{ "num_pairs": 21, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/43", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -154.137, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 56.215, "chi2": -152.317, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.217, "C1C1_dist": 10.489, "N1N9_dist": 8.879, "C6C8_dist": 9.829, "CNNC_torsion": -6.759, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.83],N1(imino)-N3[2.87],N2(amino)-O2(carbonyl)[2.74]", "interBase_angle": 15.713, "planarity": 0.192, "simple_Shear": -0.440, "simple_Stretch": -0.129, "simple_Buckle": 15.049, "simple_Propeller": 4.518, "bp_simpleParams": [ -0.440, -0.129, 0.119, 15.049, 4.518, 1.174 ], "bp_params": [ -0.434, -0.145, 0.119, 14.880, 5.047, 1.165 ], "frame": { "rmsd": null, "origin": [ 8.783, -17.787, 17.064 ], "x_axis": [ 0.354, -0.330, -0.875 ], "y_axis": [ -0.708, 0.516, -0.481 ], "z_axis": [ 0.611, 0.790, -0.051 ], "quaternion": [ 0.675, -0.471, 0.551, 0.140 ] } }, { "index": 2, "nt1": "///A/2", "nt2": "///A/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -144.683, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 50.016, "chi2": -172.312, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 61.130, "C1C1_dist": 10.365, "N1N9_dist": 8.711, "C6C8_dist": 9.569, "CNNC_torsion": -23.966, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.80],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.72]", "interBase_angle": 28.343, "planarity": 0.341, "simple_Shear": -0.620, "simple_Stretch": -0.142, "simple_Buckle": 27.476, "simple_Propeller": -6.957, "bp_simpleParams": [ -0.620, -0.142, 0.346, 27.476, -6.957, -0.349 ], "bp_params": [ -0.609, -0.182, 0.346, 27.897, -5.010, -0.339 ], "frame": { "rmsd": null, "origin": [ 11.449, -16.154, 17.347 ], "x_axis": [ -0.172, 0.030, -0.985 ], "y_axis": [ -0.817, 0.554, 0.160 ], "z_axis": [ 0.550, 0.832, -0.071 ], "quaternion": [ 0.572, -0.294, 0.670, 0.370 ] } }, { "index": 3, "nt1": "///A/3", "nt2": "///A/41", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -160.084, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.796, "chi2": -157.526, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.570, "C1C1_dist": 10.657, "N1N9_dist": 8.964, "C6C8_dist": 9.883, "CNNC_torsion": -21.563, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.78]", "interBase_angle": 3.322, "planarity": 0.099, "simple_Shear": 0.076, "simple_Stretch": -0.165, "simple_Buckle": 1.566, "simple_Propeller": -2.930, "bp_simpleParams": [ 0.076, -0.165, -0.292, 1.566, -2.930, -0.367 ], "bp_params": [ 0.076, -0.166, -0.292, 1.555, -2.936, -0.367 ], "frame": { "rmsd": null, "origin": [ 14.975, -13.929, 16.521 ], "x_axis": [ -0.705, 0.145, -0.694 ], "y_axis": [ -0.556, 0.493, 0.669 ], "z_axis": [ 0.439, 0.858, -0.267 ], "quaternion": [ 0.361, -0.131, 0.785, 0.486 ] } }, { "index": 4, "nt1": "///A/4", "nt2": "///A/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -156.639, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 58.355, "chi2": -158.180, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.401, "C1C1_dist": 10.666, "N1N9_dist": 8.890, "C6C8_dist": 9.753, "CNNC_torsion": -26.602, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.77],N1(imino)-N3[2.83],N2(amino)-O2(carbonyl)[2.78]", "interBase_angle": 27.810, "planarity": 0.296, "simple_Shear": 0.226, "simple_Stretch": -0.099, "simple_Buckle": -21.385, "simple_Propeller": -17.779, "bp_simpleParams": [ 0.226, -0.099, -0.348, -21.385, -17.779, -1.120 ], "bp_params": [ 0.222, -0.108, -0.348, -22.089, -16.897, -1.111 ], "frame": { "rmsd": null, "origin": [ 16.644, -11.110, 14.137 ], "x_axis": [ -0.949, 0.280, -0.141 ], "y_axis": [ -0.016, 0.406, 0.914 ], "z_axis": [ 0.314, 0.870, -0.381 ], "quaternion": [ 0.137, 0.080, 0.827, 0.539 ] } }, { "index": 5, "nt1": "///A/5", "nt2": "///A/39", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -159.251, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 74.673, "chi2": -150.425, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 46.196, "C1C1_dist": 10.212, "N1N9_dist": 8.828, "C6C8_dist": 9.802, "CNNC_torsion": -29.034, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.82],N3(imino)-O6(carbonyl)[3.00]", "interBase_angle": 32.726, "planarity": 0.386, "simple_Shear": 2.293, "simple_Stretch": 0.402, "simple_Buckle": -32.493, "simple_Propeller": -3.901, "bp_simpleParams": [ 2.293, 0.402, 0.586, -32.493, -3.901, 4.551 ], "bp_params": [ 2.324, -0.135, 0.586, -32.509, 3.761, 4.372 ], "frame": { "rmsd": null, "origin": [ 16.177, -8.282, 11.837 ], "x_axis": [ -0.765, 0.333, 0.551 ], "y_axis": [ 0.627, 0.190, 0.756 ], "z_axis": [ 0.147, 0.924, -0.354 ], "quaternion": [ -0.133, 0.316, 0.760, 0.553 ] } }, { "index": 6, "nt1": "///A/6", "nt2": "///A/38", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW-M", "intra_chain": true, "chi1": -120.965, "conf1": "anti", "pucker1": "----", "lambda1": 55.069, "chi2": -154.030, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 23.163, "C1C1_dist": 11.337, "N1N9_dist": 9.150, "C6C8_dist": 9.276, "CNNC_torsion": -1.211, "hbonds_num": 1, "hbonds_desc": "N3(imino)-O6(carbonyl)[2.78]", "interBase_angle": 13.728, "planarity": 0.246, "simple_Shear": 3.277, "simple_Stretch": 0.282, "simple_Buckle": -9.000, "simple_Propeller": -10.367, "bp_simpleParams": [ 3.277, 0.282, -0.662, -9.000, -10.367, -33.544 ], "bp_params": [ 3.174, -0.860, -0.662, -12.010, -6.650, -33.424 ], "frame": { "rmsd": null, "origin": [ 17.231, -6.800, 8.734 ], "x_axis": [ -0.198, 0.558, 0.806 ], "y_axis": [ 0.977, 0.040, 0.212 ], "z_axis": [ 0.086, 0.829, -0.552 ], "quaternion": [ -0.269, 0.573, 0.669, 0.389 ] } }, { "index": 7, "nt1": "///A/8", "nt2": "///A/36", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": true, "chi1": -129.148, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 49.499, "chi2": -160.034, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 89.646, "C1C1_dist": 8.989, "N1N9_dist": 8.103, "C6C8_dist": 9.120, "CNNC_torsion": -54.367, "hbonds_num": 1, "hbonds_desc": "N6(amino)-N1[2.88]", "interBase_angle": 68.531, "planarity": 0.840, "simple_Shear": -3.300, "simple_Stretch": 0.436, "simple_Buckle": -49.357, "simple_Propeller": -47.544, "bp_simpleParams": [ -3.300, 0.436, -1.785, -49.357, -47.544, 50.767 ], "bp_params": [ -3.260, -0.672, -1.785, -31.176, -61.030, 56.214 ], "frame": { "rmsd": null, "origin": [ 16.971, 2.290, 7.410 ], "x_axis": [ 0.277, 0.887, 0.368 ], "y_axis": [ 0.690, 0.083, -0.719 ], "z_axis": [ -0.669, 0.454, -0.589 ], "quaternion": [ -0.439, 0.668, 0.591, -0.112 ] } }, { "index": 8, "nt1": "///A/9", "nt2": "///A/36", "bp": "C-A", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "intra_chain": true, "chi1": -151.286, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 27.347, "chi2": -160.034, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 120.382, "C1C1_dist": 8.391, "N1N9_dist": 7.852, "C6C8_dist": 8.663, "CNNC_torsion": -34.388, "hbonds_num": 2, "hbonds_desc": "N4(amino)-O2'(hydroxyl)[2.96],N4(amino)-N3[3.09]", "interBase_angle": 55.411, "planarity": 0.680, "simple_Shear": -6.681, "simple_Stretch": 2.488, "simple_Buckle": -51.339, "simple_Propeller": 20.849, "bp_simpleParams": [ -6.681, 2.488, -1.377, -51.339, 20.849, 21.322 ], "bp_params": [ -6.432, -3.075, -1.377, -50.187, -23.488, 19.838 ], "frame": { "rmsd": null, "origin": [ 14.835, 1.592, 5.978 ], "x_axis": [ 0.336, 0.602, 0.724 ], "y_axis": [ 0.885, 0.059, -0.461 ], "z_axis": [ -0.321, 0.796, -0.513 ], "quaternion": [ -0.470, 0.669, 0.556, 0.151 ] } }, { "index": 9, "nt1": "///A/11", "nt2": "///A/36", "bp": "A-A", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -89.331, "conf1": "--", "pucker1": "~C2'-endo", "lambda1": 10.631, "chi2": -160.034, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 77.346, "C1C1_dist": 9.794, "N1N9_dist": 8.144, "C6C8_dist": 8.647, "CNNC_torsion": 118.981, "hbonds_num": 1, "hbonds_desc": "N6(amino)-N3[2.79]", "interBase_angle": 59.538, "planarity": 0.649, "simple_Shear": -6.488, "simple_Stretch": 1.252, "simple_Buckle": 31.321, "simple_Propeller": 50.633, "bp_simpleParams": [ -6.488, 