id": "///B/962/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 140, "atom1_serNum": 1050, "atom2_serNum": 1260, "donAcc_type": "standard", "distance": 2.673, "atom1_id": "///B/952/N1", "atom2_id": "///B/962/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 141, "atom1_serNum": 1052, "atom2_serNum": 1259, "donAcc_type": "standard", "distance": 2.554, "atom1_id": "///B/952/N2", "atom2_id": "///B/962/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 142, "atom1_serNum": 1072, "atom2_serNum": 1242, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///B/953/O6", "atom2_id": "///B/961/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 143, "atom1_serNum": 1073, "atom2_serNum": 1240, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///B/953/N1", "atom2_id": "///B/961/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 144, "atom1_serNum": 1075, "atom2_serNum": 1239, "donAcc_type": "standard", "distance": 2.739, "atom1_id": "///B/953/N2", "atom2_id": "///B/961/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 145, "atom1_serNum": 1092, "atom2_serNum": 1178, "donAcc_type": "standard", "distance": 2.568, "atom1_id": "///B/954/O2", "atom2_id": "///B/958/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 146, "atom1_serNum": 1093, "atom2_serNum": 1175, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///B/954/N3", "atom2_id": "///B/958/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 147, "atom1_serNum": 1108, "atom2_serNum": 1155, "donAcc_type": "acceptable", "distance": 2.903, "atom1_id": "///B/955/O2'", "atom2_id": "///B/957/O6", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 148, "atom1_serNum": 1113, "atom2_serNum": 1163, "donAcc_type": "standard", "distance": 3.032, "atom1_id": "///B/955/N3", "atom2_id": "///B/958/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 149, "atom1_serNum": 1171, "atom2_serNum": 1207, "donAcc_type": "acceptable", "distance": 2.621, "atom1_id": "///B/958/O2'", "atom2_id": "///B/960/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 150, "atom1_serNum": 1193, "atom2_serNum": 1208, "donAcc_type": "acceptable", "distance": 2.926, "atom1_id": "///B/959/O2'", "atom2_id": "///B/960/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 151, "atom1_serNum": 1207, "atom2_serNum": 1242, "donAcc_type": "standard", "distance": 3.771, "atom1_id": "///B/960/OP2", "atom2_id": "///B/961/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 152, "atom1_serNum": 1215, "atom2_serNum": 1219, "donAcc_type": "acceptable", "distance": 3.028, "atom1_id": "///B/960/O2'", "atom2_id": "///B/960/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 153, "atom1_serNum": 1275, "atom2_serNum": 1291, "donAcc_type": "acceptable", "distance": 3.021, "atom1_id": "///B/963/O2'", "atom2_id": "///B/964/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 154, "atom1_serNum": 1400, "atom2_serNum": 4119, "donAcc_type": "acceptable", "distance": 3.183, "atom1_id": "///B/969/O2'", "atom2_id": "///A/319/OD2", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 155, "atom1_serNum": 1451, "atom2_serNum": 1492, "donAcc_type": "standard", "distance": 3.012, "atom1_id": "///B/972/OP1", "atom2_id": "///B/973/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 156, "atom1_serNum": 1460, "atom2_serNum": 2592, "donAcc_type": "acceptable", "distance": 3.015, "atom1_id": "///B/972/O2'", "atom2_id": "///A/133/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 157, "atom1_serNum": 1474, "atom2_serNum": 2595, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///B/973/OP2", "atom2_id": "///A/133/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 158, "atom1_serNum": 1482, "atom2_serNum": 1518, "donAcc_type": "acceptable", "distance": 2.663, "atom1_id": "///B/973/O2'", "atom2_id": "///B/975/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 159, "atom1_serNum": 1496, "atom2_serNum": 2595, "donAcc_type": "standard", "distance": 2.804, "atom1_id": "///B/974/OP1", "atom2_id": "///A/133/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 160, "atom1_serNum": 1497, "atom2_serNum": 2594, "donAcc_type": "standard", "distance": 2.916, "atom1_id": "///B/974/OP2", "atom2_id": "///A/133/NH1", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 161, "atom1_serNum": 1509, "atom2_serNum": 2864, "donAcc_type": "standard", "distance": 3.878, "atom1_id": "///B/974/O2", "atom2_id": "///A/168/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 162, "atom1_serNum": 1512, "atom2_serNum": 2508, "donAcc_type": "standard", "distance": 2.681, "atom1_id": "///B/974/N4", "atom2_id": "///A/124/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 163, "atom1_serNum": 1512, "atom2_serNum": 2867, "donAcc_type": "standard", "distance": 2.709, "atom1_id": "///B/974/N4", "atom2_id": "///A/168/O", "atom_pair": "N:O", "residue_pair": "nt:aa" }, { "index": 164, "atom1_serNum": 1517, "atom2_serNum": 3057, "donAcc_type": "standard", "distance": 3.078, "atom1_id": "///B/975/OP2", "atom2_id": "///A/192/NE", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 165, "atom1_serNum": 1517, "atom2_serNum": 3077, "donAcc_type": "standard", "distance": 3.291, "atom1_id": "///B/975/OP2", "atom2_id": "///A/194/NZ", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 166, "atom1_serNum": 1523, "atom2_serNum": 2052, "donAcc_type": "standard", "distance": 2.912, "atom1_id": "///B/975/O3'", "atom2_id": "///A/69/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 167, "atom1_serNum": 1525, "atom2_serNum": 2052, "donAcc_type": "acceptable", "distance": 3.013, "atom1_id": "///B/975/O2'", "atom2_id": "///A/69/ND2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 168, "atom1_serNum": 1536, "atom2_serNum": 2043, "donAcc_type": "acceptable", "distance": 2.864, "atom1_id": "///B/976/OP1", "atom2_id": "///A/68/OG1", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 169, "atom1_serNum": 1536, "atom2_serNum": 3060, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///B/976/OP1", "atom2_id": "///A/192/NH2", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 170, "atom1_serNum": 1537, "atom2_serNum": 3215, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///B/976/OP2", "atom2_id": "///A/211/N", "atom_pair": "O:N", "residue_pair": "nt:aa" }, { "index": 171, "atom1_serNum": 1543, "atom2_serNum": 2029, "donAcc_type": "questionable", "distance": 2.996, "atom1_id": "///B/976/O3'", "atom2_id": "///A/66/OD2", "atom_pair": "O:O", "residue_pair": "nt:aa" }, { "index": 172, "atom1_serNum": 1563, "atom2_serNum": 1611, "donAcc_type": "acceptable", "distance": 3.560, "atom1_id": "///A/8/OG1", "atom2_id": "///A/13/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 173, "atom1_serNum": 1568, "atom2_serNum": 1603, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/9/O", "atom2_id": "///A/13/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 174, "atom1_serNum": 1571, "atom2_serNum": 1584, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///A/9/OD1", "atom2_id": "///A/11/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 175, "atom1_serNum": 1571, "atom2_serNum": 1592, "donAcc_type": "standard", "distance": 2.856, "atom1_id": "///A/9/OD1", "atom2_id": "///A/12/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 176, "atom1_serNum": 1576, "atom2_serNum": 1612, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///A/10/O", "atom2_id": "///A/14/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 177, "atom1_serNum": 1587, "atom2_serNum": 1620, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/11/O", "atom2_id": "///A/15/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 178, "atom1_serNum": 1595, "atom2_serNum": 1628, "donAcc_type": "standard", "distance": 2.921, "atom1_id": "///A/12/O", "atom2_id": "///A/16/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 179, "atom1_serNum": 1595, "atom2_serNum": 1955, "donAcc_type": "acceptable", "distance": 3.172, "atom1_id": "///A/12/O", "atom2_id": "///A/57/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 180, "atom1_serNum": 1601, "atom2_serNum": 1943, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/12/NH1", "atom2_id": "///A/56/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 181, "atom1_serNum": 1602, "atom2_serNum": 1943, "donAcc_type": "standard", "distance": 2.672, "atom1_id": "///A/12/NH2", "atom2_id": "///A/56/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 182, "atom1_serNum": 1606, "atom2_serNum": 1636, "donAcc_type": "standard", "distance": 3.001, "atom1_id": "///A/13/O", "atom2_id": "///A/17/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 183, "atom1_serNum": 1615, "atom2_serNum": 1645, "donAcc_type": "standard", "distance": 3.159, "atom1_id": "///A/14/O", "atom2_id": "///A/18/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 184, "atom1_serNum": 1623, "atom2_serNum": 1653, "donAcc_type": "standard", "distance": 3.026, "atom1_id": "///A/15/O", "atom2_id": "///A/19/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 185, "atom1_serNum": 1631, "atom2_serNum": 1661, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/16/O", "atom2_id": "///A/20/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 186, "atom1_serNum": 1634, "atom2_serNum": 1955, "donAcc_type": "acceptable", "distance": 2.760, "atom1_id": "///A/16/OD1", "atom2_id": "///A/57/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 187, "atom1_serNum": 1639, "atom2_serNum": 1666, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/17/O", "atom2_id": "///A/21/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 188, "atom1_serNum": 1648, "atom2_serNum": 1671, "donAcc_type": "acceptable", "distance": 3.160, "atom1_id": "///A/18/O", "atom2_id": "///A/21/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 189, "atom1_serNum": 1648, "atom2_serNum": 1676, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/18/O", "atom2_id": "///A/23/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 190, "atom1_serNum": 1656, "atom2_serNum": 1672, "donAcc_type": "standard", "distance": 3.225, "atom1_id": "///A/19/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 191, "atom1_serNum": 1664, "atom2_serNum": 1672, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///A/20/O", "atom2_id": "///A/22/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 192, "atom1_serNum": 1712, "atom2_serNum": 1969, "donAcc_type": "standard", "distance": 3.307, "atom1_id": "///A/27/O", "atom2_id": "///A/60/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 193, "atom1_serNum": 1716, "atom2_serNum": 3330, "donAcc_type": "acceptable", "distance": 2.909, "atom1_id": "///A/28/N", "atom2_id": "///A/225/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 194, "atom1_serNum": 1719, "atom2_serNum": 3325, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/28/O", "atom2_id": "///A/225/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 195, "atom1_serNum": 1722, "atom2_serNum": 1729, "donAcc_type": "acceptable", "distance": 3.015, "atom1_id": "///A/28/ND1", "atom2_id": "///A/29/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 196, "atom1_serNum": 1726, "atom2_serNum": 1972, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/29/N", "atom2_id": "///A/60/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 197, "atom1_serNum": 1729, "atom2_serNum": 1984, "donAcc_type": "standard", "distance": 3.201, "atom1_id": "///A/29/O", "atom2_id": "///A/62/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 198, "atom1_serNum": 1731, "atom2_serNum": 1894, "donAcc_type": "acceptable", "distance": 2.893, "atom1_id": "///A/29/OG1", "atom2_id": "///A/50/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 199, "atom1_serNum": 1742, "atom2_serNum": 3262, "donAcc_type": "questionable", "distance": 2.559, "atom1_id": "///A/30/NH1", "atom2_id": "///A/215/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 200, "atom1_serNum": 1742, "atom2_serNum": 3289, "donAcc_type": "standard", "distance": 3.838, "atom1_id": "///A/30/NH1", "atom2_id": "///A/219/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 201, "atom1_serNum": 1743, "atom2_serNum": 3351, "donAcc_type": "standard", "distance": 2.501, "atom1_id": "///A/30/NH2", "atom2_id": "///A/228/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 202, "atom1_serNum": 1744, "atom2_serNum": 1987, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///A/31/N", "atom2_id": "///A/62/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 203, "atom1_serNum": 1747, "atom2_serNum": 2000, "donAcc_type": "standard", "distance": 2.887, "atom1_id": "///A/31/O", "atom2_id": "///A/64/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 204, "atom1_serNum": 1762, "atom2_serNum": 2003, "donAcc_type": "standard", "distance": 3.294, "atom1_id": "///A/33/N", "atom2_id": "///A/64/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 205, "atom1_serNum": 1765, "atom2_serNum": 2022, "donAcc_type": "standard", "distance": 3.182, "atom1_id": "///A/33/O", "atom2_id": "///A/66/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 206, "atom1_serNum": 1769, "atom2_serNum": 5854, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/34/N", "atom2_id": "///A/998/OP1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 207, "atom1_serNum": 1772, "atom2_serNum": 1785, "donAcc_type": "standard", "distance": 2.635, "atom1_id": "///A/34/O", "atom2_id": "///A/36/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 208, "atom1_serNum": 1777, "atom2_serNum": 2084, "donAcc_type": "questionable", "distance": 2.692, "atom1_id": "///A/34/OE2", "atom2_id": "///A/73/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 209, "atom1_serNum": 1781, "atom2_serNum": 2085, "donAcc_type": "standard", "distance": 3.077, "atom1_id": "///A/35/O", "atom2_id": "///A/74/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 210, "atom1_serNum": 1785, "atom2_serNum": 1791, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/36/N", "atom2_id": "///A/36/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 211, "atom1_serNum": 1791, "atom2_serNum": 3721, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/36/OD1", "atom2_id": "///A/270/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 212, "atom1_serNum": 1808, "atom2_serNum": 2109, "donAcc_type": "acceptable", "distance": 2.710, "atom1_id": "///A/38/OH", "atom2_id": "///A/76/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 213, "atom1_serNum": 1812, "atom2_serNum": 3905, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/39/O", "atom2_id": "///A/293/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 214, "atom1_serNum": 1817, "atom2_serNum": 1845, "donAcc_type": "acceptable", "distance": 3.196, "atom1_id": "///A/40/N", "atom2_id": "///A/43/ND1", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 215, "atom1_serNum": 1820, "atom2_serNum": 1839, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///A/40/O", "atom2_id": "///A/43/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 216, "atom1_serNum": 1820, "atom2_serNum": 1849, "donAcc_type": "standard", "distance": 3.049, "atom1_id": "///A/40/O", "atom2_id": "///A/44/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 217, "atom1_serNum": 1823, "atom2_serNum": 1835, "donAcc_type": "acceptable", "distance": 3.056, "atom1_id": "///A/40/ND1", "atom2_id": "///A/42/N", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 218, "atom1_serNum": 1827, "atom2_serNum": 3894, "donAcc_type": "standard", "distance": 2.836, "atom1_id": "///A/41/N", "atom2_id": "///A/291/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 219, "atom1_serNum": 1830, "atom2_serNum": 1854, "donAcc_type": "standard", "distance": 3.160, "atom1_id": "///A/41/O", "atom2_id": "///A/45/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 220, "atom1_serNum": 1838, "atom2_serNum": 1863, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///A/42/O", "atom2_id": "///A/46/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 221, "atom1_serNum": 1842, "atom2_serNum": 1869, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/43/O", "atom2_id": "///A/47/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 222, "atom1_serNum": 1848, "atom2_serNum": 5856, "donAcc_type": "standard", "distance": 3.061, "atom1_id": "///A/43/NE2", "atom2_id": "///A/998/O5'", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 223, "atom1_serNum": 1852, "atom2_serNum": 1877, "donAcc_type": "standard", "distance": 2.974, "atom1_id": "///A/44/O", "atom2_id": "///A/48/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 224, "atom1_serNum": 1857, "atom2_serNum": 1883, "donAcc_type": "standard", "distance": 3.108, "atom1_id": "///A/45/O", "atom2_id": "///A/49/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 225, "atom1_serNum": 1862, "atom2_serNum": 3626, "donAcc_type": "standard", "distance": 2.546, "atom1_id": "///A/45/NZ", "atom2_id": "///A/259/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 226, "atom1_serNum": 1866, "atom2_serNum": 1891, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/46/O", "atom2_id": "///A/50/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 227, "atom1_serNum": 1866, "atom2_serNum": 1898, "donAcc_type": "standard", "distance": 2.925, "atom1_id": "///A/46/O", "atom2_id": "///A/50/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 228, "atom1_serNum": 1868, "atom2_serNum": 5863, "donAcc_type": "acceptable", "distance": 2.915, "atom1_id": "///A/46/OG", "atom2_id": "///A/998/O2'", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 229, "atom1_serNum": 1872, "atom2_serNum": 1899, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/47/O", "atom2_id": "///A/51/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 230, "atom1_serNum": 1880, "atom2_serNum": 1910, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/48/O", "atom2_id": "///A/52/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 231, "atom1_serNum": 1886, "atom2_serNum": 1914, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/49/O", "atom2_id": "///A/53/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 232, "atom1_serNum": 1894, "atom2_serNum": 1922, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///A/50/O", "atom2_id": "///A/54/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 233, "atom1_serNum": 1902, "atom2_serNum": 1927, "donAcc_type": "standard", "distance": 2.970, "atom1_id": "///A/51/O", "atom2_id": "///A/55/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 234, "atom1_serNum": 1913, "atom2_serNum": 1936, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/52/O", "atom2_id": "///A/56/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 235, "atom1_serNum": 1917, "atom2_serNum": 1944, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/53/O", "atom2_id": "///A/57/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 236, "atom1_serNum": 1925, "atom2_serNum": 1956, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/54/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 237, "atom1_serNum": 1925, "atom2_serNum": 1965, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///A/54/O", "atom2_id": "///A/59/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 238, "atom1_serNum": 1930, "atom2_serNum": 1956, "donAcc_type": "standard", "distance": 3.013, "atom1_id": "///A/55/O", "atom2_id": "///A/58/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 239, "atom1_serNum": 1930, "atom2_serNum": 1964, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/55/O", "atom2_id": "///A/58/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 240, "atom1_serNum": 1939, "atom2_serNum": 1964, "donAcc_type": "standard", "distance": 3.265, "atom1_id": "///A/56/O", "atom2_id": "///A/58/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 241, "atom1_serNum": 1976, "atom2_serNum": 2259, "donAcc_type": "acceptable", "distance": 2.702, "atom1_id": "///A/60/OE1", "atom2_id": "///A/93/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 242, "atom1_serNum": 1981, "atom2_serNum": 2254, "donAcc_type": "standard", "distance": 2.652, "atom1_id": "///A/61/O", "atom2_id": "///A/93/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 243, "atom1_serNum": 1984, "atom2_serNum": 1990, "donAcc_type": "standard", "distance": 2.795, "atom1_id": "///A/62/N", "atom2_id": "///A/62/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 244, "atom1_serNum": 1991, "atom2_serNum": 3311, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/62/ND2", "atom2_id": "///A/222/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 245, "atom1_serNum": 1995, "atom2_serNum": 2279, "donAcc_type": "standard", "distance": 2.864, "atom1_id": "///A/63/O", "atom2_id": "///A/97/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 246, "atom1_serNum": 2009, "atom2_serNum": 3311, "donAcc_type": "standard", "distance": 2.842, "atom1_id": "///A/64/NH1", "atom2_id": "///A/222/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 247, "atom1_serNum": 2009, "atom2_serNum": 3312, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/64/NH1", "atom2_id": "///A/222/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 248, "atom1_serNum": 2010, "atom2_serNum": 3289, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///A/64/NH2", "atom2_id": "///A/219/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 249, "atom1_serNum": 2011, "atom2_serNum": 2282, "donAcc_type": "standard", "distance": 3.281, "atom1_id": "///A/65/N", "atom2_id": "///A/97/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 250, "atom1_serNum": 2014, "atom2_serNum": 2030, "donAcc_type": "standard", "distance": 2.791, "atom1_id": "///A/65/O", "atom2_id": "///A/67/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 251, "atom1_serNum": 2014, "atom2_serNum": 2302, "donAcc_type": "standard", "distance": 3.321, "atom1_id": "///A/65/O", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 252, "atom1_serNum": 2028, "atom2_serNum": 2307, "donAcc_type": "acceptable", "distance": 2.599, "atom1_id": "///A/66/OD1", "atom2_id": "///A/99/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 253, "atom1_serNum": 2029, "atom2_serNum": 3259, "donAcc_type": "acceptable", "distance": 3.027, "atom1_id": "///A/66/OD2", "atom2_id": "///A/215/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 254, "atom1_serNum": 2030, "atom2_serNum": 2036, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/67/N", "atom2_id": "///A/67/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 255, "atom1_serNum": 2030, "atom2_serNum": 2307, "donAcc_type": "acceptable", "distance": 3.432, "atom1_id": "///A/67/N", "atom2_id": "///A/99/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 256, "atom1_serNum": 2033, "atom2_serNum": 3112, "donAcc_type": "standard", "distance": 2.536, "atom1_id": "///A/67/O", "atom2_id": "///A/198/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 257, "atom1_serNum": 2036, "atom2_serNum": 2302, "donAcc_type": "standard", "distance": 3.236, "atom1_id": "///A/67/OD1", "atom2_id": "///A/99/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 258, "atom1_serNum": 2036, "atom2_serNum": 2308, "donAcc_type": "standard", "distance": 3.008, "atom1_id": "///A/67/OD1", "atom2_id": "///A/100/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 259, "atom1_serNum": 2036, "atom2_serNum": 2313, "donAcc_type": "acceptable", "distance": 2.863, "atom1_id": "///A/67/OD1", "atom2_id": "///A/100/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 260, "atom1_serNum": 2037, "atom2_serNum": 2313, "donAcc_type": "acceptable", "distance": 2.599, "atom1_id": "///A/67/OD2", "atom2_id": "///A/100/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 261, "atom1_serNum": 2041, "atom2_serNum": 3059, "donAcc_type": "standard", "distance": 3.384, "atom1_id": "///A/68/O", "atom2_id": "///A/192/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 262, "atom1_serNum": 2041, "atom2_serNum": 3060, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/68/O", "atom2_id": "///A/192/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 263, "atom1_serNum": 2048, "atom2_serNum": 2067, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/69/O", "atom2_id": "///A/72/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 264, "atom1_serNum": 2051, "atom2_serNum": 3077, "donAcc_type": "standard", "distance": 3.015, "atom1_id": "///A/69/OD1", "atom2_id": "///A/194/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 265, "atom1_serNum": 2083, "atom2_serNum": 3122, "donAcc_type": "standard", "distance": 3.328, "atom1_id": "///A/73/OE1", "atom2_id": "///A/199/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 266, "atom1_serNum": 2088, "atom2_serNum": 2110, "donAcc_type": "standard", "distance": 3.185, "atom1_id": "///A/74/O", "atom2_id": "///A/77/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 267, "atom1_serNum": 2092, "atom2_serNum": 2101, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/74/OD2", "atom2_id": "///A/76/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 268, "atom1_serNum": 2096, "atom2_serNum": 2129, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///A/75/O", "atom2_id": "///A/79/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 269, "atom1_serNum": 2104, "atom2_serNum": 2138, "donAcc_type": "standard", "distance": 3.200, "atom1_id": "///A/76/O", "atom2_id": "///A/80/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 270, "atom1_serNum": 2104, "atom2_serNum": 2143, "donAcc_type": "acceptable", "distance": 2.733, "atom1_id": "///A/76/O", "atom2_id": "///A/80/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 271, "atom1_serNum": 2113, "atom2_serNum": 2143, "donAcc_type": "acceptable", "distance": 2.826, "atom1_id": "///A/77/O", "atom2_id": "///A/80/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 272, "atom1_serNum": 2113, "atom2_serNum": 2144, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/77/O", "atom2_id": "///A/81/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 273, "atom1_serNum": 2125, "atom2_serNum": 2152, "donAcc_type": "standard", "distance": 3.249, "atom1_id": "///A/78/O", "atom2_id": "///A/82/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 274, "atom1_serNum": 2132, "atom2_serNum": 2161, "donAcc_type": "standard", "distance": 3.397, "atom1_id": "///A/79/O", "atom2_id": "///A/83/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 275, "atom1_serNum": 2141, "atom2_serNum": 2169, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/80/O", "atom2_id": "///A/84/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 276, "atom1_serNum": 2147, "atom2_serNum": 2177, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/81/O", "atom2_id": "///A/85/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 277, "atom1_serNum": 2155, "atom2_serNum": 2184, "donAcc_type": "standard", "distance": 3.107, "atom1_id": "///A/82/O", "atom2_id": "///A/86/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 278, "atom1_serNum": 2164, "atom2_serNum": 2193, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/83/O", "atom2_id": "///A/87/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 279, "atom1_serNum": 2172, "atom2_serNum": 2207, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/84/O", "atom2_id": "///A/88/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 280, "atom1_serNum": 2175, "atom2_serNum": 3940, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/84/OD1", "atom2_id": "///A/297/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 281, "atom1_serNum": 2175, "atom2_serNum": 3941, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///A/84/OD1", "atom2_id": "///A/297/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 282, "atom1_serNum": 2180, "atom2_serNum": 2219, "donAcc_type": "standard", "distance": 3.331, "atom1_id": "///A/85/O", "atom2_id": "///A/90/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 283, "atom1_serNum": 2187, "atom2_serNum": 2215, "donAcc_type": "standard", "distance": 2.742, "atom1_id": "///A/86/O", "atom2_id": "///A/89/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 284, "atom1_serNum": 2210, "atom2_serNum": 4018, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///A/88/O", "atom2_id": "///A/307/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 285, "atom1_serNum": 2257, "atom2_serNum": 2289, "donAcc_type": "standard", "distance": 