1.252, -1.271, 31.321, 50.633, -12.646 ], "bp_params": [ -5.563, -3.565, -1.271, -13.399, 58.010, -14.369 ], "frame": { "rmsd": null, "origin": [ 14.530, 3.246, 5.224 ], "x_axis": [ 0.449, -0.144, 0.882 ], "y_axis": [ 0.833, 0.424, -0.354 ], "z_axis": [ -0.323, 0.894, 0.310 ], "quaternion": [ 0.739, -0.423, -0.408, -0.331 ] } }, { "index": 10, "nt1": "///A/12", "nt2": "///A/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -145.541, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.126, "chi2": -142.508, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.776, "C1C1_dist": 10.671, "N1N9_dist": 8.948, "C6C8_dist": 9.835, "CNNC_torsion": -7.400, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.80],N1(imino)-N3[2.85],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 3.437, "planarity": 0.092, "simple_Shear": -0.332, "simple_Stretch": -0.207, "simple_Buckle": 0.205, "simple_Propeller": 3.431, "bp_simpleParams": [ -0.332, -0.207, -0.422, 0.205, 3.431, -1.303 ], "bp_params": [ -0.326, -0.216, -0.422, 0.106, 3.436, -1.302 ], "frame": { "rmsd": null, "origin": [ 13.259, 6.235, 6.246 ], "x_axis": [ 0.930, 0.095, 0.354 ], "y_axis": [ 0.311, 0.307, -0.899 ], "z_axis": [ -0.194, 0.947, 0.256 ], "quaternion": [ 0.790, -0.585, -0.174, -0.068 ] } }, { "index": 11, "nt1": "///A/13", "nt2": "///A/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -150.389, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 53.701, "chi2": -161.820, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 55.671, "C1C1_dist": 10.670, "N1N9_dist": 8.957, "C6C8_dist": 9.816, "CNNC_torsion": -8.342, "hbonds_num": 3, "hbonds_desc": "O6(carbonyl)-N4(amino)[2.78],N1(imino)-N3[2.86],N2(amino)-O2(carbonyl)[2.76]", "interBase_angle": 7.514, "planarity": 0.148, "simple_Shear": -0.280, "simple_Stretch": -0.177, "simple_Buckle": 7.303, "simple_Propeller": -1.768, "bp_simpleParams": [ -0.280, -0.177, -0.163, 7.303, -1.768, -1.369 ], "bp_params": [ -0.275, -0.184, -0.163, 7.345, -1.585, -1.366 ], "frame": { "rmsd": null, "origin": [ 12.917, 9.088, 7.685 ], "x_axis": [ 0.956, 0.139, -0.260 ], "y_axis": [ -0.284, 0.194, -0.939 ], "z_axis": [ -0.081, 0.971, 0.225 ], "quaternion": [ 0.771, -0.620, 0.058, 0.137 ] } }, { "index": 12, "nt1": "///A/14", "nt2": "///A/33", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -162.387, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 70.594, "chi2": -162.915, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 44.850, "C1C1_dist": 10.282, "N1N9_dist": 8.754, "C6C8_dist": 9.780, "CNNC_torsion": -11.581, "hbonds_num": 2, "hbonds_desc": "O2(carbonyl)-N1(imino)[2.70],N3(imino)-O6(carbonyl)[2.82]", "interBase_angle": 7.034, "planarity": 0.261, "simple_Shear": 2.422, "simple_Stretch": 0.009, "simple_Buckle": -2.005, "simple_Propeller": -6.742, "bp_simpleParams": [ 2.422, 0.009, -0.752, -2.005, -6.742, 5.873 ], "bp_params": [ 2.355, -0.563, -0.752, -3.538, -6.079, 5.879 ], "frame": { "rmsd": null, "origin": [ 14.658, 12.202, 9.120 ], "x_axis": [ 0.543, 0.057, -0.838 ], "y_axis": [ -0.820, 0.253, -0.513 ], "z_axis": [ 0.183, 0.966, 0.184 ], "quaternion": [ 0.704, -0.526, 0.363, 0.312 ] } }, { "index": 13, "nt1": "///A/15", "nt2": "///A/31", "bp": "C-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -173.123, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 47.384, "chi2": -148.237, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 82.386, "C1C1_dist": 8.103, "N1N9_dist": 6.926, "C6C8_dist": 8.211, "CNNC_torsion": 24.461, "hbonds_num": 1, "hbonds_desc": "N4(amino)-N3[2.83]", "interBase_angle": 45.894, "planarity": 0.690, "simple_Shear": -3.039, "simple_Stretch": -1.203, "simple_Buckle": 27.605, "simple_Propeller": 36.663, "bp_simpleParams": [ -3.039, -1.203, 1.179, 27.605, 36.663, 33.860 ], "bp_params": [ -2.550, -2.044, 1.179, 15.260, 43.282, 36.000 ], "frame": { "rmsd": null, "origin": [ 17.074, 15.194, 5.713 ], "x_axis": [ 0.111, 0.324, -0.940 ], "y_axis": [ -0.972, -0.161, -0.170 ], "z_axis": [ -0.207, 0.932, 0.297 ], "quaternion": [ 0.558, -0.494, 0.328, 0.580 ] } }, { "index": 14, "nt1": "///A/15", "nt2": "///A/32", "bp": "C-A", "name": "~Sheared", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -173.123, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 82.987, "chi2": 159.967, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 3.361, "C1C1_dist": 9.035, "N1N9_dist": 7.525, "C6C8_dist": 7.724, "CNNC_torsion": 164.982, "hbonds_num": 2, "hbonds_desc": "O2'(hydroxyl)-N6(amino)[2.83],O2(carbonyl)-N6(amino)[2.75]", "interBase_angle": 22.203, "planarity": 0.249, "simple_Shear": 7.661, "simple_Stretch": 1.729, "simple_Buckle": -21.100, "simple_Propeller": 6.912, "bp_simpleParams": [ 7.661, 1.729, 0.375, -21.100, 6.912, -24.242 ], "bp_params": [ 6.111, -4.933, 0.375, -7.741, 20.810, -24.583 ], "frame": { "rmsd": null, "origin": [ 16.586, 15.082, 10.975 ], "x_axis": [ -0.357, 0.126, -0.926 ], "y_axis": [ -0.928, 0.064, 0.367 ], "z_axis": [ 0.105, 0.990, 0.094 ], "quaternion": [ 0.447, -0.348, 0.576, 0.589 ] } }, { "index": 15, "nt1": "///A/16", "nt2": "///A/30", "bp": "A-G", "name": "--", "Saenger": "--", "LW": "tHW", "DSSR": "tM-W", "intra_chain": true, "chi1": -177.373, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 48.308, "chi2": -165.137, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 74.172, "C1C1_dist": 10.376, "N1N9_dist": 9.302, "C6C8_dist": 9.096, "CNNC_torsion": 143.745, "hbonds_num": 2, "hbonds_desc": "OP2-N1(imino)[2.66],OP2-N2(amino)[2.69]", "interBase_angle": 21.994, "planarity": 0.390, "simple_Shear": -7.115, "simple_Stretch": 8.277, "simple_Buckle": -3.344, "simple_Propeller": -21.738, "bp_simpleParams": [ -7.115, 8.277, -1.193, -3.344, -21.738, -85.501 ], "bp_params": [ -8.938, -6.264, -1.193, 21.313, -5.433, -84.572 ], "frame": { "rmsd": null, "origin": [ 17.313, 17.262, 13.352 ], "x_axis": [ 0.015, 0.064, -0.998 ], "y_axis": [ -0.992, 0.128, -0.007 ], "z_axis": [ 0.127, 0.990, 0.066 ], "quaternion": [ 0.550, -0.453, 0.512, 0.480 ] } }, { "index": 16, "nt1": "///A/17", "nt2": "///A/30", "bp": "G-G", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "intra_chain": true, "chi1": -162.211, "conf1": "anti", "pucker1": "~C2'-endo", "lambda1": 4.498, "chi2": -165.137, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 102.992, "C1C1_dist": 10.237, "N1N9_dist": 9.189, "C6C8_dist": 9.665, "CNNC_torsion": 170.132, "hbonds_num": 2, "hbonds_desc": "N7-N2(amino)[3.89],O6(carbonyl)-O2'(hydroxyl)[2.50]", "interBase_angle": 30.370, "planarity": 0.494, "simple_Shear": -7.353, "simple_Stretch": 3.364, "simple_Buckle": 5.029, "simple_Propeller": -29.951, "bp_simpleParams": [ -7.353, 3.364, 1.146, 5.029, -29.951, -2.658 ], "bp_params": [ -7.268, -3.543, 1.146, 26.274, -15.233, -2.612 ], "frame": { "rmsd": null, "origin": [ 18.095, 18.404, 10.535 ], "x_axis": [ -0.635, 0.107, -0.765 ], "y_axis": [ -0.746, 0.174, 0.643 ], "z_axis": [ 0.202, 0.979, -0.030 ], "quaternion": [ 0.357, -0.235, 0.678, 0.598 ] } }, { "index": 17, "nt1": "///A/18", "nt2": "///A/29", "bp": "G-A", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -142.580, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 52.667, "chi2": -169.851, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 58.012, "C1C1_dist": 12.190, "N1N9_dist": 10.518, "C6C8_dist": 11.199, "CNNC_torsion": -20.733, "hbonds_num": 2, "hbonds_desc": "O6(carbonyl)-N6(amino)[2.96],N1(imino)-N1[2.78]", "interBase_angle": 32.527, "planarity": 0.484, "simple_Shear": -0.074, "simple_Stretch": 1.504, "simple_Buckle": 21.932, "simple_Propeller": -24.021, "bp_simpleParams": [ -0.074, 1.504, -0.477, 21.932, -24.021, -5.071 ], "bp_params": [ -0.115, 1.502, -0.477, 22.557, -23.435, -5.083 ], "frame": { "rmsd": null, "origin": [ 18.149, 22.259, 10.343 ], "x_axis": [ -0.980, -0.070, 0.188 ], "y_axis": [ 0.171, 0.202, 0.964 ], "z_axis": [ -0.105, 0.977, -0.186 ], "quaternion": [ -0.095, 0.033, 0.769, 0.631 ] } }, { "index": 18, "nt1": "///A/19", "nt2": "///A/28", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -164.595, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 