3.214, "atom1_id": "///A/93/O", "atom2_id": "///A/97/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 286, "atom1_serNum": 2267, "atom2_serNum": 2286, "donAcc_type": "standard", "distance": 2.714, "atom1_id": "///A/95/O", "atom2_id": "///A/97/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 287, "atom1_serNum": 2290, "atom2_serNum": 2321, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/98/N", "atom2_id": "///A/101/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 288, "atom1_serNum": 2293, "atom2_serNum": 2314, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/98/O", "atom2_id": "///A/101/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 289, "atom1_serNum": 2305, "atom2_serNum": 2322, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///A/99/O", "atom2_id": "///A/102/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 290, "atom1_serNum": 2305, "atom2_serNum": 2334, "donAcc_type": "standard", "distance": 3.391, "atom1_id": "///A/99/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 291, "atom1_serNum": 2311, "atom2_serNum": 2334, "donAcc_type": "standard", "distance": 3.244, "atom1_id": "///A/100/O", "atom2_id": "///A/103/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 292, "atom1_serNum": 2325, "atom2_serNum": 2362, "donAcc_type": "standard", "distance": 2.820, "atom1_id": "///A/102/O", "atom2_id": "///A/106/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 293, "atom1_serNum": 2333, "atom2_serNum": 3312, "donAcc_type": "acceptable", "distance": 2.570, "atom1_id": "///A/102/OH", "atom2_id": "///A/222/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 294, "atom1_serNum": 2348, "atom2_serNum": 2380, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/104/O", "atom2_id": "///A/108/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 295, "atom1_serNum": 2351, "atom2_serNum": 3159, "donAcc_type": "standard", "distance": 2.988, "atom1_id": "///A/104/OD1", "atom2_id": "///A/204/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 296, "atom1_serNum": 2352, "atom2_serNum": 3159, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/104/OD2", "atom2_id": "///A/204/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 297, "atom1_serNum": 2356, "atom2_serNum": 2385, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///A/105/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 298, "atom1_serNum": 2365, "atom2_serNum": 2385, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/106/O", "atom2_id": "///A/109/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 299, "atom1_serNum": 2365, "atom2_serNum": 2397, "donAcc_type": "standard", "distance": 2.733, "atom1_id": "///A/106/O", "atom2_id": "///A/110/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 300, "atom1_serNum": 2370, "atom2_serNum": 3049, "donAcc_type": "acceptable", "distance": 2.826, "atom1_id": "///A/107/N", "atom2_id": "///A/191/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 301, "atom1_serNum": 2373, "atom2_serNum": 2402, "donAcc_type": "standard", "distance": 2.980, "atom1_id": "///A/107/O", "atom2_id": "///A/111/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 302, "atom1_serNum": 2383, "atom2_serNum": 2410, "donAcc_type": "standard", "distance": 3.071, "atom1_id": "///A/108/O", "atom2_id": "///A/112/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 303, "atom1_serNum": 2388, "atom2_serNum": 2419, "donAcc_type": "standard", "distance": 2.969, "atom1_id": "///A/109/O", "atom2_id": "///A/113/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 304, "atom1_serNum": 2396, "atom2_serNum": 3528, "donAcc_type": "acceptable", "distance": 2.732, "atom1_id": "///A/109/OH", "atom2_id": "///A/248/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 305, "atom1_serNum": 2400, "atom2_serNum": 2427, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/110/O", "atom2_id": "///A/114/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 306, "atom1_serNum": 2405, "atom2_serNum": 2435, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/111/O", "atom2_id": "///A/115/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 307, "atom1_serNum": 2413, "atom2_serNum": 2443, "donAcc_type": "standard", "distance": 2.808, "atom1_id": "///A/112/O", "atom2_id": "///A/116/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 308, "atom1_serNum": 2417, "atom2_serNum": 3525, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/112/OE1", "atom2_id": "///A/248/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 309, "atom1_serNum": 2418, "atom2_serNum": 3530, "donAcc_type": "acceptable", "distance": 2.709, "atom1_id": "///A/112/OE2", "atom2_id": "///A/248/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 310, "atom1_serNum": 2422, "atom2_serNum": 2452, "donAcc_type": "standard", "distance": 2.945, "atom1_id": "///A/113/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 311, "atom1_serNum": 2422, "atom2_serNum": 2456, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///A/113/O", "atom2_id": "///A/118/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 312, "atom1_serNum": 2430, "atom2_serNum": 2452, "donAcc_type": "standard", "distance": 2.750, "atom1_id": "///A/114/O", "atom2_id": "///A/117/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 313, "atom1_serNum": 2455, "atom2_serNum": 2920, "donAcc_type": "standard", "distance": 3.580, "atom1_id": "///A/117/O", "atom2_id": "///A/175/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 314, "atom1_serNum": 2459, "atom2_serNum": 2912, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///A/118/O", "atom2_id": "///A/175/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 315, "atom1_serNum": 2469, "atom2_serNum": 2899, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/120/N", "atom2_id": "///A/173/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 316, "atom1_serNum": 2472, "atom2_serNum": 2488, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/120/O", "atom2_id": "///A/122/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 317, "atom1_serNum": 2472, "atom2_serNum": 2896, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/120/O", "atom2_id": "///A/173/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 318, "atom1_serNum": 2480, "atom2_serNum": 3015, "donAcc_type": "acceptable", "distance": 2.823, "atom1_id": "///A/120/OH", "atom2_id": "///A/187/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 319, "atom1_serNum": 2484, "atom2_serNum": 2710, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/121/O", "atom2_id": "///A/148/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 320, "atom1_serNum": 2484, "atom2_serNum": 2713, "donAcc_type": "standard", "distance": 3.387, "atom1_id": "///A/121/O", "atom2_id": "///A/148/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 321, "atom1_serNum": 2488, "atom2_serNum": 2885, "donAcc_type": "standard", "distance": 2.891, "atom1_id": "///A/122/N", "atom2_id": "///A/171/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 322, "atom1_serNum": 2491, "atom2_serNum": 2882, "donAcc_type": "standard", "distance": 3.300, "atom1_id": "///A/122/O", "atom2_id": "///A/171/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 323, "atom1_serNum": 2494, "atom2_serNum": 2496, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///A/122/OD1", "atom2_id": "///A/123/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 324, "atom1_serNum": 2494, "atom2_serNum": 2505, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///A/122/OD1", "atom2_id": "///A/124/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 325, "atom1_serNum": 2494, "atom2_serNum": 2664, "donAcc_type": "acceptable", "distance": 2.697, "atom1_id": "///A/122/OD1", "atom2_id": "///A/143/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 326, "atom1_serNum": 2495, "atom2_serNum": 2903, "donAcc_type": "standard", "distance": 3.073, "atom1_id": "///A/122/OD2", "atom2_id": "///A/173/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 327, "atom1_serNum": 2495, "atom2_serNum": 2906, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///A/122/OD2", "atom2_id": "///A/173/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 328, "atom1_serNum": 2504, "atom2_serNum": 2713, "donAcc_type": "standard", "distance": 2.704, "atom1_id": "///A/123/OE2", "atom2_id": "///A/148/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 329, "atom1_serNum": 2513, "atom2_serNum": 2543, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/125/N", "atom2_id": "///A/128/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 330, "atom1_serNum": 2516, "atom2_serNum": 2545, "donAcc_type": "standard", "distance": 3.042, "atom1_id": "///A/125/O", "atom2_id": "///A/129/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 331, "atom1_serNum": 2518, "atom2_serNum": 2536, "donAcc_type": "acceptable", "distance": 3.073, "atom1_id": "///A/125/OG1", "atom2_id": "///A/128/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 332, "atom1_serNum": 2523, "atom2_serNum": 2553, "donAcc_type": "standard", "distance": 3.535, "atom1_id": "///A/126/O", "atom2_id": "///A/130/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 333, "atom1_serNum": 2530, "atom2_serNum": 2564, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/127/O", "atom2_id": "///A/131/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 334, "atom1_serNum": 2539, "atom2_serNum": 2573, "donAcc_type": "standard", "distance": 2.837, "atom1_id": "///A/128/O", "atom2_id": "///A/132/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 335, "atom1_serNum": 2556, "atom2_serNum": 2585, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/130/O", "atom2_id": "///A/133/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 336, "atom1_serNum": 2576, "atom2_serNum": 2642, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/132/O", "atom2_id": "///A/141/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 337, "atom1_serNum": 2588, "atom2_serNum": 3004, "donAcc_type": "standard", "distance": 2.767, "atom1_id": "///A/133/O", "atom2_id": "///A/186/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 338, "atom1_serNum": 2600, "atom2_serNum": 2625, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///A/135/N", "atom2_id": "///A/138/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 339, "atom1_serNum": 2603, "atom2_serNum": 3007, "donAcc_type": "standard", "distance": 2.558, "atom1_id": "///A/135/O", "atom2_id": "///A/186/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 340, "atom1_serNum": 2605, "atom2_serNum": 2615, "donAcc_type": "acceptable", "distance": 3.132, "atom1_id": "///A/135/OG1", "atom2_id": "///A/137/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 341, "atom1_serNum": 2605, "atom2_serNum": 2622, "donAcc_type": "acceptable", "distance": 2.682, "atom1_id": "///A/135/OG1", "atom2_id": "///A/138/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 342, "atom1_serNum": 2638, "atom2_serNum": 2940, "donAcc_type": "standard", "distance": 2.851, "atom1_id": "///A/140/N", "atom2_id": "///A/178/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 343, "atom1_serNum": 2662, "atom2_serNum": 2684, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///A/143/O", "atom2_id": "///A/146/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 344, "atom1_serNum": 2664, "atom2_serNum": 2672, "donAcc_type": "acceptable", "distance": 3.228, "atom1_id": "///A/143/OG", "atom2_id": "///A/145/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 345, "atom1_serNum": 2675, "atom2_serNum": 2703, "donAcc_type": "standard", "distance": 3.526, "atom1_id": "///A/145/O", "atom2_id": "///A/148/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 346, "atom1_serNum": 2687, "atom2_serNum": 2920, "donAcc_type": "standard", "distance": 3.228, "atom1_id": "///A/146/O", "atom2_id": "///A/175/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 347, "atom1_serNum": 2691, "atom2_serNum": 3015, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/146/NE", "atom2_id": "///A/187/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 348, "atom1_serNum": 2694, "atom2_serNum": 3014, "donAcc_type": "standard", "distance": 3.146, "atom1_id": "///A/146/NH2", "atom2_id": "///A/187/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 349, "atom1_serNum": 2701, "atom2_serNum": 2920, "donAcc_type": "standard", "distance": 3.968, "atom1_id": "///A/147/OD1", "atom2_id": "///A/175/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 350, "atom1_serNum": 2714, "atom2_serNum": 2744, "donAcc_type": "standard", "distance": 2.695, "atom1_id": "///A/149/N", "atom2_id": "///A/152/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 351, "atom1_serNum": 2717, "atom2_serNum": 2736, "donAcc_type": "standard", "distance": 2.746, "atom1_id": "///A/149/O", "atom2_id": "///A/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 352, "atom1_serNum": 2717, "atom2_serNum": 2745, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/149/O", "atom2_id": "///A/153/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 353, "atom1_serNum": 2719, "atom2_serNum": 2736, "donAcc_type": "acceptable", "distance": 3.097, "atom1_id": "///A/149/OG", "atom2_id": "///A/152/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 354, "atom1_serNum": 2719, "atom2_serNum": 2744, "donAcc_type": "acceptable", "distance": 2.957, "atom1_id": "///A/149/OG", "atom2_id": "///A/152/OE2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 355, "atom1_serNum": 2723, "atom2_serNum": 2753, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/150/O", "atom2_id": "///A/154/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 356, "atom1_serNum": 2730, "atom2_serNum": 2761, "donAcc_type": "standard", "distance": 2.939, "atom1_id": "///A/151/O", "atom2_id": "///A/155/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 357, "atom1_serNum": 2739, "atom2_serNum": 2766, "donAcc_type": "standard", "distance": 2.747, "atom1_id": "///A/152/O", "atom2_id": "///A/156/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 358, "atom1_serNum": 2748, "atom2_serNum": 2774, "donAcc_type": "standard", "distance": 2.693, "atom1_id": "///A/153/O", "atom2_id": "///A/157/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 359, "atom1_serNum": 2756, "atom2_serNum": 2785, "donAcc_type": "standard", "distance": 3.064, "atom1_id": "///A/154/O", "atom2_id": "///A/158/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 360, "atom1_serNum": 2764, "atom2_serNum": 2794, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/155/O", "atom2_id": "///A/159/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 361, "atom1_serNum": 2769, "atom2_serNum": 2803, "donAcc_type": "standard", "distance": 3.066, "atom1_id": "///A/156/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 362, "atom1_serNum": 2777, "atom2_serNum": 2803, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///A/157/O", "atom2_id": "///A/160/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 363, "atom1_serNum": 2777, "atom2_serNum": 2811, "donAcc_type": "standard", "distance": 2.932, "atom1_id": "///A/157/O", "atom2_id": "///A/161/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 364, "atom1_serNum": 2788, "atom2_serNum": 2822, "donAcc_type": "standard", "distance": 2.726, "atom1_id": "///A/158/O", "atom2_id": "///A/162/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 365, "atom1_serNum": 2792, "atom2_serNum": 2820, "donAcc_type": "standard", "distance": 3.427, "atom1_id": "///A/158/OE1", "atom2_id": "///A/161/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 366, "atom1_serNum": 2793, "atom2_serNum": 2821, "donAcc_type": "standard", "distance": 2.936, "atom1_id": "///A/158/OE2", "atom2_id": "///A/161/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 367, "atom1_serNum": 2797, "atom2_serNum": 2827, "donAcc_type": "standard", "distance": 3.097, "atom1_id": "///A/159/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 368, "atom1_serNum": 2797, "atom2_serNum": 2831, "donAcc_type": "standard", "distance": 2.806, "atom1_id": "///A/159/O", "atom2_id": "///A/164/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 369, "atom1_serNum": 2806, "atom2_serNum": 2827, "donAcc_type": "standard", "distance": 2.901, "atom1_id": "///A/160/O", "atom2_id": "///A/163/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 370, "atom1_serNum": 2849, "atom2_serNum": 2868, "donAcc_type": "standard", "distance": 2.823, "atom1_id": "///A/166/O", "atom2_id": "///A/169/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 371, "atom1_serNum": 2863, "atom2_serNum": 3078, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/167/OE2", "atom2_id": "///A/195/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 372, "atom1_serNum": 2888, "atom2_serNum": 3041, "donAcc_type": "standard", "distance": 2.963, "atom1_id": "///A/172/N", "atom2_id": "///A/191/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 373, "atom1_serNum": 2891, "atom2_serNum": 3030, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/172/O", "atom2_id": "///A/190/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 374, "atom1_serNum": 2891, "atom2_serNum": 3038, "donAcc_type": "standard", "distance": 3.280, "atom1_id": "///A/172/O", "atom2_id": "///A/191/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 375, "atom1_serNum": 2905, "atom2_serNum": 3000, "donAcc_type": "standard", "distance": 3.412, "atom1_id": "///A/173/NH1", "atom2_id": "///A/186/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 376, "atom1_serNum": 2905, "atom2_serNum": 3011, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///A/173/NH1", "atom2_id": "///A/187/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 377, "atom1_serNum": 2907, "atom2_serNum": 3019, "donAcc_type": "standard", "distance": 3.091, "atom1_id": "///A/174/N", "atom2_id": "///A/188/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 378, "atom1_serNum": 2910, "atom2_serNum": 2921, "donAcc_type": "standard", "distance": 3.239, "atom1_id": "///A/174/O", "atom2_id": "///A/176/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 379, "atom1_serNum": 2921, "atom2_serNum": 3014, "donAcc_type": "standard", "distance": 2.633, "atom1_id": "///A/176/N", "atom2_id": "///A/187/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 380, "atom1_serNum": 2929, "atom2_serNum": 2992, "donAcc_type": "standard", "distance": 3.235, "atom1_id": "///A/177/N", "atom2_id": "///A/185/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 381, "atom1_serNum": 2932, "atom2_serNum": 2945, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///A/177/O", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 382, "atom1_serNum": 2932, "atom2_serNum": 2950, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/177/O", "atom2_id": "///A/180/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 383, "atom1_serNum": 2935, "atom2_serNum": 2945, "donAcc_type": "standard", "distance": 2.965, "atom1_id": "///A/177/OD1", "atom2_id": "///A/179/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 384, "atom1_serNum": 2953, "atom2_serNum": 3006, "donAcc_type": "standard", "distance": 2.510, "atom1_id": "///A/180/O", "atom2_id": "///A/186/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 385, "atom1_serNum": 2966, "atom2_serNum": 2989, "donAcc_type": "standard", "distance": 2.810, "atom1_id": "///A/182/O", "atom2_id": "///A/185/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 386, "atom1_serNum": 2977, "atom2_serNum": 2997, "donAcc_type": "standard", "distance": 3.302, "atom1_id": "///A/183/O", "atom2_id": "///A/186/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 387, "atom1_serNum": 2992, "atom2_serNum": 3008, "donAcc_type": "standard", "distance": 2.849, "atom1_id": "///A/185/O", "atom2_id": "///A/187/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 388, "atom1_serNum": 3033, "atom2_serNum": 3207, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/190/O", "atom2_id": "///A/210/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 389, "atom1_serNum": 3050, "atom2_serNum": 3191, "donAcc_type": "standard", "distance": 3.094, "atom1_id": "///A/192/N", "atom2_id": "///A/208/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 390, "atom1_serNum": 3053, "atom2_serNum": 3188, "donAcc_type": "standard", "distance": 3.040, "atom1_id": "///A/192/O", "atom2_id": "///A/208/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 391, "atom1_serNum": 3059, "atom2_serNum": 3203, "donAcc_type": "standard", "distance": 2.996, "atom1_id": "///A/192/NH1", "atom2_id": "///A/209/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 392, "atom1_serNum": 3069, "atom2_serNum": 3177, "donAcc_type": "standard", "distance": 2.957, "atom1_id": "///A/194/N", "atom2_id": "///A/206/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 393, "atom1_serNum": 3092, "atom2_serNum": 3199, "donAcc_type": "acceptable", "distance": 2.950, "atom1_id": "///A/196/O", "atom2_id": "///A/208/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 394, "atom1_serNum": 3101, "atom2_serNum": 3150, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///A/197/OE1", "atom2_id": "///A/203/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 395, "atom1_serNum": 3103, "atom2_serNum": 3142, "donAcc_type": "standard", "distance": 2.682, "atom1_id": "///A/198/N", "atom2_id": "///A/202/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 396, "atom1_serNum": 3106, "atom2_serNum": 3139, "donAcc_type": "standard", "distance": 3.105, "atom1_id": "///A/198/O", "atom2_id": "///A/202/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 397, "atom1_serNum": 3109, "atom2_serNum": 3137, "donAcc_type": "acceptable", "distance": 2.984, "atom1_id": "///A/198/ND1", "atom2_id": "///A/201/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 398, "atom1_serNum": 3119, "atom2_serNum": 3131, "donAcc_type": "acceptable", "distance": 3.319, "atom1_id": "///A/199/ND1", "atom2_id": "///A/200/NE2", "atom_pair": "N:N", "residue_pair": "aa:aa" }, { "index": 399, "atom1_serNum": 3135, "atom2_serNum": 3143, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/201/O", "atom2_id": "///A/203/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 400, "atom1_serNum": 3135, "atom2_serNum": 3151, "donAcc_type": "standard", "distance": 3.063, "atom1_id": "///A/201/O", "atom2_id": "///A/204/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 401, "atom1_serNum": 3163, "atom2_serNum": 3199, "donAcc_type": "acceptable", "distance": 2.524, "atom1_id": "///A/205/O", "atom2_id": "///A/208/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 402, "atom1_serNum": 3210, "atom2_serNum": 3246, "donAcc_type": "standard", "distance": 3.014, "atom1_id": "///A/210/O", "atom2_id": "///A/214/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 403, "atom1_serNum": 3210, "atom2_serNum": 3251, "donAcc_type": "acceptable", "distance": 2.735, "atom1_id": "///A/210/O", "atom2_id": "///A/214/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 404, "atom1_serNum": 3218, "atom2_serNum": 3253, "donAcc_type": "standard", "distance": 2.694, "atom1_id": "///A/211/O", "atom2_id": "///A/215/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 405, "atom1_serNum": 3230, "atom2_serNum": 3263, "donAcc_type": "standard", "distance": 3.804, "atom1_id": "///A/212/O", "atom2_id": "///A/216/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 406, "atom1_serNum": 3233, "atom2_serNum": 3420, "donAcc_type": "questionable", "distance": 2.664, "atom1_id": "///A/212/OD1", "atom2_id": "///A/236/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 407, "atom1_serNum": 3238, "atom2_serNum": 3269, "donAcc_type": "standard", "distance": 3.744, "atom1_id": "///A/213/O", "atom2_id": "///A/217/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 408, "atom1_serNum": 3249, "atom2_serNum": 3277, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/214/O", "atom2_id": "///A/218/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 409, "atom1_serNum": 3249, "atom2_serNum": 3282, "donAcc_type": "acceptable", "distance": 2.784, "atom1_id": "///A/214/O", "atom2_id": "///A/218/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 410, "atom1_serNum": 3256, "atom2_serNum": 3283, "donAcc_type": "standard", "distance": 3.052, "atom1_id": "///A/215/O", "atom2_id": "///A/219/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 411, "atom1_serNum": 3262, "atom2_serNum": 3347, "donAcc_type": "acceptable", "distance": 3.755, "atom1_id": "///A/215/NE2", "atom2_id": "///A/227/OG", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 412, "atom1_serNum": 3266, "atom2_serNum": 3291, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/216/O", "atom2_id": "///A/220/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 413, "atom1_serNum": 3272, "atom2_serNum": 3296, "donAcc_type": "standard", "distance": 2.872, "atom1_id": "///A/217/O", "atom2_id": "///A/221/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 414, "atom1_serNum": 3280, "atom2_serNum": 3304, "donAcc_type": "standard", "distance": 2.934, "atom1_id": "///A/218/O", "atom2_id": "///A/222/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 415, "atom1_serNum": 3286, "atom2_serNum": 3313, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/219/O", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 416, "atom1_serNum": 3286, "atom2_serNum": 3317, "donAcc_type": "standard", "distance": 2.918, "atom1_id": "///A/219/O", "atom2_id": "///A/224/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 417, "atom1_serNum": 3290, "atom2_serNum": 3347, "donAcc_type": "acceptable", "distance": 2.823, "atom1_id": "///A/219/OD2", "atom2_id": "///A/227/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 418, "atom1_serNum": 3290, "atom2_serNum": 3463, "donAcc_type": "acceptable", "distance": 2.765, "atom1_id": "///A/219/OD2", "atom2_id": "///A/240/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 419, "atom1_serNum": 3294, "atom2_serNum": 3313, "donAcc_type": "standard", "distance": 3.034, "atom1_id": "///A/220/O", "atom2_id": "///A/223/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 420, "atom1_serNum": 3328, "atom2_serNum": 3571, "donAcc_type": "standard", "distance": 3.474, "atom1_id": "///A/225/O", "atom2_id": "///A/254/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 421, "atom1_serNum": 3342, "atom2_serNum": 3574, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/227/N", "atom2_id": "///A/254/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 422, "atom1_serNum": 3345, "atom2_serNum": 3591, "donAcc_type": "standard", "distance": 2.794, "atom1_id": "///A/227/O", "atom2_id": "///A/256/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 423, "atom1_serNum": 3356, "atom2_serNum": 3594, "donAcc_type": "standard", "distance": 2.997, "atom1_id": "///A/229/N", "atom2_id": "///A/256/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 424, "atom1_serNum": 3359, "atom2_serNum": 3612, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/229/O", "atom2_id": "///A/258/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 425, "atom1_serNum": 3365, "atom2_serNum": 3386, "donAcc_type": "standard", "distance": 3.454, "atom1_id": "///A/230/O", "atom2_id": "///A/233/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 426, "atom1_serNum": 3367, "atom2_serNum": 3384, "donAcc_type": "acceptable", "distance": 2.652, "atom1_id": "///A/230/OG1", "atom2_id": "///A/232/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 427, "atom1_serNum": 3372, "atom2_serNum": 3397, "donAcc_type": "standard", "distance": 2.971, "atom1_id": "///A/231/O", "atom2_id": "///A/234/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 428, "atom1_serNum": 3377, "atom2_serNum": 3384, "donAcc_type": "standard", "distance": 3.079, "atom1_id": "///A/232/N", "atom2_id": "///A/232/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 429, "atom1_serNum": 3380, "atom2_serNum": 3421, "donAcc_type": "standard", "distance": 3.373, "atom1_id": "///A/232/O", "atom2_id": "///A/236/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 430, "atom1_serNum": 3389, "atom2_serNum": 3422, "donAcc_type": "standard", "distance": 3.186, "atom1_id": "///A/233/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 431, "atom1_serNum": 3389, "atom2_serNum": 