45.334, "chi2": -157.640, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.412, "C1C1_dist": 10.959, "N1N9_dist": 9.106, "C6C8_dist": 9.877, "CNNC_torsion": -27.877, "hbonds_num": 2, "hbonds_desc": "N3(imino)-N1[2.94],O4(carbonyl)-N6(amino)[2.82]", "interBase_angle": 29.554, "planarity": 0.330, "simple_Shear": -0.345, "simple_Stretch": 0.108, "simple_Buckle": 21.956, "simple_Propeller": -19.784, "bp_simpleParams": [ -0.345, 0.108, -0.422, 21.956, -19.784, -5.947 ], "bp_params": [ -0.351, 0.088, -0.422, 23.093, -18.443, -5.906 ], "frame": { "rmsd": null, "origin": [ 17.163, 25.102, 8.345 ], "x_axis": [ -0.788, -0.080, 0.610 ], "y_axis": [ 0.596, 0.150, 0.789 ], "z_axis": [ -0.154, 0.986, -0.071 ], "quaternion": [ -0.270, 0.182, 0.709, 0.626 ] } }, { "index": 19, "nt1": "///A/20", "nt2": "///A/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -158.587, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 54.535, "chi2": -162.443, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 56.231, "C1C1_dist": 10.585, "N1N9_dist": 8.912, "C6C8_dist": 9.828, "CNNC_torsion": -29.212, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.83],N4(amino)-O6(carbonyl)[2.82]", "interBase_angle": 18.733, "planarity": 0.226, "simple_Shear": 0.348, "simple_Stretch": -0.181, "simple_Buckle": 8.085, "simple_Propeller": -16.898, "bp_simpleParams": [ 0.348, -0.181, 0.008, 8.085, -16.898, 0.457 ], "bp_params": [ 0.343, -0.189, 0.008, 7.632, -17.108, 0.461 ], "frame": { "rmsd": null, "origin": [ 15.669, 28.418, 7.507 ], "x_axis": [ -0.212, -0.091, 0.973 ], "y_axis": [ 0.972, 0.085, 0.219 ], "z_axis": [ -0.103, 0.992, 0.070 ], "quaternion": [ -0.486, 0.398, 0.554, 0.547 ] } }, { "index": 20, "nt1": "///A/21", "nt2": "///A/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "intra_chain": true, "chi1": -147.913, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 55.716, "chi2": -168.752, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 47.180, "C1C1_dist": 10.720, "N1N9_dist": 8.888, "C6C8_dist": 9.732, "CNNC_torsion": -10.036, "hbonds_num": 3, "hbonds_desc": "O2(carbonyl)-N2(amino)[2.75],N3-N1(imino)[2.85],N4(amino)-O6(carbonyl)[2.78]", "interBase_angle": 3.501, "planarity": 0.108, "simple_Shear": 0.564, "simple_Stretch": -0.261, "simple_Buckle": 3.216, "simple_Propeller": -1.383, "bp_simpleParams": [ 0.564, -0.261, 0.305, 3.216, -1.383, -1.586 ], "bp_params": [ 0.550, -0.291, 0.305, 3.139, -1.550, -1.585 ], "frame": { "rmsd": null, "origin": [ 14.087, 31.629, 7.409 ], "x_axis": [ 0.387, -0.174, 0.905 ], "y_axis": [ 0.921, 0.103, -0.375 ], "z_axis": [ -0.028, 0.979, 0.200 ], "quaternion": [ 0.650, -0.521, -0.359, -0.421 ] } }, { "index": 21, "nt1": "///A/22", "nt2": "///A/25", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M", "intra_chain": true, "chi1": -147.587, "conf1": "anti", "pucker1": "~C3'-endo", "lambda1": 82.346, "chi2": -162.750, "conf2": "anti", "pucker2": "~C3'-endo", "lambda2": 28.403, "C1C1_dist": 9.530, "N1N9_dist": 8.289, "C6C8_dist": 8.124, "CNNC_torsion": -137.305, "hbonds_num": 3, "hbonds_desc": "N1(imino)-OP2[2.72],N2(amino)-OP2[2.69],N2(amino)-N7[2.66]", "interBase_angle": 18.676, "planarity": 0.317, "simple_Shear": 7.940, "simple_Stretch": 4.396, "simple_Buckle": 18.666, "simple_Propeller": 0.602, "bp_simpleParams": [ 7.940, 4.396, 0.221, 18.666, 0.602, -52.898 ], "bp_params": [ 7.346, -5.330, 0.221, 8.449, -16.655, -53.260 ], "frame": { "rmsd": null, "origin": [ 11.603, 34.716, 7.887 ], "x_axis": [ 1.000, 0.012, -0.007 ], "y_axis": [ -0.009, 0.212, -0.977 ], "z_axis": [ -0.011, 0.977, 0.212 ], "quaternion": [ 0.778, -0.628, -0.001, 0.007 ] } } ], "num_multiplets": 2, "multiplets": [ { "index": 1, "num_nts": 3, "nts_short": "CCA", "nts_long": "///A/15,///A/31,///A/32", "planarity": 0.568 }, { "index": 2, "num_nts": 4, "nts_short": "ACAA", "nts_long": "///A/8,///A/9,///A/11,///A/36", "planarity": 1.772 } ], "num_helices": 1, "helices": [ { "index": 1, "num_stems": 3, "strand1": "GGCGUUAGGUCGGUCCG", "strand2": "CCGCGGACCGCGAAGGA", "bp_type": "|||||..|||...|||.", "helix_form": ".....xx..xx...A.", "helical_rise": 3.112, "helical_rise_std": 1.659, "helical_radius": 10.267, "helical_radius_std": 4.412, "helical_axis": [ 0.394, 0.915, -0.081 ], "point1": [ 5.004, -15.489, 13.953 ], "point2": [ 24.615, 30.024, 9.942 ], "num_pairs": 17, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/43", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.434, -0.145, 0.119, 14.880, 5.047, 1.165 ], "step_params": [ -0.243, -1.279, 2.857, -4.354, 0.431, 37.797 ], "heli_params": [ -2.010, -0.111, 2.852, 0.663, 6.694, 38.040 ], "bp2_params": [ -0.609, -0.182, 0.346, 27.897, -5.010, -0.339 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.857, "simple_Twist": 38.600, "simple_hRise": 2.853, "simple_hTwist": 38.837 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.609, -0.182, 0.346, 27.897, -5.010, -0.339 ], "step_params": [ -0.689, -1.800, 3.788, -0.487, 13.013, 33.628 ], "heli_params": [ -4.882, 1.041, 2.924, 21.517, 0.805, 35.994 ], "bp2_params": [ 0.076, -0.166, -0.292, 1.555, -2.936, -0.367 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.788, "simple_Twist": 29.201, "simple_hRise": 2.765, "simple_hTwist": 31.916 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/41", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.076, -0.166, -0.292, 1.555, -2.936, -0.367 ], "step_params": [ 0.196, -1.248, 3.850, 2.964, 9.305, 34.883 ], "heli_params": [ -3.493, 0.157, 3.420, 15.158, -4.828, 36.183 ], "bp2_params": [ 0.222, -0.108, -0.348, -22.089, -16.897, -1.111 ], "groove_widths": [ 15.936, null, 13.311, null ], "simple_Rise": 3.850, "simple_Twist": 34.676, "simple_hRise": 3.417, "simple_hTwist": 35.985 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.222, -0.108, -0.348, -22.089, -16.897, -1.111 ], "step_params": [ 0.846, -1.409, 3.287, 0.740, 10.164, 40.905 ], "heli_params": [ -2.968, -1.104, 2.887, 14.278, -1.039, 42.102 ], "bp2_params": [ 2.324, -0.135, 0.586, -32.509, 3.761, 4.372 ], "groove_widths": [ 17.179, 15.145, 14.880, 12.435 ], "simple_Rise": 3.287, "simple_Twist": 28.840, "simple_hRise": 2.668, "simple_hTwist": 30.551 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/39", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.324, -0.135, 0.586, -32.509, 3.761, 4.372 ], "step_params": [ -2.153, -0.445, 2.846, 9.499, -9.012, 37.761 ], "heli_params": [ 0.190, 4.044, 2.302, -13.440, -14.167, 39.888 ], "bp2_params": [ 3.174, -0.860, -0.662, -12.010, -6.650, -33.424 ], "groove_widths": [ 22.398, 17.686, 16.047, 15.484 ], "simple_Rise": 2.846, "simple_Twist": 34.575, "simple_hRise": 2.240, "simple_hTwist": 36.901 }, { "index": 6, "nt1": "///A/6", "nt2": "///A/38", "bp": "U-G", "name": "--", "Saenger": "--", "LW": "cWH", "DSSR": "cW-M", "bp1_params": [ 3.174, -0.860, -0.662, -12.010, -6.650, -33.424 ], "step_params": [ 5.300, 1.540, 7.348, 44.599, -22.405, 39.874 ], "heli_params": [ 4.467, 0.895, 7.858, -24.137, -48.046, 63.074 ], "bp2_params": [ -3.260, -0.672, -1.785, -31.176, -61.030, 56.214 ], "groove_widths": [ 25.910, 20.743, 15.687, 15.473 ], "simple_Rise": 7.348, "simple_Twist": 78.417, "simple_hRise": 8.385, "simple_hTwist": 90.743 }, { "index": 7, "nt1": "///A/8", "nt2": "///A/36", "bp": "A-A", "name": "--", "Saenger": "--", "LW": "cWS", "DSSR": "cW-m", "bp1_params": [ -3.260, -0.672, -1.785, -31.176, -61.030, 56.214 ], "step_params": [ -0.991, -0.462, 5.431, 25.533, 60.749, 15.131 ], "heli_params": [ -4.285, 2.519, 0.502, 72.384, -30.423, 67.420 ], "bp2_params": [ -0.326, -0.216, -0.422, 0.106, 3.436, -1.302 ], "groove_widths": [ 23.646, 19.883, 14.132, 14.132 ], "simple_Rise": 5.431, "simple_Twist": -5.017, "simple_hRise": 1.243, "simple_hTwist": -66.066 }, { "index": 8, "nt1": "///A/12", "nt2": "///A/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.326, -0.216, -0.422, 0.106, 3.436, -1.302 ], "step_params": [ 0.102, -0.699, 3.135, -2.196, 6.548, 35.283 ], "heli_params": [ -2.011, -0.460, 2.950, 10.677, 3.580, 35.932 ], "bp2_params": [ -0.275, -0.184, -0.163, 7.345, -1.585, -1.366 ], "groove_widths": [ 18.886, 16.106, 17.275, 17.263 ], "simple_Rise": 3.135, "simple_Twist": 35.059, "simple_hRise": 2.949, "simple_hTwist": 35.712 }, { "index": 9, "nt1": "///A/13", "nt2": "///A/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.275, -0.184, -0.163, 7.345, -1.585, -1.366 ], "step_params": [ 0.808, -1.542, 3.430, 7.207, 13.540, 39.861 ], "heli_params": [ -3.489, -0.385, 2.880, 19.027, -10.128, 42.598 ], "bp2_params": [ 2.355, -0.563, -0.752, -3.538, -6.079, 5.879 ], "groove_widths": [ 16.888, 13.622, 16.768, 16.296 ], "simple_Rise": 3.430, "simple_Twist": 24.638, "simple_hRise": 2.415, "simple_hTwist": 28.959 }, { "index": 10, "nt1": "///A/14", "nt2": "///A/33", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 2.355, -0.563, -0.752, -3.538, -6.079, 5.879 ], "step_params": [ 4.635, -0.885, 2.034, -18.733, -14.187, 26.909 ], "heli_params": [ -0.891, -8.321, -0.500, -25.232, 33.317, 35.582 ], "bp2_params": [ -2.550, -2.044, 1.179, 15.260, 43.282, 36.000 ], "groove_widths": [ 17.764, 13.132, 13.402, 12.557 ], "simple_Rise": 2.034, "simple_Twist": 59.421, "simple_hRise": 0.853, "simple_hTwist": 63.502 }, { "index": 11, "nt1": "///A/15", "nt2": "///A/31", "bp": "C-C", "name": "--", "Saenger": "--", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -2.550, -2.044, 1.179, 15.260, 43.282, 36.000 ], "step_params": [ -4.448, 0.199, 3.843, 28.045, 11.914, 46.941 ], "heli_params": [ -0.378, 6.170, 1.208, 13.437, -31.630, 55.490 ], "bp2_params": [ -7.268, -3.543, 1.146, 26.274, -15.233, -2.612 ], "groove_widths": [ 18.054, 13.309, 11.407, 10.973 ], "simple_Rise": 3.843, "simple_Twist": 75.126, "simple_hRise": 2.338, "simple_hTwist": 80.218 }, { "index": 12, "nt1": "///A/17", "nt2": "///A/30", "bp": "G-G", "name": "~Sheared", "Saenger": "--", "LW": "tHS", "DSSR": "tM-m", "bp1_params": [ -7.268, -3.543, 1.146, 26.274, -15.233, -2.612 ], "step_params": [ 0.049, 0.265, 3.851, 2.527, 19.694, 59.045 ], "heli_params": [ -0.834, 0.093, 3.762, 19.396, -2.489, 62.008 ], "bp2_params": [ -0.115, 1.502, -0.477, 22.557, -23.435, -5.083 ], "groove_widths": [ 16.004, 13.120, 12.922, 12.459 ], "simple_Rise": 3.851, "simple_Twist": 13.464, "simple_hRise": 2.398, "simple_hTwist": 23.952 }, { "index": 13, "nt1": "///A/18", "nt2": "///A/29", "bp": "G-A", "name": "Imino", "Saenger": "08-VIII", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.115, 1.502, -0.477, 22.557, -23.435, -5.083 ], "step_params": [ -0.111, -1.708, 3.180, -4.973, 5.235, 26.309 ], "heli_params": [ -4.834, -0.914, 2.769, 11.235, 10.673, 27.265 ], "bp2_params": [ -0.351, 0.088, -0.422, 23.093, -18.443, -5.906 ], "groove_widths": [ 13.948, 13.127, 15.163, 11.687 ], "simple_Rise": 3.180, "simple_Twist": 27.029, "simple_hRise": 2.782, "simple_hTwist": 27.960 }, { "index": 14, "nt1": "///A/19", "nt2": "///A/28", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.351, 0.088, -0.422, 23.093, -18.443, -5.906 ], "step_params": [ -0.139, -1.339, 3.481, -6.851, 5.220, 39.598 ], "heli_params": [ -2.545, -0.599, 3.265, 7.597, 9.969, 40.488 ], "bp2_params": [ 0.343, -0.189, 0.008, 7.632, -17.108, 0.461 ], "groove_widths": [ 15.015, null, 18.029, null ], "simple_Rise": 3.481, "simple_Twist": 35.251, "simple_hRise": 3.227, "simple_hTwist": 36.256 }, { "index": 15, "nt1": "///A/20", "nt2": "///A/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.343, -0.189, 0.008, 7.632, -17.108, 0.461 ], "step_params": [ -0.659, -1.316, 3.265, -3.609, 7.831, 34.602 ], "heli_params": [ -3.249, 0.570, 2.959, 12.919, 5.954, 35.628 ], "bp2_params": [ 0.550, -0.291, 0.305, 3.139, -1.550, -1.585 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.265, "simple_Twist": 34.162, "simple_hRise": 2.953, "simple_hTwist": 35.202 }, { "index": 16, "nt1": "///A/21", "nt2": "///A/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.550, -0.291, 0.305, 3.139, -1.550, -1.585 ], "step_params": [ -2.117, -1.192, 3.166, 0.032, 1.198, 67.695 ], "heli_params": [ -1.114, 1.901, 3.146, 1.076, -0.029, 67.704 ], "bp2_params": [ 7.346, -5.330, 0.221, 8.449, -16.655, -53.260 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.166, "simple_Twist": 22.147, "simple_hRise": 3.095, "simple_hTwist": 22.179 }, { "index": 17, "nt1": "///A/22", "nt2": "///A/25", "bp": "G-A", "name": "--", "Saenger": "--", "LW": "tSH", "DSSR": "tm-M" } ] } ], "num_stems": 3, "stems": [ { "index": 1, "helix_index": 1, "strand1": "GGCGU", "strand2": "CCGCG", "bp_type": "|||||", "helix_form": "....", "helical_rise": 1.849, "helical_rise_std": 0.259, "helical_radius": 8.796, "helical_radius_std": 0.675, "helical_axis": [ 0.167, 0.984, 0.059 ], "point1": [ 11.342, -16.612, 13.726 ], "point2": [ 12.498, -9.789, 14.138 ], "num_pairs": 5, "pairs": [ { "index": 1, "nt1": "///A/1", "nt2": "///A/43", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.434, -0.145, 0.119, 14.880, 5.047, 1.165 ], "step_params": [ -0.243, -1.279, 2.857, -4.354, 0.431, 37.797 ], "heli_params": [ -2.010, -0.111, 2.852, 0.663, 6.694, 38.040 ], "bp2_params": [ -0.609, -0.182, 0.346, 27.897, -5.010, -0.339 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 2.857, "simple_Twist": 38.600, "simple_hRise": 2.853, "simple_hTwist": 38.837 }, { "index": 2, "nt1": "///A/2", "nt2": "///A/42", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.609, -0.182, 0.346, 27.897, -5.010, -0.339 ], "step_params": [ -0.689, -1.800, 3.788, -0.487, 13.013, 33.628 ], "heli_params": [ -4.882, 1.041, 2.924, 21.517, 0.805, 35.994 ], "bp2_params": [ 0.076, -0.166, -0.292, 1.555, -2.936, -0.367 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.788, "simple_Twist": 29.201, "simple_hRise": 2.765, "simple_hTwist": 31.916 }, { "index": 3, "nt1": "///A/3", "nt2": "///A/41", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.076, -0.166, -0.292, 1.555, -2.936, -0.367 ], "step_params": [ 0.196, -1.248, 3.850, 2.964, 9.305, 34.883 ], "heli_params": [ -3.493, 0.157, 3.420, 15.158, -4.828, 36.183 ], "bp2_params": [ 0.222, -0.108, -0.348, -22.089, -16.897, -1.111 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.850, "simple_Twist": 34.676, "simple_hRise": 3.417, "simple_hTwist": 35.985 }, { "index": 4, "nt1": "///A/4", "nt2": "///A/40", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.222, -0.108, -0.348, -22.089, -16.897, -1.111 ], "step_params": [ 0.846, -1.409, 3.287, 0.740, 10.164, 40.905 ], "heli_params": [ -2.968, -1.104, 2.887, 14.278, -1.039, 42.102 ], "bp2_params": [ 2.324, -0.135, 0.586, -32.509, 3.761, 4.372 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.287, "simple_Twist": 28.840, "simple_hRise": 2.668, "simple_hTwist": 30.551 }, { "index": 5, "nt1": "///A/5", "nt2": "///A/39", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 2, "helix_index": 1, "strand1": "GGU", "strand2": "CCG", "bp_type": "|||", "helix_form": "..", "helical_rise": 2.710, "helical_rise_std": 0.433, "helical_radius": 9.832, "helical_radius_std": 1.213, "helical_axis": [ -0.060, 0.997, -0.051 ], "point1": [ 16.548, 6.346, 6.300 ], "point2": [ 16.226, 11.710, 6.025 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/12", "nt2": "///A/35", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.326, -0.216, -0.422, 0.106, 3.436, -1.302 ], "step_params": [ 0.102, -0.699, 3.135, -2.196, 6.548, 35.283 ], "heli_params": [ -2.011, -0.460, 2.950, 10.677, 3.580, 35.932 ], "bp2_params": [ -0.275, -0.184, -0.163, 7.345, -1.585, -1.366 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.135, "simple_Twist": 35.059, "simple_hRise": 2.949, "simple_hTwist": 35.712 }, { "index": 2, "nt1": "///A/13", "nt2": "///A/34", "bp": "G-C", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.275, -0.184, -0.163, 7.345, -1.585, -1.366 ], "step_params": [ 0.808, -1.542, 3.430, 7.207, 13.540, 39.861 ], "heli_params": [ -3.489, -0.385, 2.880, 19.027, -10.128, 42.598 ], "bp2_params": [ 2.355, -0.563, -0.752, -3.538, -6.079, 5.879 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.430, "simple_Twist": 24.638, "simple_hRise": 2.415, "simple_hTwist": 28.959 }, { "index": 3, "nt1": "///A/14", "nt2": "///A/33", "bp": "U-G", "name": "Wobble", "Saenger": "28-XXVIII", "LW": "cWW", "DSSR": "cW-W" } ] }, { "index": 