3590, "donAcc_type": "standard", "distance": 2.690, "atom1_id": "///A/233/O", "atom2_id": "///A/255/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 432, "atom1_serNum": 3400, "atom2_serNum": 3422, "donAcc_type": "standard", "distance": 3.174, "atom1_id": "///A/234/O", "atom2_id": "///A/237/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 433, "atom1_serNum": 3400, "atom2_serNum": 3442, "donAcc_type": "standard", "distance": 3.028, "atom1_id": "///A/234/O", "atom2_id": "///A/238/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 434, "atom1_serNum": 3404, "atom2_serNum": 4102, "donAcc_type": "standard", "distance": 3.372, "atom1_id": "///A/234/OE1", "atom2_id": "///A/317/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 435, "atom1_serNum": 3409, "atom2_serNum": 3433, "donAcc_type": "standard", "distance": 3.128, "atom1_id": "///A/235/O", "atom2_id": "///A/238/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 436, "atom1_serNum": 3417, "atom2_serNum": 3444, "donAcc_type": "standard", "distance": 3.137, "atom1_id": "///A/236/O", "atom2_id": "///A/239/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 437, "atom1_serNum": 3417, "atom2_serNum": 3452, "donAcc_type": "standard", "distance": 3.101, "atom1_id": "///A/236/O", "atom2_id": "///A/240/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 438, "atom1_serNum": 3425, "atom2_serNum": 3464, "donAcc_type": "standard", "distance": 2.902, "atom1_id": "///A/237/O", "atom2_id": "///A/241/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 439, "atom1_serNum": 3431, "atom2_serNum": 3610, "donAcc_type": "standard", "distance": 3.072, "atom1_id": "///A/237/NH1", "atom2_id": "///A/257/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 440, "atom1_serNum": 3431, "atom2_serNum": 3611, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/237/NH1", "atom2_id": "///A/257/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 441, "atom1_serNum": 3436, "atom2_serNum": 3472, "donAcc_type": "standard", "distance": 3.070, "atom1_id": "///A/238/O", "atom2_id": "///A/242/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 442, "atom1_serNum": 3447, "atom2_serNum": 3486, "donAcc_type": "standard", "distance": 3.036, "atom1_id": "///A/239/O", "atom2_id": "///A/243/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 443, "atom1_serNum": 3455, "atom2_serNum": 3493, "donAcc_type": "standard", "distance": 3.527, "atom1_id": "///A/240/O", "atom2_id": "///A/244/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 444, "atom1_serNum": 3467, "atom2_serNum": 3501, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/241/O", "atom2_id": "///A/245/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 445, "atom1_serNum": 3470, "atom2_serNum": 3563, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/241/OD1", "atom2_id": "///A/252/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 446, "atom1_serNum": 3470, "atom2_serNum": 3580, "donAcc_type": "standard", "distance": 2.769, "atom1_id": "///A/241/OD1", "atom2_id": "///A/254/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 447, "atom1_serNum": 3475, "atom2_serNum": 3509, "donAcc_type": "standard", "distance": 2.859, "atom1_id": "///A/242/O", "atom2_id": "///A/246/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 448, "atom1_serNum": 3475, "atom2_serNum": 3516, "donAcc_type": "standard", "distance": 2.839, "atom1_id": "///A/242/O", "atom2_id": "///A/246/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 449, "atom1_serNum": 3496, "atom2_serNum": 3517, "donAcc_type": "standard", "distance": 3.226, "atom1_id": "///A/244/O", "atom2_id": "///A/247/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 450, "atom1_serNum": 3507, "atom2_serNum": 3560, "donAcc_type": "acceptable", "distance": 3.273, "atom1_id": "///A/245/OD1", "atom2_id": "///A/252/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 451, "atom1_serNum": 3520, "atom2_serNum": 3532, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///A/247/O", "atom2_id": "///A/249/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 452, "atom1_serNum": 3590, "atom2_serNum": 3611, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/255/NE2", "atom2_id": "///A/257/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 453, "atom1_serNum": 3603, "atom2_serNum": 3610, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/257/N", "atom2_id": "///A/257/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 454, "atom1_serNum": 3623, "atom2_serNum": 4090, "donAcc_type": "standard", "distance": 2.622, "atom1_id": "///A/259/N", "atom2_id": "///A/316/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 455, "atom1_serNum": 3628, "atom2_serNum": 4106, "donAcc_type": "acceptable", "distance": 2.673, "atom1_id": "///A/259/OG", "atom2_id": "///A/318/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 456, "atom1_serNum": 3628, "atom2_serNum": 4127, "donAcc_type": "acceptable", "distance": 3.060, "atom1_id": "///A/259/OG", "atom2_id": "///A/320/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 457, "atom1_serNum": 3640, "atom2_serNum": 5871, "donAcc_type": "standard", "distance": 2.800, "atom1_id": "///A/261/N", "atom2_id": "///A/998/N1", "atom_pair": "N:N", "residue_pair": "aa:ligand" }, { "index": 458, "atom1_serNum": 3643, "atom2_serNum": 5870, "donAcc_type": "standard", "distance": 3.247, "atom1_id": "///A/261/O", "atom2_id": "///A/998/N6", "atom_pair": "O:N", "residue_pair": "aa:ligand" }, { "index": 459, "atom1_serNum": 3651, "atom2_serNum": 4135, "donAcc_type": "standard", "distance": 2.955, "atom1_id": "///A/262/O", "atom2_id": "///A/322/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 460, "atom1_serNum": 3655, "atom2_serNum": 4123, "donAcc_type": "standard", "distance": 2.870, "atom1_id": "///A/262/ND2", "atom2_id": "///A/320/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 461, "atom1_serNum": 3659, "atom2_serNum": 3688, "donAcc_type": "questionable", "distance": 3.258, "atom1_id": "///A/263/O", "atom2_id": "///A/266/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 462, "atom1_serNum": 3664, "atom2_serNum": 4138, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/264/N", "atom2_id": "///A/322/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 463, "atom1_serNum": 3673, "atom2_serNum": 5307, "donAcc_type": "standard", "distance": 2.686, "atom1_id": "///A/265/N", "atom2_id": "///A/479/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 464, "atom1_serNum": 3676, "atom2_serNum": 5280, "donAcc_type": "standard", "distance": 3.574, "atom1_id": "///A/265/O", "atom2_id": "///A/476/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 465, "atom1_serNum": 3699, "atom2_serNum": 5844, "donAcc_type": "acceptable", "distance": 3.282, "atom1_id": "///A/268/N", "atom2_id": "///A/1395/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 466, "atom1_serNum": 3710, "atom2_serNum": 3733, "donAcc_type": "standard", "distance": 2.863, "atom1_id": "///A/269/O", "atom2_id": "///A/272/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 467, "atom1_serNum": 3710, "atom2_serNum": 3742, "donAcc_type": "standard", "distance": 2.759, "atom1_id": "///A/269/O", "atom2_id": "///A/273/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 468, "atom1_serNum": 3712, "atom2_serNum": 3741, "donAcc_type": "acceptable", "distance": 3.309, "atom1_id": "///A/269/OG", "atom2_id": "///A/272/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 469, "atom1_serNum": 3712, "atom2_serNum": 5844, "donAcc_type": "acceptable", "distance": 2.534, "atom1_id": "///A/269/OG", "atom2_id": "///A/1395/O1", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 470, "atom1_serNum": 3712, "atom2_serNum": 5846, "donAcc_type": "acceptable", "distance": 2.883, "atom1_id": "///A/269/OG", "atom2_id": "///A/1395/O3", "atom_pair": "O:O", "residue_pair": "aa:ligand" }, { "index": 471, "atom1_serNum": 3716, "atom2_serNum": 3750, "donAcc_type": "standard", "distance": 2.762, "atom1_id": "///A/270/O", "atom2_id": "///A/274/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 472, "atom1_serNum": 3721, "atom2_serNum": 5854, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///A/270/NZ", "atom2_id": "///A/998/OP1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 473, "atom1_serNum": 3721, "atom2_serNum": 5855, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/270/NZ", "atom2_id": "///A/998/OP2", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 474, "atom1_serNum": 3725, "atom2_serNum": 3758, "donAcc_type": "standard", "distance": 3.090, "atom1_id": "///A/271/O", "atom2_id": "///A/275/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 475, "atom1_serNum": 3736, "atom2_serNum": 3766, "donAcc_type": "standard", "distance": 3.083, "atom1_id": "///A/272/O", "atom2_id": "///A/276/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 476, "atom1_serNum": 3741, "atom2_serNum": 5847, "donAcc_type": "acceptable", "distance": 3.412, "atom1_id": "///A/272/NZ", "atom2_id": "///A/1395/O4", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 477, "atom1_serNum": 3745, "atom2_serNum": 3774, "donAcc_type": "standard", "distance": 3.136, "atom1_id": "///A/273/O", "atom2_id": "///A/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 478, "atom1_serNum": 3753, "atom2_serNum": 3774, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/274/O", "atom2_id": "///A/277/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 479, "atom1_serNum": 3753, "atom2_serNum": 3781, "donAcc_type": "standard", "distance": 2.592, "atom1_id": "///A/274/O", "atom2_id": "///A/278/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 480, "atom1_serNum": 3761, "atom2_serNum": 3788, "donAcc_type": "standard", "distance": 2.789, "atom1_id": "///A/275/O", "atom2_id": "///A/279/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 481, "atom1_serNum": 3769, "atom2_serNum": 3805, "donAcc_type": "standard", "distance": 2.853, "atom1_id": "///A/276/O", "atom2_id": "///A/281/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 482, "atom1_serNum": 3777, "atom2_serNum": 3796, "donAcc_type": "standard", "distance": 3.258, "atom1_id": "///A/277/O", "atom2_id": "///A/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 483, "atom1_serNum": 3784, "atom2_serNum": 3796, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/278/O", "atom2_id": "///A/280/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 484, "atom1_serNum": 3808, "atom2_serNum": 3881, "donAcc_type": "standard", "distance": 3.219, "atom1_id": "///A/281/O", "atom2_id": "///A/289/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 485, "atom1_serNum": 3822, "atom2_serNum": 3864, "donAcc_type": "standard", "distance": 2.737, "atom1_id": "///A/283/N", "atom2_id": "///A/287/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 486, "atom1_serNum": 3829, "atom2_serNum": 3952, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/283/OE1", "atom2_id": "///A/298/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 487, "atom1_serNum": 3829, "atom2_serNum": 5704, "donAcc_type": "standard", "distance": 3.027, "atom1_id": "///A/283/OE1", "atom2_id": "///A/530/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 488, "atom1_serNum": 3830, "atom2_serNum": 5231, "donAcc_type": "standard", "distance": 3.714, "atom1_id": "///A/283/OE2", "atom2_id": "///A/470/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 489, "atom1_serNum": 3834, "atom2_serNum": 3857, "donAcc_type": "standard", "distance": 3.109, "atom1_id": "///A/284/O", "atom2_id": "///A/287/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 490, "atom1_serNum": 3838, "atom2_serNum": 3903, "donAcc_type": "acceptable", "distance": 2.556, "atom1_id": "///A/285/O", "atom2_id": "///A/292/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 491, "atom1_serNum": 3856, "atom2_serNum": 3951, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/286/OD2", "atom2_id": "///A/298/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 492, "atom1_serNum": 3860, "atom2_serNum": 3883, "donAcc_type": "standard", "distance": 2.940, "atom1_id": "///A/287/O", "atom2_id": "///A/290/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 493, "atom1_serNum": 3863, "atom2_serNum": 3865, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/287/OD1", "atom2_id": "///A/288/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 494, "atom1_serNum": 3863, "atom2_serNum": 3872, "donAcc_type": "standard", "distance": 3.125, "atom1_id": "///A/287/OD1", "atom2_id": "///A/289/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 495, "atom1_serNum": 3868, "atom2_serNum": 3962, "donAcc_type": "standard", "distance": 3.113, "atom1_id": "///A/288/O", "atom2_id": "///A/299/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 496, "atom1_serNum": 3901, "atom2_serNum": 3923, "donAcc_type": "standard", "distance": 2.973, "atom1_id": "///A/292/O", "atom2_id": "///A/296/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 497, "atom1_serNum": 3903, "atom2_serNum": 3919, "donAcc_type": "acceptable", "distance": 2.867, "atom1_id": "///A/292/OG1", "atom2_id": "///A/295/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 498, "atom1_serNum": 3908, "atom2_serNum": 3931, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/293/O", "atom2_id": "///A/297/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 499, "atom1_serNum": 3916, "atom2_serNum": 3942, "donAcc_type": "standard", "distance": 2.857, "atom1_id": "///A/294/O", "atom2_id": "///A/298/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 500, "atom1_serNum": 3922, "atom2_serNum": 3953, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/295/O", "atom2_id": "///A/299/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 501, "atom1_serNum": 3926, "atom2_serNum": 3964, "donAcc_type": "standard", "distance": 3.133, "atom1_id": "///A/296/O", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 502, "atom1_serNum": 3926, "atom2_serNum": 3968, "donAcc_type": "standard", "distance": 2.740, "atom1_id": "///A/296/O", "atom2_id": "///A/301/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 503, "atom1_serNum": 3934, "atom2_serNum": 3964, "donAcc_type": "standard", "distance": 2.638, "atom1_id": "///A/297/O", "atom2_id": "///A/300/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 504, "atom1_serNum": 3945, "atom2_serNum": 5773, "donAcc_type": "standard", "distance": 2.977, "atom1_id": "///A/298/O", "atom2_id": "///A/539/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 505, "atom1_serNum": 3956, "atom2_serNum": 5790, "donAcc_type": "acceptable", "distance": 2.731, "atom1_id": "///A/299/O", "atom2_id": "///A/541/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 506, "atom1_serNum": 3960, "atom2_serNum": 5788, "donAcc_type": "standard", "distance": 2.926, "atom1_id": "///A/299/NE", "atom2_id": "///A/541/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 507, "atom1_serNum": 3983, "atom2_serNum": 3997, "donAcc_type": "standard", "distance": 2.543, "atom1_id": "///A/302/O", "atom2_id": "///A/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 508, "atom1_serNum": 3983, "atom2_serNum": 4002, "donAcc_type": "acceptable", "distance": 2.632, "atom1_id": "///A/302/O", "atom2_id": "///A/305/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 509, "atom1_serNum": 3983, "atom2_serNum": 4003, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/302/O", "atom2_id": "///A/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 510, "atom1_serNum": 3985, "atom2_serNum": 3997, "donAcc_type": "acceptable", "distance": 2.965, "atom1_id": "///A/302/OG1", "atom2_id": "///A/305/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 511, "atom1_serNum": 3985, "atom2_serNum": 4002, "donAcc_type": "acceptable", "distance": 3.053, "atom1_id": "///A/302/OG1", "atom2_id": "///A/305/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 512, "atom1_serNum": 3985, "atom2_serNum": 4235, "donAcc_type": "acceptable", "distance": 2.541, "atom1_id": "///A/302/OG1", "atom2_id": "///A/334/OD2", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 513, "atom1_serNum": 3990, "atom2_serNum": 4003, "donAcc_type": "standard", "distance": 3.039, "atom1_id": "///A/303/O", "atom2_id": "///A/306/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 514, "atom1_serNum": 3990, "atom2_serNum": 4011, "donAcc_type": "standard", "distance": 2.927, "atom1_id": "///A/303/O", "atom2_id": "///A/307/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 515, "atom1_serNum": 3995, "atom2_serNum": 4022, "donAcc_type": "standard", "distance": 3.121, "atom1_id": "///A/304/O", "atom2_id": "///A/308/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 516, "atom1_serNum": 4000, "atom2_serNum": 4031, "donAcc_type": "standard", "distance": 2.975, "atom1_id": "///A/305/O", "atom2_id": "///A/309/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 517, "atom1_serNum": 4006, "atom2_serNum": 4042, "donAcc_type": "standard", "distance": 2.884, "atom1_id": "///A/306/O", "atom2_id": "///A/310/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 518, "atom1_serNum": 4014, "atom2_serNum": 4048, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/307/O", "atom2_id": "///A/311/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 519, "atom1_serNum": 4021, "atom2_serNum": 5849, "donAcc_type": "acceptable", "distance": 2.728, "atom1_id": "///A/307/NH2", "atom2_id": "///A/1396/O1", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 520, "atom1_serNum": 4021, "atom2_serNum": 5850, "donAcc_type": "acceptable", "distance": 2.885, "atom1_id": "///A/307/NH2", "atom2_id": "///A/1396/O2", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 521, "atom1_serNum": 4021, "atom2_serNum": 5851, "donAcc_type": "acceptable", "distance": 2.822, "atom1_id": "///A/307/NH2", "atom2_id": "///A/1396/O3", "atom_pair": "N:O", "residue_pair": "aa:ligand" }, { "index": 522, "atom1_serNum": 4025, "atom2_serNum": 4057, "donAcc_type": "standard", "distance": 2.843, "atom1_id": "///A/308/O", "atom2_id": "///A/312/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 523, "atom1_serNum": 4030, "atom2_serNum": 4064, "donAcc_type": "standard", "distance": 2.608, "atom1_id": "///A/308/OE2", "atom2_id": "///A/312/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 524, "atom1_serNum": 4034, "atom2_serNum": 4068, "donAcc_type": "standard", "distance": 2.892, "atom1_id": "///A/309/O", "atom2_id": "///A/313/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 525, "atom1_serNum": 4067, "atom2_serNum": 4226, "donAcc_type": "standard", "distance": 2.838, "atom1_id": "///A/312/NH2", "atom2_id": "///A/333/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 526, "atom1_serNum": 4092, "atom2_serNum": 4103, "donAcc_type": "acceptable", "distance": 3.094, "atom1_id": "///A/316/OG1", "atom2_id": "///A/318/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 527, "atom1_serNum": 4106, "atom2_serNum": 4127, "donAcc_type": "standard", "distance": 2.954, "atom1_id": "///A/318/O", "atom2_id": "///A/320/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 528, "atom1_serNum": 4123, "atom2_serNum": 4133, "donAcc_type": "acceptable", "distance": 2.933, "atom1_id": "///A/320/O", "atom2_id": "///A/321/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 529, "atom1_serNum": 4146, "atom2_serNum": 4165, "donAcc_type": "standard", "distance": 3.130, "atom1_id": "///A/323/O", "atom2_id": "///A/326/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 530, "atom1_serNum": 4155, "atom2_serNum": 4171, "donAcc_type": "standard", "distance": 2.708, "atom1_id": "///A/324/O", "atom2_id": "///A/327/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 531, "atom1_serNum": 4155, "atom2_serNum": 4179, "donAcc_type": "standard", "distance": 2.944, "atom1_id": "///A/324/O", "atom2_id": "///A/328/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 532, "atom1_serNum": 4163, "atom2_serNum": 4188, "donAcc_type": "standard", "distance": 2.845, "atom1_id": "///A/325/O", "atom2_id": "///A/329/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 533, "atom1_serNum": 4168, "atom2_serNum": 4194, "donAcc_type": "standard", "distance": 3.217, "atom1_id": "///A/326/O", "atom2_id": "///A/330/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 534, "atom1_serNum": 4174, "atom2_serNum": 4200, "donAcc_type": "standard", "distance": 3.423, "atom1_id": "///A/327/O", "atom2_id": "///A/331/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 535, "atom1_serNum": 4182, "atom2_serNum": 4208, "donAcc_type": "standard", "distance": 2.943, "atom1_id": "///A/328/O", "atom2_id": "///A/332/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 536, "atom1_serNum": 4191, "atom2_serNum": 4219, "donAcc_type": "standard", "distance": 2.761, "atom1_id": "///A/329/O", "atom2_id": "///A/333/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 537, "atom1_serNum": 4197, "atom2_serNum": 4228, "donAcc_type": "standard", "distance": 3.296, "atom1_id": "///A/330/O", "atom2_id": "///A/334/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 538, "atom1_serNum": 4203, "atom2_serNum": 4236, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/331/O", "atom2_id": "///A/335/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 539, "atom1_serNum": 4211, "atom2_serNum": 4244, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///A/332/O", "atom2_id": "///A/336/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 540, "atom1_serNum": 4215, "atom2_serNum": 5802, "donAcc_type": "standard", "distance": 2.716, "atom1_id": "///A/332/NE", "atom2_id": "///A/543/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 541, "atom1_serNum": 4218, "atom2_serNum": 5802, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/332/NH2", "atom2_id": "///A/543/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 542, "atom1_serNum": 4231, "atom2_serNum": 4252, "donAcc_type": "standard", "distance": 2.828, "atom1_id": "///A/334/O", "atom2_id": "///A/337/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 543, "atom1_serNum": 4231, "atom2_serNum": 4261, "donAcc_type": "standard", "distance": 3.270, "atom1_id": "///A/334/O", "atom2_id": "///A/338/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 544, "atom1_serNum": 4234, "atom2_serNum": 4268, "donAcc_type": "standard", "distance": 2.711, "atom1_id": "///A/334/OD1", "atom2_id": "///A/338/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 545, "atom1_serNum": 4239, "atom2_serNum": 4269, "donAcc_type": "standard", "distance": 2.840, "atom1_id": "///A/335/O", "atom2_id": "///A/339/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 546, "atom1_serNum": 4239, "atom2_serNum": 4291, "donAcc_type": "standard", "distance": 3.504, "atom1_id": "///A/335/O", "atom2_id": "///A/341/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 547, "atom1_serNum": 4255, "atom2_serNum": 4521, "donAcc_type": "standard", "distance": 3.043, "atom1_id": "///A/337/O", "atom2_id": "///A/371/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 548, "atom1_serNum": 4272, "atom2_serNum": 4288, "donAcc_type": "standard", "distance": 3.164, "atom1_id": "///A/339/O", "atom2_id": "///A/341/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 549, "atom1_serNum": 4272, "atom2_serNum": 4291, "donAcc_type": "standard", "distance": 2.706, "atom1_id": "///A/339/O", "atom2_id": "///A/341/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 550, "atom1_serNum": 4272, "atom2_serNum": 4494, "donAcc_type": "acceptable", "distance": 2.996, "atom1_id": "///A/339/O", "atom2_id": "///A/368/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 551, "atom1_serNum": 4277, "atom2_serNum": 5580, "donAcc_type": "standard", "distance": 2.753, "atom1_id": "///A/340/O", "atom2_id": "///A/517/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 552, "atom1_serNum": 4281, "atom2_serNum": 4483, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///A/341/N", "atom2_id": "///A/367/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 553, "atom1_serNum": 4292, "atom2_serNum": 5583, "donAcc_type": "standard", "distance": 2.984, "atom1_id": "///A/342/N", "atom2_id": "///A/517/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 554, "atom1_serNum": 4295, "atom2_serNum": 5600, "donAcc_type": "standard", "distance": 2.967, "atom1_id": "///A/342/O", "atom2_id": "///A/519/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 555, "atom1_serNum": 4297, "atom2_serNum": 5494, "donAcc_type": "standard", "distance": 2.734, "atom1_id": "///A/343/N", "atom2_id": "///A/504/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 556, "atom1_serNum": 4300, "atom2_serNum": 5487, "donAcc_type": "standard", "distance": 3.166, "atom1_id": "///A/343/O", "atom2_id": "///A/504/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 557, "atom1_serNum": 4308, "atom2_serNum": 5127, "donAcc_type": "acceptable", "distance": 2.737, "atom1_id": "///A/344/O", "atom2_id": "///A/457/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 558, "atom1_serNum": 4310, "atom2_serNum": 5474, "donAcc_type": "standard", "distance": 2.848, "atom1_id": "///A/345/N", "atom2_id": "///A/502/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 559, "atom1_serNum": 4313, "atom2_serNum": 5471, "donAcc_type": "standard", "distance": 3.019, "atom1_id": "///A/345/O", "atom2_id": "///A/502/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 560, "atom1_serNum": 4320, "atom2_serNum": 5461, "donAcc_type": "questionable", "distance": 2.925, "atom1_id": "///A/346/O", "atom2_id": "///A/500/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 561, "atom1_serNum": 4325, "atom2_serNum": 4656, "donAcc_type": "standard", "distance": 2.764, "atom1_id": "///A/347/N", "atom2_id": "///A/388/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 562, "atom1_serNum": 4328, "atom2_serNum": 4658, "donAcc_type": "standard", "distance": 3.025, "atom1_id": "///A/347/O", "atom2_id": "///A/389/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 563, "atom1_serNum": 4331, "atom2_serNum": 4665, "donAcc_type": "standard", "distance": 3.260, "atom1_id": "///A/347/OD1", "atom2_id": "///A/389/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 564, "atom1_serNum": 4340, "atom2_serNum": 4645, "donAcc_type": "standard", "distance": 2.813, "atom1_id": "///A/349/N", "atom2_id": "///A/387/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 565, "atom1_serNum": 4343, "atom2_serNum": 4356, "donAcc_type": "standard", "distance": 3.252, "atom1_id": "///A/349/O", "atom2_id": "///A/351/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 566, "atom1_serNum": 4343, "atom2_serNum": 4642, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///A/349/O", "atom2_id": "///A/387/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 567, "atom1_serNum": 4350, "atom2_serNum": 5020, "donAcc_type": "acceptable", "distance": 3.520, "atom1_id": "///A/350/O", "atom2_id": "///A/432/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 568, "atom1_serNum": 4350, "atom2_serNum": 5022, "donAcc_type": "standard", "distance": 3.329, "atom1_id": "///A/350/O", "atom2_id": "///A/433/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 569, "atom1_serNum": 4356, "atom2_serNum": 4623, "donAcc_type": "standard", "distance": 2.846, "atom1_id": "///A/351/N", "atom2_id": "///A/385/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 570, "atom1_serNum": 4364, "atom2_serNum": 5025, "donAcc_type": "standard", "distance": 3.057, "atom1_id": "///A/352/N", "atom2_id": "///A/433/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 571, "atom1_serNum": 4367, "atom2_serNum": 4379, "donAcc_type": "standard", "distance": 2.922, "atom1_id": "///A/352/O", "atom2_id": "///A/354/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 572, "atom1_serNum": 4367, "atom2_serNum": 5041, "donAcc_type": "standard", "distance": 3.722, "atom1_id": "///A/352/O", "atom2_id": "///A/435/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 573, "atom1_serNum": 4371, "atom2_serNum": 4610, "donAcc_type": "standard", "distance": 2.724, "atom1_id": "///A/353/N", "atom2_id": "///A/383/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 574, "atom1_serNum": 4374, "atom2_serNum": 4396, "donAcc_type": "standard", "distance": 