3, "helix_index": 1, "strand1": "UCC", "strand2": "AGG", "bp_type": "|||", "helix_form": ".A", "helical_rise": 1.597, "helical_rise_std": 0.327, "helical_radius": 8.623, "helical_radius_std": 0.752, "helical_axis": [ 0.390, 0.910, 0.138 ], "point1": [ 13.928, 27.711, 10.961 ], "point2": [ 15.060, 30.349, 11.361 ], "num_pairs": 3, "pairs": [ { "index": 1, "nt1": "///A/19", "nt2": "///A/28", "bp": "U-A", "name": "WC", "Saenger": "20-XX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ -0.351, 0.088, -0.422, 23.093, -18.443, -5.906 ], "step_params": [ -0.139, -1.339, 3.481, -6.851, 5.220, 39.598 ], "heli_params": [ -2.545, -0.599, 3.265, 7.597, 9.969, 40.488 ], "bp2_params": [ 0.343, -0.189, 0.008, 7.632, -17.108, 0.461 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.481, "simple_Twist": 35.251, "simple_hRise": 3.227, "simple_hTwist": 36.256 }, { "index": 2, "nt1": "///A/20", "nt2": "///A/27", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W", "bp1_params": [ 0.343, -0.189, 0.008, 7.632, -17.108, 0.461 ], "step_params": [ -0.659, -1.316, 3.265, -3.609, 7.831, 34.602 ], "heli_params": [ -3.249, 0.570, 2.959, 12.919, 5.954, 35.628 ], "bp2_params": [ 0.550, -0.291, 0.305, 3.139, -1.550, -1.585 ], "groove_widths": [ null, null, null, null ], "simple_Rise": 3.265, "simple_Twist": 34.162, "simple_hRise": 2.953, "simple_hTwist": 35.202 }, { "index": 3, "nt1": "///A/21", "nt2": "///A/26", "bp": "C-G", "name": "WC", "Saenger": "19-XIX", "LW": "cWW", "DSSR": "cW-W" } ] } ], "num_coaxStacks": 1, "coaxStacks": [ { "index": 1, "helix_index": 1, "num_stems": 3, "stem_indices": [ 1, 2, 3 ] } ], "num_stacks": 10, "stacks": [ { "index": 1, "num_nts": 2, "nts_short": "UU", "nts_long": "///A/5,///A/6" }, { "index": 2, "num_nts": 2, "nts_short": "UA", "nts_long": "///A/7,///A/8" }, { "index": 3, "num_nts": 2, "nts_short": "AG", "nts_long": "///A/11,///A/12" }, { "index": 4, "num_nts": 2, "nts_short": "UC", "nts_long": "///A/14,///A/15" }, { "index": 5, "num_nts": 2, "nts_short": "CG", "nts_long": "///A/21,///A/22" }, { "index": 6, "num_nts": 2, "nts_short": "CA", "nts_long": "///A/35,///A/36" }, { "index": 7, "num_nts": 4, "nts_short": "GAAG", "nts_long": "///A/23,///A/24,///A/25,///A/26" }, { "index": 8, "num_nts": 4, "nts_short": "AAGC", "nts_long": "///A/28,///A/29,///A/30,///A/31" }, { "index": 9, "num_nts": 5, "nts_short": "CCAGG", "nts_long": "///A/10,///A/9,///A/37,///A/38,///A/39" }, { "index": 10, "num_nts": 6, "nts_short": "UGGAAG", "nts_long": "///A/19,///A/18,///A/17,///A/16,///A/32,///A/33" } ], "nonStack": { "num_nts": 1, "nts_short": "C", "nts_long": "///A/43" }, "num_atom2bases": 4, "atom2bases": [ { "index": 1, "type": "sugar", "atom": "///A/10/O2'", "nt": "///A/9", "vert_dist": 2.890 }, { "index": 2, "type": "sugar", "atom": "///A/17/O4'", "nt": "///A/16", "vert_dist": 3.030 }, { "index": 3, "type": "sugar", "atom": "///A/26/O4'", "nt": "///A/25", "vert_dist": 3.270 }, { "index": 4, "type": "sugar", "atom": "///A/38/O4'", "nt": "///A/37", "vert_dist": 3.171 } ], "num_hairpins": 1, "hairpins": [ { "index": 1, "type": "hairpin loop", "bridging_nts": [ 4 ], "stem_indices": [ 3 ], "summary": "[1] 4 [A.21 A.26] 3", "num_nts": 6, "nts_short": "CGGAAG", "nts_long": "///A/21,///A/22,///A/23,///A/24,///A/25,///A/26", "num_stems": 1, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "GGAA", "nts_long": "///A/22,///A/23,///A/24,///A/25" } ] } ], "num_iloops": 2, "iloops": [ { "index": 1, "type": "symmetric internal loop", "bridging_nts": [ 4, 4 ], "stem_indices": [ 2, 3 ], "summary": "[2] 4 4 [A.14 A.33 A.19 A.28] 3 3", "num_nts": 12, "nts_short": "UCAGGUAAGCAG", "nts_long": "///A/14,///A/15,///A/16,///A/17,///A/18,///A/19,///A/28,///A/29,///A/30,///A/31,///A/32,///A/33", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 4, "nts_short": "CAGG", "nts_long": "///A/15,///A/16,///A/17,///A/18" }, { "index": 2, "num_nts": 4, "nts_short": "AGCA", "nts_long": "///A/29,///A/30,///A/31,///A/32" } ] }, { "index": 2, "type": "asymmetric internal loop", "bridging_nts": [ 6, 3 ], "stem_indices": [ 1, 2 ], "summary": "[2] 6 3 [A.5 A.39 A.12 A.35] 5 3", "num_nts": 13, "nts_short": "UUUACCAGCAAGG", "nts_long": "///A/5,///A/6,///A/7,///A/8,///A/9,///A/10,///A/11,///A/12,///A/35,///A/36,///A/37,///A/38,///A/39", "num_stems": 2, "bridges": [ { "index": 1, "num_nts": 6, "nts_short": "UUACCA", "nts_long": "///A/6,///A/7,///A/8,///A/9,///A/10,///A/11" }, { "index": 2, "num_nts": 3, "nts_short": "AAG", "nts_long": "///A/36,///A/37,///A/38" } ] } ], "num_splayUnits": 1, "splayUnits": [ { "index": 1, "num_nts": 2, "nts_short": "AA", "nts_long": "///A/36,///A/37" } ], "dbn": { "all_chains": { "num_nts": 43, "num_chars": 43, "bseq": "GGCGUUUACCAGGUCAGGUCCGGAAGGAAGCAGCCAAGGCGCC", "sstr": "(((((......(((....(((....)))....)))...)))))", "form": ".AA.........A....A.A..BA.AAA....A.....A..A-" }, "chain_A": { "num_nts": 43, "num_chars": 43, "bseq": "GGCGUUUACCAGGUCAGGUCCGGAAGGAAGCAGCCAAGGCGCC", "sstr": "(((((......(((....(((....)))....)))...)))))", "form": ".AA.........A....A.A..BA.AAA....A.....A..A-" } }, "chains": { "chain_A": { "num_nts": 43, "bseq": "GGCGUUUACCAGGUCAGGUCCGGAAGGAAGCAGCCAAGGCGCC", "sstr": "(((((......(((....(((....)))....)))...)))))", "form": ".AA.........A....A.A..BA.AAA....A.....A..A-", "helical_rise": 0.132, "helical_rise_std": 2.683, "helical_axis": [ 0.942, -0.083, -0.324 ], "point1": [ 6.310, 12.471, 15.442 ], "point2": [ 11.980, 11.971, 13.492 ], "num_chars": 127, "suite": "G1aG1aC1aG1aU!!U!!U!!A!!C!!C0bA!!G1aG1aU!!C1cA!!G!!G1cU1aC1aC1aG!!G!!A1LA!!G1aG1aA1cA1cG!!C!!A!!G1aC1aC!!A5nA!!G1aG1aC1aG1aC1aC" } }, "num_nts": 43, "nts": [ { "index": 1, "index_chain": 1, "chain_name": "A", "nt_resnum": 1, "nt_name": "G", "nt_code": "G", "nt_id": "///A/1", "linked_nts": [ null, "///A/2" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack", "alpha": null, "beta": null, "gamma": -60.575, "delta": 74.451, "epsilon": -161.183, "zeta": -76.100, "epsilon_zeta": -85.083, "bb_type": "BI", "chi": -154.137, "glyco_bond": "anti", "C5prime_xyz": [ -2.652, 8.936, 0.264 ], "P_xyz": [ null, null, null ], "form": ".", "ssZp": 3.760, "Dp": 4.185, "splay_angle": 20.414, "splay_distance": 3.327, "splay_ratio": 0.177, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": -0.090, "v1": -22.785, "v2": 34.647, "v3": -36.601, "v4": 23.162, "amplitude": 36.681, "phase_angle": 19.168, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "inc", "cluster": "__", "suiteness": 0.000, "filter_rmsd": 0.028, "frame": { "rmsd": 0.028, "origin": [ 8.794, -17.706, 17.287 ], "x_axis": [ 0.319, -0.356, -0.878 ], "y_axis": [ -0.626, 0.617, -0.477 ], "z_axis": [ 0.712, 0.702, -0.026 ], "quaternion": [ 0.691, -0.427, 0.575, 0.097 ] } }, { "index": 2, "index_chain": 2, "chain_name": "A", "nt_resnum": 2, "nt_name": "G", "nt_code": "G", "nt_id": "///A/2", "linked_nts": [ "///A/1", "///A/3" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -65.788, "beta": 171.545, "gamma": 57.267, "delta": 85.808, "epsilon": -154.505, "zeta": -65.689, "epsilon_zeta": -88.816, "bb_type": "BI", "chi": -144.683, "glyco_bond": "anti", "C5prime_xyz": [ -1.448, 8.825, -0.283 ], "P_xyz": [ 1.080, 9.353, 0.194 ], "form": "A", "ssZp": 3.471, "Dp": 4.454, "splay_angle": 23.656, "splay_distance": 3.980, "splay_ratio": 0.206, "d22": null, "d64": null, "eta": 171.127, "theta": -136.857, "eta_prime": -179.060, "theta_prime": -140.023, "eta_base": -135.346, "theta_base": -113.874, "v0": 6.150, "v1": -29.320, "v2": 39.133, "v3": -36.810, "v4": 19.502, "amplitude": 39.714, "phase_angle": 9.817, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.762, "filter_rmsd": 0.051, "frame": { "rmsd": 0.051, "origin": [ 11.672, -16.070, 17.620 ], "x_axis": [ -0.142, 0.061, -0.988 ], "y_axis": [ -0.660, 0.738, 0.141 ], "z_axis": [ 0.738, 0.672, -0.065 ], "quaternion": [ 0.619, -0.215, 0.697, 0.291 ] } }, { "index": 3, "index_chain": 3, "chain_name": "A", "nt_resnum": 3, "nt_name": "C", "nt_code": "C", "nt_id": "///A/3", "linked_nts": [ "///A/2", "///A/4" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.111, "beta": 173.462, "gamma": 