2.898, "atom1_id": "///A/353/O", "atom2_id": "///A/356/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 575, "atom1_serNum": 4379, "atom2_serNum": 5044, "donAcc_type": "standard", "distance": 3.676, "atom1_id": "///A/354/N", "atom2_id": "///A/435/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 576, "atom1_serNum": 4387, "atom2_serNum": 4940, "donAcc_type": "standard", "distance": 2.715, "atom1_id": "///A/354/OE2", "atom2_id": "///A/421/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 577, "atom1_serNum": 4394, "atom2_serNum": 5057, "donAcc_type": "questionable", "distance": 3.245, "atom1_id": "///A/355/OD1", "atom2_id": "///A/437/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 578, "atom1_serNum": 4407, "atom2_serNum": 4433, "donAcc_type": "acceptable", "distance": 3.438, "atom1_id": "///A/356/OH", "atom2_id": "///A/360/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 579, "atom1_serNum": 4407, "atom2_serNum": 4441, "donAcc_type": "acceptable", "distance": 3.298, "atom1_id": "///A/356/OH", "atom2_id": "///A/361/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 580, "atom1_serNum": 4408, "atom2_serNum": 4415, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///A/357/N", "atom2_id": "///A/357/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 581, "atom1_serNum": 4415, "atom2_serNum": 5065, "donAcc_type": "acceptable", "distance": 2.890, "atom1_id": "///A/357/OE1", "atom2_id": "///A/437/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 582, "atom1_serNum": 4434, "atom2_serNum": 4593, "donAcc_type": "standard", "distance": 3.118, "atom1_id": "///A/361/N", "atom2_id": "///A/381/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 583, "atom1_serNum": 4437, "atom2_serNum": 4590, "donAcc_type": "standard", "distance": 2.819, "atom1_id": "///A/361/O", "atom2_id": "///A/381/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 584, "atom1_serNum": 4441, "atom2_serNum": 4891, "donAcc_type": "acceptable", "distance": 2.620, "atom1_id": "///A/361/OE1", "atom2_id": "///A/415/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 585, "atom1_serNum": 4442, "atom2_serNum": 4891, "donAcc_type": "acceptable", "distance": 3.060, "atom1_id": "///A/361/OE2", "atom2_id": "///A/415/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 586, "atom1_serNum": 4451, "atom2_serNum": 4579, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///A/363/N", "atom2_id": "///A/379/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 587, "atom1_serNum": 4454, "atom2_serNum": 4576, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///A/363/O", "atom2_id": "///A/379/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 588, "atom1_serNum": 4463, "atom2_serNum": 4574, "donAcc_type": "acceptable", "distance": 2.844, "atom1_id": "///A/364/OG1", "atom2_id": "///A/378/OE1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 589, "atom1_serNum": 4465, "atom2_serNum": 4559, "donAcc_type": "standard", "distance": 2.653, "atom1_id": "///A/365/N", "atom2_id": "///A/377/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 590, "atom1_serNum": 4468, "atom2_serNum": 4556, "donAcc_type": "standard", "distance": 2.664, "atom1_id": "///A/365/O", "atom2_id": "///A/377/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 591, "atom1_serNum": 4476, "atom2_serNum": 4565, "donAcc_type": "standard", "distance": 2.584, "atom1_id": "///A/366/O", "atom2_id": "///A/377/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 592, "atom1_serNum": 4480, "atom2_serNum": 4549, "donAcc_type": "standard", "distance": 3.095, "atom1_id": "///A/367/N", "atom2_id": "///A/375/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 593, "atom1_serNum": 4486, "atom2_serNum": 4565, "donAcc_type": "standard", "distance": 3.519, "atom1_id": "///A/367/OD1", "atom2_id": "///A/377/NH1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 594, "atom1_serNum": 4487, "atom2_serNum": 4541, "donAcc_type": "standard", "distance": 2.871, "atom1_id": "///A/367/ND2", "atom2_id": "///A/374/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 595, "atom1_serNum": 4491, "atom2_serNum": 4513, "donAcc_type": "standard", "distance": 2.582, "atom1_id": "///A/368/O", "atom2_id": "///A/371/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 596, "atom1_serNum": 4505, "atom2_serNum": 4511, "donAcc_type": "standard", "distance": 2.697, "atom1_id": "///A/370/N", "atom2_id": "///A/370/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 597, "atom1_serNum": 4516, "atom2_serNum": 4538, "donAcc_type": "standard", "distance": 3.148, "atom1_id": "///A/371/O", "atom2_id": "///A/374/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 598, "atom1_serNum": 4525, "atom2_serNum": 4546, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/372/O", "atom2_id": "///A/375/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 599, "atom1_serNum": 4529, "atom2_serNum": 4536, "donAcc_type": "standard", "distance": 2.787, "atom1_id": "///A/373/N", "atom2_id": "///A/373/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 600, "atom1_serNum": 4563, "atom2_serNum": 5495, "donAcc_type": "standard", "distance": 2.876, "atom1_id": "///A/377/NE", "atom2_id": "///A/504/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 601, "atom1_serNum": 4566, "atom2_serNum": 5494, "donAcc_type": "standard", "distance": 2.619, "atom1_id": "///A/377/NH2", "atom2_id": "///A/504/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 602, "atom1_serNum": 4606, "atom2_serNum": 5157, "donAcc_type": "acceptable", "distance": 2.696, "atom1_id": "///A/382/OG", "atom2_id": "///A/460/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 603, "atom1_serNum": 4614, "atom2_serNum": 5158, "donAcc_type": "standard", "distance": 2.882, "atom1_id": "///A/384/O", "atom2_id": "///A/461/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 604, "atom1_serNum": 4628, "atom2_serNum": 5148, "donAcc_type": "standard", "distance": 2.696, "atom1_id": "///A/386/N", "atom2_id": "///A/459/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 605, "atom1_serNum": 4631, "atom2_serNum": 5145, "donAcc_type": "standard", "distance": 3.487, "atom1_id": "///A/386/O", "atom2_id": "///A/459/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 606, "atom1_serNum": 4650, "atom2_serNum": 4681, "donAcc_type": "standard", "distance": 3.096, "atom1_id": "///A/388/N", "atom2_id": "///A/391/OD2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 607, "atom1_serNum": 4653, "atom2_serNum": 4674, "donAcc_type": "standard", "distance": 2.809, "atom1_id": "///A/388/O", "atom2_id": "///A/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 608, "atom1_serNum": 4661, "atom2_serNum": 4674, "donAcc_type": "standard", "distance": 2.534, "atom1_id": "///A/389/O", "atom2_id": "///A/391/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 609, "atom1_serNum": 4661, "atom2_serNum": 4682, "donAcc_type": "standard", "distance": 2.730, "atom1_id": "///A/389/O", "atom2_id": "///A/392/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 610, "atom1_serNum": 4672, "atom2_serNum": 4764, "donAcc_type": "acceptable", "distance": 2.858, "atom1_id": "///A/390/O", "atom2_id": "///A/400/OH", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 611, "atom1_serNum": 4677, "atom2_serNum": 4785, "donAcc_type": "standard", "distance": 2.805, "atom1_id": "///A/391/O", "atom2_id": "///A/403/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 612, "atom1_serNum": 4680, "atom2_serNum": 5619, "donAcc_type": "standard", "distance": 2.713, "atom1_id": "///A/391/OD1", "atom2_id": "///A/520/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 613, "atom1_serNum": 4693, "atom2_serNum": 4788, "donAcc_type": "standard", "distance": 2.563, "atom1_id": "///A/393/N", "atom2_id": "///A/403/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 614, "atom1_serNum": 4696, "atom2_serNum": 4800, "donAcc_type": "standard", "distance": 2.991, "atom1_id": "///A/393/O", "atom2_id": "///A/405/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 615, "atom1_serNum": 4711, "atom2_serNum": 4965, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/394/OE1", "atom2_id": "///A/424/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 616, "atom1_serNum": 4712, "atom2_serNum": 4965, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/394/OE2", "atom2_id": "///A/424/NZ", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 617, "atom1_serNum": 4747, "atom2_serNum": 4765, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///A/399/O", "atom2_id": "///A/401/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 618, "atom1_serNum": 4764, "atom2_serNum": 4788, "donAcc_type": "acceptable", "distance": 3.963, "atom1_id": "///A/400/OH", "atom2_id": "///A/403/O", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 619, "atom1_serNum": 4773, "atom2_serNum": 5109, "donAcc_type": "standard", "distance": 3.368, "atom1_id": "///A/401/NZ", "atom2_id": "///A/455/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 620, "atom1_serNum": 4796, "atom2_serNum": 4808, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///A/404/O", "atom2_id": "///A/406/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 621, "atom1_serNum": 4796, "atom2_serNum": 4812, "donAcc_type": "standard", "distance": 3.183, "atom1_id": "///A/404/O", "atom2_id": "///A/407/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 622, "atom1_serNum": 4815, "atom2_serNum": 4916, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/407/O", "atom2_id": "///A/419/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 623, "atom1_serNum": 4830, "atom2_serNum": 4902, "donAcc_type": "standard", "distance": 3.009, "atom1_id": "///A/409/N", "atom2_id": "///A/417/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 624, "atom1_serNum": 4833, "atom2_serNum": 4848, "donAcc_type": "standard", "distance": 3.362, "atom1_id": "///A/409/O", "atom2_id": "///A/411/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 625, "atom1_serNum": 4833, "atom2_serNum": 4899, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/409/O", "atom2_id": "///A/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 626, "atom1_serNum": 4837, "atom2_serNum": 5105, "donAcc_type": "standard", "distance": 2.699, "atom1_id": "///A/410/N", "atom2_id": "///A/454/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 627, "atom1_serNum": 4840, "atom2_serNum": 5113, "donAcc_type": "standard", "distance": 3.002, "atom1_id": "///A/410/O", "atom2_id": "///A/456/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 628, "atom1_serNum": 4844, "atom2_serNum": 4878, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///A/410/NE", "atom2_id": "///A/414/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 629, "atom1_serNum": 4848, "atom2_serNum": 4883, "donAcc_type": "standard", "distance": 3.044, "atom1_id": "///A/411/N", "atom2_id": "///A/415/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 630, "atom1_serNum": 4856, "atom2_serNum": 5116, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/412/N", "atom2_id": "///A/456/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 631, "atom1_serNum": 4859, "atom2_serNum": 4875, "donAcc_type": "standard", "distance": 2.620, "atom1_id": "///A/412/O", "atom2_id": "///A/414/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 632, "atom1_serNum": 4859, "atom2_serNum": 5139, "donAcc_type": "standard", "distance": 2.650, "atom1_id": "///A/412/O", "atom2_id": "///A/458/NE1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 633, "atom1_serNum": 4883, "atom2_serNum": 4899, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/415/O", "atom2_id": "///A/417/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 634, "atom1_serNum": 4892, "atom2_serNum": 5092, "donAcc_type": "acceptable", "distance": 3.041, "atom1_id": "///A/416/N", "atom2_id": "///A/441/OG1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 635, "atom1_serNum": 4895, "atom2_serNum": 5066, "donAcc_type": "standard", "distance": 3.349, "atom1_id": "///A/416/O", "atom2_id": "///A/438/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 636, "atom1_serNum": 4910, "atom2_serNum": 5047, "donAcc_type": "standard", "distance": 2.865, "atom1_id": "///A/418/O", "atom2_id": "///A/436/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 637, "atom1_serNum": 4915, "atom2_serNum": 4929, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///A/418/NZ", "atom2_id": "///A/420/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 638, "atom1_serNum": 4921, "atom2_serNum": 5033, "donAcc_type": "standard", "distance": 2.907, "atom1_id": "///A/420/N", "atom2_id": "///A/434/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 639, "atom1_serNum": 4928, "atom2_serNum": 5052, "donAcc_type": "acceptable", "distance": 2.842, "atom1_id": "///A/420/OE1", "atom2_id": "///A/436/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 640, "atom1_serNum": 4930, "atom2_serNum": 5033, "donAcc_type": "standard", "distance": 3.215, "atom1_id": "///A/421/N", "atom2_id": "///A/434/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 641, "atom1_serNum": 4939, "atom2_serNum": 4955, "donAcc_type": "standard", "distance": 3.455, "atom1_id": "///A/421/NH1", "atom2_id": "///A/423/OE1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 642, "atom1_serNum": 4948, "atom2_serNum": 5018, "donAcc_type": "standard", "distance": 3.445, "atom1_id": "///A/423/N", "atom2_id": "///A/432/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 643, "atom1_serNum": 4951, "atom2_serNum": 5008, "donAcc_type": "standard", "distance": 3.173, "atom1_id": "///A/423/O", "atom2_id": "///A/431/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 644, "atom1_serNum": 4966, "atom2_serNum": 4972, "donAcc_type": "standard", "distance": 3.038, "atom1_id": "///A/425/N", "atom2_id": "///A/425/OD1", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 645, "atom1_serNum": 4966, "atom2_serNum": 4995, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///A/425/N", "atom2_id": "///A/429/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 646, "atom1_serNum": 4969, "atom2_serNum": 4988, "donAcc_type": "standard", "distance": 2.675, "atom1_id": "///A/425/O", "atom2_id": "///A/428/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 647, "atom1_serNum": 4972, "atom2_serNum": 4992, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/425/OD1", "atom2_id": "///A/429/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 648, "atom1_serNum": 5050, "atom2_serNum": 5052, "donAcc_type": "acceptable", "distance": 2.933, "atom1_id": "///A/436/O", "atom2_id": "///A/436/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 649, "atom1_serNum": 5069, "atom2_serNum": 5092, "donAcc_type": "acceptable", "distance": 3.199, "atom1_id": "///A/438/O", "atom2_id": "///A/441/OG1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 650, "atom1_serNum": 5072, "atom2_serNum": 5079, "donAcc_type": "standard", "distance": 2.765, "atom1_id": "///A/438/OD1", "atom2_id": "///A/440/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 651, "atom1_serNum": 5130, "atom2_serNum": 5628, "donAcc_type": "standard", "distance": 3.332, "atom1_id": "///A/457/NE2", "atom2_id": "///A/521/OE2", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 652, "atom1_serNum": 5157, "atom2_serNum": 5174, "donAcc_type": "acceptable", "distance": 3.061, "atom1_id": "///A/460/OG", "atom2_id": "///A/463/ND1", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 653, "atom1_serNum": 5183, "atom2_serNum": 5485, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/465/N", "atom2_id": "///A/503/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 654, "atom1_serNum": 5186, "atom2_serNum": 5198, "donAcc_type": "standard", "distance": 2.941, "atom1_id": "///A/465/O", "atom2_id": "///A/467/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 655, "atom1_serNum": 5186, "atom2_serNum": 5482, "donAcc_type": "standard", "distance": 3.199, "atom1_id": "///A/465/O", "atom2_id": "///A/503/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 656, "atom1_serNum": 5201, "atom2_serNum": 5467, "donAcc_type": "standard", "distance": 3.029, "atom1_id": "///A/467/O", "atom2_id": "///A/501/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 657, "atom1_serNum": 5205, "atom2_serNum": 5744, "donAcc_type": "standard", "distance": 3.120, "atom1_id": "///A/468/N", "atom2_id": "///A/536/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 658, "atom1_serNum": 5208, "atom2_serNum": 5755, "donAcc_type": "standard", "distance": 2.779, "atom1_id": "///A/468/O", "atom2_id": "///A/538/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 659, "atom1_serNum": 5212, "atom2_serNum": 5466, "donAcc_type": "standard", "distance": 3.275, "atom1_id": "///A/468/OE1", "atom2_id": "///A/500/NE2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 660, "atom1_serNum": 5213, "atom2_serNum": 5229, "donAcc_type": "standard", "distance": 3.011, "atom1_id": "///A/468/OE2", "atom2_id": "///A/470/NE", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 661, "atom1_serNum": 5214, "atom2_serNum": 5452, "donAcc_type": "standard", "distance": 2.721, "atom1_id": "///A/469/N", "atom2_id": "///A/499/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 662, "atom1_serNum": 5217, "atom2_serNum": 5449, "donAcc_type": "standard", "distance": 2.772, "atom1_id": "///A/469/O", "atom2_id": "///A/499/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 663, "atom1_serNum": 5222, "atom2_serNum": 5758, "donAcc_type": "standard", "distance": 2.651, "atom1_id": "///A/470/N", "atom2_id": "///A/538/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 664, "atom1_serNum": 5225, "atom2_serNum": 5774, "donAcc_type": "standard", "distance": 2.961, "atom1_id": "///A/470/O", "atom2_id": "///A/540/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 665, "atom1_serNum": 5231, "atom2_serNum": 5252, "donAcc_type": "acceptable", "distance": 3.713, "atom1_id": "///A/470/NH1", "atom2_id": "///A/472/OH", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 666, "atom1_serNum": 5233, "atom2_serNum": 5437, "donAcc_type": "standard", "distance": 2.978, "atom1_id": "///A/471/N", "atom2_id": "///A/497/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 667, "atom1_serNum": 5236, "atom2_serNum": 5434, "donAcc_type": "standard", "distance": 2.904, "atom1_id": "///A/471/O", "atom2_id": "///A/497/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 668, "atom1_serNum": 5244, "atom2_serNum": 5784, "donAcc_type": "standard", "distance": 2.985, "atom1_id": "///A/472/O", "atom2_id": "///A/540/NH2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 669, "atom1_serNum": 5252, "atom2_serNum": 5772, "donAcc_type": "acceptable", "distance": 3.020, "atom1_id": "///A/472/OH", "atom2_id": "///A/539/OD1", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 670, "atom1_serNum": 5253, "atom2_serNum": 5423, "donAcc_type": "standard", "distance": 2.569, "atom1_id": "///A/473/N", "atom2_id": "///A/495/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 671, "atom1_serNum": 5260, "atom2_serNum": 5403, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/473/OD2", "atom2_id": "///A/492/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 672, "atom1_serNum": 5264, "atom2_serNum": 5403, "donAcc_type": "standard", "distance": 2.889, "atom1_id": "///A/474/O", "atom2_id": "///A/492/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 673, "atom1_serNum": 5275, "atom2_serNum": 5396, "donAcc_type": "standard", "distance": 2.634, "atom1_id": "///A/475/O", "atom2_id": "///A/492/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 674, "atom1_serNum": 5291, "atom2_serNum": 5384, "donAcc_type": "standard", "distance": 3.024, "atom1_id": "///A/477/N", "atom2_id": "///A/490/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 675, "atom1_serNum": 5294, "atom2_serNum": 5296, "donAcc_type": "acceptable", "distance": 3.123, "atom1_id": "///A/477/O", "atom2_id": "///A/477/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 676, "atom1_serNum": 5314, "atom2_serNum": 5330, "donAcc_type": "standard", "distance": 3.114, "atom1_id": "///A/480/O", "atom2_id": "///A/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 677, "atom1_serNum": 5317, "atom2_serNum": 5330, "donAcc_type": "standard", "distance": 3.204, "atom1_id": "///A/480/OD1", "atom2_id": "///A/483/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 678, "atom1_serNum": 5322, "atom2_serNum": 5335, "donAcc_type": "standard", "distance": 2.775, "atom1_id": "///A/481/O", "atom2_id": "///A/484/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 679, "atom1_serNum": 5351, "atom2_serNum": 5375, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/486/O", "atom2_id": "///A/489/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 680, "atom1_serNum": 5351, "atom2_serNum": 5380, "donAcc_type": "acceptable", "distance": 2.747, "atom1_id": "///A/486/O", "atom2_id": "///A/489/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 681, "atom1_serNum": 5359, "atom2_serNum": 5381, "donAcc_type": "standard", "distance": 3.141, "atom1_id": "///A/487/O", "atom2_id": "///A/490/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 682, "atom1_serNum": 5370, "atom2_serNum": 5388, "donAcc_type": "standard", "distance": 3.154, "atom1_id": "///A/488/O", "atom2_id": "///A/491/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 683, "atom1_serNum": 5399, "atom2_serNum": 5420, "donAcc_type": "standard", "distance": 2.900, "atom1_id": "///A/492/O", "atom2_id": "///A/495/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 684, "atom1_serNum": 5399, "atom2_serNum": 5425, "donAcc_type": "acceptable", "distance": 3.175, "atom1_id": "///A/492/O", "atom2_id": "///A/495/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 685, "atom1_serNum": 5402, "atom2_serNum": 5411, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/492/OD1", "atom2_id": "///A/494/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 686, "atom1_serNum": 5490, "atom2_serNum": 5509, "donAcc_type": "standard", "distance": 3.005, "atom1_id": "///A/504/O", "atom2_id": "///A/507/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 687, "atom1_serNum": 5499, "atom2_serNum": 5517, "donAcc_type": "standard", "distance": 2.987, "atom1_id": "///A/505/O", "atom2_id": "///A/508/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 688, "atom1_serNum": 5506, "atom2_serNum": 5526, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/506/O", "atom2_id": "///A/509/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 689, "atom1_serNum": 5542, "atom2_serNum": 5555, "donAcc_type": "standard", "distance": 2.793, "atom1_id": "///A/511/O", "atom2_id": "///A/514/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 690, "atom1_serNum": 5558, "atom2_serNum": 5662, "donAcc_type": "standard", "distance": 3.994, "atom1_id": "///A/514/O", "atom2_id": "///A/526/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 691, "atom1_serNum": 5569, "atom2_serNum": 5648, "donAcc_type": "standard", "distance": 2.995, "atom1_id": "///A/516/N", "atom2_id": "///A/524/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 692, "atom1_serNum": 5572, "atom2_serNum": 5645, "donAcc_type": "standard", "distance": 2.758, "atom1_id": "///A/516/O", "atom2_id": "///A/524/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 693, "atom1_serNum": 5592, "atom2_serNum": 5620, "donAcc_type": "standard", "distance": 3.243, "atom1_id": "///A/518/O", "atom2_id": "///A/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 694, "atom1_serNum": 5592, "atom2_serNum": 5629, "donAcc_type": "standard", "distance": 3.390, "atom1_id": "///A/518/O", "atom2_id": "///A/522/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 695, "atom1_serNum": 5603, "atom2_serNum": 5620, "donAcc_type": "standard", "distance": 2.774, "atom1_id": "///A/519/O", "atom2_id": "///A/521/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 696, "atom1_serNum": 5623, "atom2_serNum": 5803, "donAcc_type": "standard", "distance": 3.518, "atom1_id": "///A/521/O", "atom2_id": "///A/544/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 697, "atom1_serNum": 5633, "atom2_serNum": 5795, "donAcc_type": "standard", "distance": 2.893, "atom1_id": "///A/523/N", "atom2_id": "///A/542/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 698, "atom1_serNum": 5636, "atom2_serNum": 5785, "donAcc_type": "standard", "distance": 2.669, "atom1_id": "///A/523/O", "atom2_id": "///A/541/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 699, "atom1_serNum": 5636, "atom2_serNum": 5792, "donAcc_type": "standard", "distance": 3.614, "atom1_id": "///A/523/O", "atom2_id": "///A/542/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 700, "atom1_serNum": 5656, "atom2_serNum": 5769, "donAcc_type": "standard", "distance": 2.861, "atom1_id": "///A/525/N", "atom2_id": "///A/539/O", "atom_pair": "N:O", "residue_pair": "aa:aa" }, { "index": 701, "atom1_serNum": 5659, "atom2_serNum": 5766, "donAcc_type": "standard", "distance": 2.670, "atom1_id": "///A/525/O", "atom2_id": "///A/539/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 702, "atom1_serNum": 5665, "atom2_serNum": 5678, "donAcc_type": "standard", "distance": 3.279, "atom1_id": "///A/526/O", "atom2_id": "///A/528/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 703, "atom1_serNum": 5665, "atom2_serNum": 5773, "donAcc_type": "standard", "distance": 3.693, "atom1_id": "///A/526/O", "atom2_id": "///A/539/ND2", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 704, "atom1_serNum": 5673, "atom2_serNum": 5683, "donAcc_type": "acceptable", "distance": 2.714, "atom1_id": "///A/527/O", "atom2_id": "///A/528/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 705, "atom1_serNum": 5673, "atom2_serNum": 5695, "donAcc_type": "standard", "distance": 2.994, "atom1_id": "///A/527/O", "atom2_id": "///A/530/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 706, "atom1_serNum": 5673, "atom2_serNum": 5705, "donAcc_type": "standard", "distance": 3.305, "atom1_id": "///A/527/O", "atom2_id": "///A/531/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 707, "atom1_serNum": 5673, "atom2_serNum": 5710, "donAcc_type": "acceptable", "distance": 3.038, "atom1_id": "///A/527/O", "atom2_id": "///A/531/OG", "atom_pair": "O:O", "residue_pair": "aa:aa" }, { "index": 708, "atom1_serNum": 5676, "atom2_serNum": 5684, "donAcc_type": "standard", "distance": 2.877, "atom1_id": "///A/527/OD1", "atom2_id": "///A/529/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 709, "atom1_serNum": 5698, "atom2_serNum": 5711, "donAcc_type": "standard", "distance": 2.604, "atom1_id": "///A/530/O", "atom2_id": "///A/532/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 710, "atom1_serNum": 5716, "atom2_serNum": 5732, "donAcc_type": "acceptable", "distance": 3.116, "atom1_id": "///A/532/OG1", "atom2_id": "///A/535/N", "atom_pair": "O:N", "residue_pair": "aa:aa" }, { "index": 711, "atom1_serNum": 5735, "atom2_serNum": 5748, "donAcc_type": "standard", "distance": 2.725, "atom1_id": "///A/535/O", "atom2_id": "///A/537/N", "atom_pair": "O:N", "residue_pair": "aa:aa" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1exd", "num_aaChains": 1, "aaChains": "A=530", "num_naChains": 1, "naChains": "B=73", "num_atoms": 6031, "num_waters": 159, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 17, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-junctions.pdb", "desc": "an ensemble of junctions (multi-branch)" }, { "index": 7, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 8, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 9, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 10, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 11, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 12, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 13, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" }, { "index": 14, "name": "dssr-rotmat.txt", "desc": "position vector and rotation matrix" }, { "index": 15, "name": "dssr-viewV.pdb", "desc": "vertical view of the principal moment of inertia" }, { "index": 16, "name": "dssr-viewH.pdb", "desc": "horizontal view of the principal moment of inertia" }, { "index": 17, "name": "dssr-viewT.pdb", "desc": "top view of the principal moment of inertia" } ], "time_used": "999" } }