54.809, "delta": 82.152, "epsilon": -156.059, "zeta": -69.848, "epsilon_zeta": -86.212, "bb_type": "BI", "chi": -160.084, "glyco_bond": "anti", "C5prime_xyz": [ -1.732, 8.944, 0.297 ], "P_xyz": [ 0.657, 9.798, 1.055 ], "form": "A", "ssZp": 3.813, "Dp": 4.617, "splay_angle": 24.538, "splay_distance": 3.993, "splay_ratio": 0.214, "d22": null, "d64": null, "eta": 160.159, "theta": -145.473, "eta_prime": 176.581, "theta_prime": -143.106, "eta_base": -140.134, "theta_base": -109.092, "v0": 0.480, "v1": -24.186, "v2": 36.232, "v3": -37.243, "v4": 23.667, "amplitude": 38.098, "phase_angle": 18.006, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.897, "filter_rmsd": 0.063, "frame": { "rmsd": 0.029, "origin": [ 14.930, -14.089, 16.479 ], "x_axis": [ -0.692, 0.165, -0.703 ], "y_axis": [ -0.552, 0.505, 0.663 ], "z_axis": [ 0.465, 0.847, -0.258 ], "quaternion": [ 0.372, -0.123, 0.784, 0.482 ] } }, { "index": 4, "index_chain": 4, "chain_name": "A", "nt_resnum": 4, "nt_name": "G", "nt_code": "G", "nt_id": "///A/4", "linked_nts": [ "///A/3", "///A/5" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.119, "beta": 172.446, "gamma": 57.000, "delta": 86.409, "epsilon": -156.134, "zeta": -62.854, "epsilon_zeta": -93.280, "bb_type": "BI", "chi": -156.639, "glyco_bond": "anti", "C5prime_xyz": [ -1.958, 8.771, 0.661 ], "P_xyz": [ 0.562, 9.514, 0.962 ], "form": ".", "ssZp": 4.368, "Dp": 4.485, "splay_angle": 25.471, "splay_distance": 4.219, "splay_ratio": 0.229, "d22": null, "d64": null, "eta": 160.917, "theta": -132.919, "eta_prime": 179.700, "theta_prime": -134.700, "eta_base": -129.179, "theta_base": -92.400, "v0": 6.061, "v1": -29.069, "v2": 38.734, "v3": -36.910, "v4": 19.379, "amplitude": 39.340, "phase_angle": 10.065, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.866, "filter_rmsd": 0.061, "frame": { "rmsd": 0.061, "origin": [ 16.485, -11.252, 14.138 ], "x_axis": [ -0.893, 0.408, -0.192 ], "y_axis": [ -0.098, 0.241, 0.966 ], "z_axis": [ 0.440, 0.881, -0.175 ], "quaternion": [ 0.208, 0.102, 0.760, 0.608 ] } }, { "index": 5, "index_chain": 5, "chain_name": "A", "nt_resnum": 5, "nt_name": "U", "nt_code": "U", "nt_id": "///A/5", "linked_nts": [ "///A/4", "///A/6" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -67.609, "beta": 173.892, "gamma": 57.337, "delta": 64.641, "epsilon": -161.218, "zeta": -83.350, "epsilon_zeta": -77.868, "bb_type": "BI", "chi": -159.251, "glyco_bond": "anti", "C5prime_xyz": [ -1.720, 8.872, 0.449 ], "P_xyz": [ 0.701, 9.705, 1.117 ], "form": ".", "ssZp": 3.935, "Dp": 4.676, "splay_angle": 18.573, "splay_distance": 2.890, "splay_ratio": 0.162, "d22": 5.198, "d64": 4.984, "eta": 170.183, "theta": -176.751, "eta_prime": -172.209, "theta_prime": -168.574, "eta_base": -109.913, "theta_base": -166.473, "v0": 6.136, "v1": -28.858, "v2": 40.201, "v3": -39.194, "v4": 20.163, "amplitude": 40.973, "phase_angle": 11.139, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.349, "filter_rmsd": 0.094, "frame": { "rmsd": 0.040, "origin": [ 15.289, -7.637, 12.323 ], "x_axis": [ -0.750, 0.299, 0.590 ], "y_axis": [ 0.593, -0.089, 0.800 ], "z_axis": [ 0.291, 0.950, -0.110 ], "quaternion": [ -0.112, 0.335, 0.666, 0.657 ] } }, { "index": 6, "index_chain": 6, "chain_name": "A", "nt_resnum": 6, "nt_name": "U", "nt_code": "U", "nt_id": "///A/6", "linked_nts": [ "///A/5", "///A/7" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,non-canonical,non-pair-contact,helix,internal-loop", "alpha": -52.127, "beta": 170.891, "gamma": 50.917, "delta": 116.258, "epsilon": -92.283, "zeta": -131.524, "epsilon_zeta": 39.241, "bb_type": "--", "chi": -120.965, "glyco_bond": "anti", "C5prime_xyz": [ -1.863, 8.575, -0.826 ], "P_xyz": [ 0.749, 8.755, -1.266 ], "form": ".", "ssZp": 2.711, "Dp": 3.191, "splay_angle": 45.051, "splay_distance": 8.100, "splay_ratio": 0.383, "d22": 4.386, "d64": 4.744, "eta": -157.416, "theta": -108.217, "eta_prime": -152.326, "theta_prime": -120.287, "eta_base": -156.976, "theta_base": -99.956, "v0": 1.048, "v1": -4.577, "v2": 6.013, "v3": -5.581, "v4": 2.905, "amplitude": 6.084, "phase_angle": 8.789, "puckering": "C3'-endo", "sugar_class": "--", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.101, "frame": { "rmsd": 0.035, "origin": [ 16.469, -6.207, 10.106 ], "x_axis": [ -0.458, 0.592, 0.663 ], "y_axis": [ 0.867, 0.131, 0.482 ], "z_axis": [ 0.199, 0.795, -0.573 ], "quaternion": [ -0.158, 0.496, 0.735, 0.434 ] } }, { "index": 7, "index_chain": 7, "chain_name": "A", "nt_resnum": 7, "nt_name": "U", "nt_code": "U", "nt_id": "///A/7", "linked_nts": [ "///A/6", "///A/8" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,anti,~C2'-endo,non-pair-contact,internal-loop", "alpha": 66.076, "beta": -111.749, "gamma": -127.713, "delta": 109.540, "epsilon": 84.644, "zeta": -44.020, "epsilon_zeta": -231.336, "bb_type": "--", "chi": 158.373, "glyco_bond": "anti", "C5prime_xyz": [ -2.945, 7.894, 2.456 ], "P_xyz": [ -1.520, 9.948, 3.296 ], "form": ".", "ssZp": -1.921, "Dp": 1.110, "splay_angle": 17.643, "splay_distance": 2.840, "splay_ratio": 0.154, "d22": null, "d64": null, "eta": -103.852, "theta": 88.973, "eta_prime": -119.281, "theta_prime": 112.118, "eta_base": -100.511, "theta_base": 127.506, "v0": -32.302, "v1": 34.672, "v2": -29.365, "v3": 12.328, "v4": 11.543, "amplitude": 36.399, "phase_angle": 143.782, "puckering": "C1'-exo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.123, "frame": { "rmsd": 0.070, "origin": [ 18.626, 1.577, 9.492 ], "x_axis": [ -0.675, -0.523, 0.520 ], "y_axis": [ 0.578, -0.813, -0.066 ], "z_axis": [ 0.458, 0.256, 0.852 ], "quaternion": [ -0.301, 0.267, 0.052, 0.914 ] } }, { "index": 8, "index_chain": 8, "chain_name": "A", "nt_resnum": 8, "nt_name": "A", "nt_code": "A", "nt_id": "///A/8", "linked_nts": [ "///A/7", "///A/9" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate", "alpha": 164.163, "beta": -159.635, "gamma": 175.977, "delta": 82.149, "epsilon": 140.290, "zeta": 47.813, "epsilon_zeta": 92.477, "bb_type": "--", "chi": -129.148, "glyco_bond": "anti", "C5prime_xyz": [ -1.054, 8.404, -0.659 ], "P_xyz": [ 1.142, 9.077, -1.890 ], "form": ".", "ssZp": 1.943, "Dp": 3.565, "splay_angle": 29.648, "splay_distance": 5.329, "splay_ratio": 0.258, "d22": null, "d64": null, "eta": -149.851, "theta": -90.004, "eta_prime": -156.243, "theta_prime": -125.789, "eta_base": -145.087, "theta_base": -148.468, "v0": 20.251, "v1": -34.904, "v2": 34.838, "v3": -24.342, "v4": 2.933, "amplitude": 35.996, "phase_angle": 345.425, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.050, "frame": { "rmsd": 0.025, "origin": [ 16.884, 0.411, 7.576 ], "x_axis": [ 0.361, 0.893, -0.268 ], "y_axis": [ 0.777, -0.447, -0.442 ], "z_axis": [ -0.515, -0.049, -0.856 ], "quaternion": [ -0.121, 0.816, 0.512, -0.240 ] } }, { "index": 9, "index_chain": 9, "chain_name": "A", "nt_resnum": 9, "nt_name": "C", "nt_code": "C", "nt_id": "///A/9", "linked_nts": [ "///A/8", "///A/10" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,cap-acceptor,phosphate", "alpha": 50.573, "beta": -179.979, "gamma": 172.825, "delta": 73.168, "epsilon": 157.923, "zeta": 35.040, "epsilon_zeta": 122.882, "bb_type": "--", "chi": -151.286, "glyco_bond": "anti", "C5prime_xyz": [ -2.191, 8.935, -0.686 ], "P_xyz": [ -1.676, 10.106, -3.023 ], "form": ".", "ssZp": 3.434, "Dp": 4.218, "splay_angle": 26.429, "splay_distance": 4.290, "splay_ratio": 0.231, "d22": 5.370, "d64": 6.559, "eta": 97.200, "theta": -104.025, "eta_prime": 126.843, "theta_prime": -137.627, "eta_base": 127.166, "theta_base": 168.302, "v0": 0.528, "v1": -24.993, "v2": 37.138, "v3": -37.652, "v4": 24.314, "amplitude": 38.980, "phase_angle": 17.686, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.062, "frame": { "rmsd": 0.050, "origin": [ 12.612, -0.984, 4.712 ], "x_axis": [ 0.465, 0.694, 0.549 ], "y_axis": [ 0.885, -0.380, -0.268 ], "z_axis": [ 0.023, 0.611, -0.791 ], "quaternion": [ -0.271, 0.812, 0.486, 0.176 ] } }, { "index": 10, "index_chain": 10, "chain_name": "A", "nt_resnum": 10, "nt_name": "C", "nt_code": "C", "nt_id": "///A/10", "linked_nts": [ "///A/9", "///A/11" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,BII,non-pair-contact,internal-loop,cap-donor,phosphate", "alpha": 94.645, "beta": 170.658, "gamma": 80.280, "delta": 144.436, "epsilon": -68.866, "zeta": 131.511, "epsilon_zeta": 159.623, "bb_type": "BII", "chi": -130.710, "glyco_bond": "anti", "C5prime_xyz": [ -2.083, 8.826, 0.514 ], "P_xyz": [ 0.398, 9.601, -0.073 ], "form": ".", "ssZp": 2.685, "Dp": 0.568, "splay_angle": 17.952, "splay_distance": 3.245, "splay_ratio": 0.185, "d22": null, "d64": null, "eta": 52.239, "theta": 157.274, "eta_prime": 101.590, "theta_prime": 155.871, "eta_base": 73.248, "theta_base": -154.437, "v0": -21.682, "v1": 36.785, "v2": -36.546, "v3": 26.427, "v4": -3.323, "amplitude": 37.719, "phase_angle": 165.678, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "32p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.082, "frame": { "rmsd": 0.062, "origin": [ 9.808, 0.404, 1.778 ], "x_axis": [ -0.426, -0.882, 0.203 ], "y_axis": [ 0.778, -0.472, -0.415 ], "z_axis": [ 0.462, -0.019, 0.887 ], "quaternion": [ -0.497, 0.199, -0.130, 0.834 ] } }, { "index": 11, "index_chain": 11, "chain_name": "A", "nt_resnum": 11, "nt_name": "A", "nt_code": "A", "nt_id": "///A/11", "linked_nts": [ "///A/10", "///A/12" ], "nt_type": "RNA", "dbn": ".", "summary": "~C2'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop", "alpha": -73.571, "beta": 155.036, "gamma": 49.570, "delta": 146.400, "epsilon": 166.471, "zeta": -95.351, "epsilon_zeta": -98.178, "bb_type": "BI", "chi": -89.331, "glyco_bond": "--", "C5prime_xyz": [ -1.549, 7.335, -2.683 ], "P_xyz": [ 1.070, 7.494, -2.302 ], "form": ".", "ssZp": 0.552, "Dp": 1.390, "splay_angle": 28.859, "splay_distance": 4.881, "splay_ratio": 0.250, "d22": null, "d64": null, "eta": 177.713, "theta": -123.544, "eta_prime": -139.586, "theta_prime": -171.433, "eta_base": -102.637, "theta_base": -106.933, "v0": -3.968, "v1": 25.370, "v2": -35.161, "v3": 34.483, "v4": -19.311, "amplitude": 36.047, "phase_angle": 192.735, "puckering": "C3'-exo", "sugar_class": "~C2'-endo", "bin": "22p", "cluster": "0b", "suiteness": 0.141, "filter_rmsd": 0.059, "frame": { "rmsd": 0.036, "origin": [ 12.002, 2.323, 3.205 ], "x_axis": [ 0.414, -0.607, 0.678 ], "y_axis": [ 0.910, 0.251, -0.330 ], "z_axis": [ 0.030, 0.754, 0.656 ], "quaternion": [ 0.762, -0.356, -0.213, -0.498 ] } }, { "index": 12, "index_chain": 12, "chain_name": "A", "nt_resnum": 12, "nt_name": "G", "nt_code": "G", "nt_id": "///A/12", "linked_nts": [ "///A/11", "///A/13" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": -68.968, "beta": 162.260, "gamma": 66.059, "delta": 84.629, "epsilon": -173.187, "zeta": -69.715, "epsilon_zeta": -103.472, "bb_type": "BI", "chi": -145.541, "glyco_bond": "anti", "C5prime_xyz": [ -2.157, 8.980, -0.592 ], "P_xyz": [ 0.277, 9.898, -1.014 ], "form": ".", "ssZp": 3.537, "Dp": 4.191, "splay_angle": 20.552, "splay_distance": 3.380, "splay_ratio": 0.178, "d22": null, "d64": null, "eta": 170.443, "theta": -153.036, "eta_prime": -178.304, "theta_prime": -160.127, "eta_base": -104.095, "theta_base": -128.193, "v0": -4.497, "v1": -17.867, "v2": 31.135, "v3": -34.789, "v4": 25.408, "amplitude": 34.654, "phase_angle": 26.044, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "23p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.024, "frame": { "rmsd": 0.024, "origin": [ 13.115, 5.986, 6.232 ], "x_axis": [ 0.932, 0.063, 0.356 ], "y_axis": [ 0.321, 0.309, -0.895 ], "z_axis": [ -0.167, 0.949, 0.268 ], "quaternion": [ 0.792, -0.582, -0.165, -0.081 ] } }, { "index": 13, "index_chain": 13, "chain_name": "A", "nt_resnum": 13, "nt_name": "G", "nt_code": "G", "nt_id": "///A/13", "linked_nts": [ "///A/12", "///A/14" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -96.281, "beta": -176.642, "gamma": 66.163, "delta": 89.322, "epsilon": -164.976, "zeta": -57.379, "epsilon_zeta": -107.597, "bb_type": "BI", "chi": -150.389, "glyco_bond": "anti", "C5prime_xyz": [ -1.534, 8.882, 0.154 ], "P_xyz": [ 1.060, 9.431, -0.078 ], "form": "A", "ssZp": 4.371, "Dp": 4.513, "splay_angle": 23.892, "splay_distance": 3.918, "splay_ratio": 0.211, "d22": null, "d64": null, "eta": 155.671, "theta": -132.151, "eta_prime": 167.986, "theta_prime": -134.854, "eta_base": -143.687, "theta_base": -93.648, "v0": 3.817, "v1": -25.085, "v2": 34.286, "v3": -32.664, "v4": 18.887, "amplitude": 35.067, "phase_angle": 12.113, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.164, "filter_rmsd": 0.062, "frame": { "rmsd": 0.062, "origin": [ 12.818, 8.971, 7.789 ], "x_axis": [ 0.958, 0.150, -0.245 ], "y_axis": [ -0.277, 0.258, -0.926 ], "z_axis": [ -0.075, 0.955, 0.288 ], "quaternion": [ 0.791, -0.594, 0.054, 0.135 ] } }, { "index": 14, "index_chain": 14, "chain_name": "A", "nt_resnum": 14, "nt_name": "U", "nt_code": "U", "nt_id": "///A/14", "linked_nts": [ "///A/13", "///A/15" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -82.548, "beta": 169.990, "gamma": 68.722, "delta": 62.820, "epsilon": 93.979, "zeta": 71.549, "epsilon_zeta": 22.430, "bb_type": "--", "chi": -162.387, "glyco_bond": "anti", "C5prime_xyz": [ -1.644, 8.841, 0.536 ], "P_xyz": [ 0.899, 9.610, 0.590 ], "form": ".", "ssZp": 3.183, "Dp": 3.745, "splay_angle": 24.089, "splay_distance": 4.451, "splay_ratio": 0.222, "d22": 3.434, "d64": 3.950, "eta": -177.796, "theta": -99.212, "eta_prime": -153.708, "theta_prime": -120.575, "eta_base": -92.683, "theta_base": -87.028, "v0": 5.909, "v1": -29.326, "v2": 40.426, "v3": -38.955, "v4": 20.815, "amplitude": 41.205, "phase_angle": 11.156, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.122, "filter_rmsd": 0.098, "frame": { "rmsd": 0.041, "origin": [ 15.459, 11.835, 8.209 ], "x_axis": [ 0.508, 0.120, -0.853 ], "y_axis": [ -0.852, 0.218, -0.476 ], "z_axis": [ 0.129, 0.969, 0.212 ], "quaternion": [ 0.696, -0.519, 0.353, 0.349 ] } }, { "index": 15, "index_chain": 15, "chain_name": "A", "nt_resnum": 15, "nt_name": "C", "nt_code": "C", "nt_id": "///A/15", "linked_nts": [ "///A/14", "///A/16" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate", "alpha": 53.037, "beta": -167.211, "gamma": -175.140, "delta": 73.072, "epsilon": 156.488, "zeta": -95.072, "epsilon_zeta": -108.440, "bb_type": "BI", "chi": -173.123, "glyco_bond": "anti", "C5prime_xyz": [ -1.548, 8.569, 1.560 ], "P_xyz": [ -0.541, 10.779, 0.577 ], "form": ".", "ssZp": 4.547, "Dp": 4.373, "splay_angle": 68.435, "splay_distance": 10.831, "splay_ratio": 0.572, "d22": null, "d64": null, "eta": 131.665, "theta": 129.306, "eta_prime": 160.718, "theta_prime": 125.805, "eta_base": -137.026, "theta_base": 121.871, "v0": 4.414, "v1": -29.056, "v2": 40.015, "v3": -38.296, "v4": 22.142, "amplitude": 40.963, "phase_angle": 12.352, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.055, "frame": { "rmsd": 0.014, "origin": [ 17.804, 15.496, 7.260 ], "x_axis": [ -0.158, -0.053, -0.986 ], "y_axis": [ -0.987, -0.015, 0.159 ], "z_axis": [ -0.024, 0.998, -0.050 ], "quaternion": [ 0.441, -0.476, 0.546, 0.530 ] } }, { "index": 16, "index_chain": 16, "chain_name": "A", "nt_resnum": 16, "nt_name": "A", "nt_code": "A", "nt_id": "///A/16", "linked_nts": [ "///A/15", "///A/17" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,internal-loop,cap-acceptor,phosphate", "alpha": 166.728, "beta": -176.159, "gamma": -164.051, "delta": 77.354, "epsilon": 141.752, "zeta": 39.345, "epsilon_zeta": 102.407, "bb_type": "--", "chi": -177.373, "glyco_bond": "anti", "C5prime_xyz": [ -1.844, 8.181, 1.565 ], "P_xyz": [ -1.024, 10.595, 0.878 ], "form": ".", "ssZp": 3.434, "Dp": 4.140, "splay_angle": 36.635, "splay_distance": 6.278, "splay_ratio": 0.332, "d22": null, "d64": null, "eta": -143.497, "theta": -120.562, "eta_prime": -165.870, "theta_prime": -114.750, "eta_base": 171.524, "theta_base": -42.652, "v0": 6.191, "v1": -28.884, "v2": 37.656, "v3": -35.918, "v4": 19.422, "amplitude": 38.227, "phase_angle": 9.919, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.069, "filter_rmsd": 0.055, "frame": { "rmsd": 0.033, "origin": [ 20.274, 15.983, 17.794 ], "x_axis": [ 0.659, -0.126, -0.742 ], "y_axis": [ -0.686, 0.302, -0.661 ], "z_axis": [ 0.308, 0.945, 0.113 ], "quaternion": [ 0.720, -0.558, 0.364, 0.195 ] } }, { "index": 17, "index_chain": 17, "chain_name": "A", "nt_resnum": 17, "nt_name": "G", "nt_code": "G", "nt_id": "///A/17", "linked_nts": [ "///A/16", "///A/18" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,cap-donor,phosphate", "alpha": 70.302, "beta": -166.982, "gamma": -162.363, "delta": 119.539, "epsilon": -110.925, "zeta": -71.908, "epsilon_zeta": -39.017, "bb_type": "--", "chi": -162.211, "glyco_bond": "anti", "C5prime_xyz": [ -1.147, 8.785, 0.433 ], "P_xyz": [ 0.323, 10.467, -1.001 ], "form": ".", "ssZp": 2.831, "Dp": 3.025, "splay_angle": 30.870, "splay_distance": 5.344, "splay_ratio": 0.266, "d22": null, "d64": null, "eta": 163.642, "theta": -107.221, "eta_prime": -163.197, "theta_prime": -107.929, "eta_base": -69.929, "theta_base": -51.542, "v0": -27.478, "v1": 34.736, "v2": -29.586, "v3": 14.113, "v4": 8.302, "amplitude": 34.802, "phase_angle": 148.224, "puckering": "C2'-endo", "sugar_class": "~C2'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.052, "frame": { "rmsd": 0.052, "origin": [ 21.838, 18.266, 12.159 ], "x_axis": [ -0.576, 0.224, -0.786 ], "y_axis": [ -0.684, 0.395, 0.613 ], "z_axis": [ 0.447, 0.891, -0.074 ], "quaternion": [ 0.431, -0.161, 0.715, 0.526 ] } }, { "index": 18, "index_chain": 18, "chain_name": "A", "nt_resnum": 18, "nt_name": "G", "nt_code": "G", "nt_id": "///A/18", "linked_nts": [ "///A/17", "///A/19" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 94.048, "beta": -145.801, "gamma": -168.430, "delta": 90.448, "epsilon": 178.888, "zeta": -74.486, "epsilon_zeta": -106.625, "bb_type": "BI", "chi": -142.580, "glyco_bond": "anti", "C5prime_xyz": [ -1.333, 8.574, -0.589 ], "P_xyz": [ -0.704, 9.455, -3.026 ], "form": "A", "ssZp": 3.842, "Dp": 4.426, "splay_angle": 23.382, "splay_distance": 4.046, "splay_ratio": 0.209, "d22": null, "d64": null, "eta": 122.986, "theta": -164.733, "eta_prime": 169.649, "theta_prime": -169.754, "eta_base": -113.443, "theta_base": -152.860, "v0": 5.963, "v1": -26.704, "v2": 35.548, "v3": -33.177, "v4": 17.766, "amplitude": 36.041, "phase_angle": 9.483, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.023, "frame": { "rmsd": 0.023, "origin": [ 18.359, 22.182, 11.101 ], "x_axis": [ -0.990, 0.107, 0.087 ], "y_axis": [ 0.123, 0.395, 0.911 ], "z_axis": [ 0.063, 0.912, -0.404 ], "quaternion": [ -0.007, 0.069, 0.835, 0.546 ] } }, { "index": 19, "index_chain": 19, "chain_name": "A", "nt_resnum": 19, "nt_name": "U", "nt_code": "U", "nt_id": "///A/19", "linked_nts": [ "///A/18", "///A/20" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": 151.944, "beta": -153.348, "gamma": 179.891, "delta": 87.689, "epsilon": -140.850, "zeta": -68.718, "epsilon_zeta": -72.133, "bb_type": "BI", "chi": -164.595, "glyco_bond": "anti", "C5prime_xyz": [ -1.547, 8.635, 0.804 ], "P_xyz": [ 0.415, 10.176, -0.002 ], "form": ".", "ssZp": 3.717, "Dp": 4.572, "splay_angle": 24.621, "splay_distance": 3.981, "splay_ratio": 0.213, "d22": 4.028, "d64": 3.598, "eta": 178.174, "theta": -152.602, "eta_prime": -168.022, "theta_prime": -149.472, "eta_base": -137.110, "theta_base": -107.001, "v0": 6.201, "v1": -27.390, "v2": 37.085, "v3": -34.551, "v4": 17.832, "amplitude": 37.584, "phase_angle": 9.350, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.597, "filter_rmsd": 0.099, "frame": { "rmsd": 0.039, "origin": [ 17.360, 24.914, 8.288 ], "x_axis": [ -0.840, 0.058, 0.539 ], "y_axis": [ 0.523, 0.348, 0.778 ], "z_axis": [ -0.142, 0.936, -0.323 ], "quaternion": [ -0.215, 0.183, 0.792, 0.541 ] } }, { "index": 20, "index_chain": 20, "chain_name": "A", "nt_resnum": 20, "nt_name": "C", "nt_code": "C", "nt_id": "///A/20", "linked_nts": [ "///A/19", "///A/21" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.343, "beta": 175.346, "gamma": 51.391, "delta": 79.904, "epsilon": -154.151, "zeta": -70.563, "epsilon_zeta": -83.588, "bb_type": "BI", "chi": -158.587, "glyco_bond": "anti", "C5prime_xyz": [ -1.423, 8.809, 0.209 ], "P_xyz": [ 1.078, 9.309, 0.870 ], "form": "A", "ssZp": 3.910, "Dp": 4.639, "splay_angle": 22.548, "splay_distance": 3.637, "splay_ratio": 0.196, "d22": 4.253, "d64": 3.990, "eta": 161.034, "theta": -144.797, "eta_prime": 179.205, "theta_prime": -141.692, "eta_base": -125.272, "theta_base": -116.159, "v0": 5.656, "v1": -29.240, "v2": 39.399, "v3": -38.343, "v4": 20.652, "amplitude": 40.169, "phase_angle": 11.241, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.852, "filter_rmsd": 0.067, "frame": { "rmsd": 0.027, "origin": [ 15.541, 28.398, 7.654 ], "x_axis": [ -0.226, 0.058, 0.973 ], "y_axis": [ 0.965, 0.151, 0.215 ], "z_axis": [ -0.135, 0.987, -0.090 ], "quaternion": [ -0.457, 0.422, 0.605, 0.496 ] } }, { "index": 21, "index_chain": 21, "chain_name": "A", "nt_resnum": 21, "nt_name": "C", "nt_code": "C", "nt_id": "///A/21", "linked_nts": [ "///A/20", "///A/22" ], "nt_type": "RNA", "dbn": "(", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop", "alpha": -61.638, "beta": 179.709, "gamma": 40.684, "delta": 91.646, "epsilon": -155.024, "zeta": -56.623, "epsilon_zeta": -98.401, "bb_type": "BI", "chi": -147.913, "glyco_bond": "anti", "C5prime_xyz": [ -1.282, 8.778, -0.100 ], "P_xyz": [ 1.246, 9.296, 0.525 ], "form": ".", "ssZp": 3.926, "Dp": 4.475, "splay_angle": 24.227, "splay_distance": 3.975, "splay_ratio": 0.210, "d22": null, "d64": null, "eta": 168.541, "theta": -126.369, "eta_prime": -178.889, "theta_prime": -125.574, "eta_base": -143.978, "theta_base": -81.202, "v0": 5.310, "v1": -26.093, "v2": 34.547, "v3": -32.861, "v4": 17.844, "amplitude": 35.112, "phase_angle": 10.289, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.541, "filter_rmsd": 0.060, "frame": { "rmsd": 0.015, "origin": [ 14.055, 31.716, 7.742 ], "x_axis": [ 0.374, -0.162, 0.913 ], "y_axis": [ 0.926, 0.127, -0.357 ], "z_axis": [ -0.058, 0.979, 0.198 ], "quaternion": [ 0.652, -0.512, -0.373, -0.417 ] } }, { "index": 22, "index_chain": 22, "chain_name": "A", "nt_resnum": 22, "nt_name": "G", "nt_code": "G", "nt_id": "///A/22", "linked_nts": [ "///A/21", "///A/23" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop", "alpha": -88.092, "beta": 176.294, "gamma": 57.384, "delta": 87.925, "epsilon": -152.929, "zeta": -70.088, "epsilon_zeta": -82.840, "bb_type": "BI", "chi": -147.587, "glyco_bond": "anti", "C5prime_xyz": [ -1.700, 8.758, 0.587 ], "P_xyz": [ 0.696, 9.457, -0.269 ], "form": ".", "ssZp": 4.848, "Dp": 4.568, "splay_angle": 74.325, "splay_distance": 10.922, "splay_ratio": 0.604, "d22": null, "d64": null, "eta": 154.455, "theta": -108.161, "eta_prime": 178.454, "theta_prime": -152.265, "eta_base": -118.153, "theta_base": 144.161, "v0": 4.989, "v1": -25.756, "v2": 34.142, "v3": -32.962, "v4": 18.080, "amplitude": 34.773, "phase_angle": 10.933, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.396, "filter_rmsd": 0.086, "frame": { "rmsd": 0.086, "origin": [ 15.298, 34.305, 10.491 ], "x_axis": [ 0.890, 0.010, 0.456 ], "y_axis": [ 0.429, 0.321, -0.844 ], "z_axis": [ -0.155, 0.947, 0.282 ], "quaternion": [ 0.789, -0.567, -0.193, -0.133 ] } }, { "index": 23, "index_chain": 23, "chain_name": "A", "nt_resnum": 23, "nt_name": "G", "nt_code": "G", "nt_id": "///A/23", "linked_nts": [ "///A/22", "///A/24" ], "nt_type": "RNA", "dbn": ".", "summary": "turn,u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop", "alpha": 110.992, "beta": 168.849, "gamma": 94.930, "delta": 78.442, "epsilon": 74.830, "zeta": 87.720, "epsilon_zeta": -12.891, "bb_type": "--", "chi": -145.997, "glyco_bond": "anti", "C5prime_xyz": [ -0.921, 8.610, -0.249 ], "P_xyz": [ 1.624, 8.817, -0.955 ], "form": "B", "ssZp": 2.238, "Dp": 3.520, "splay_angle": 24.425, "splay_distance": 4.092, "splay_ratio": 0.216, "d22": null, "d64": null, "eta": 40.131, "theta": -109.549, "eta_prime": 65.137, "theta_prime": -127.572, "eta_base": 33.758, "theta_base": -71.439, "v0": 11.981, "v1": -32.398, "v2": 38.565, "v3": -32.796, "v4": 13.777, "amplitude": 38.571, "phase_angle": 1.059, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.041, "frame": { "rmsd": 0.041, "origin": [ 7.647, 41.322, 7.096 ], "x_axis": [ -0.073, -0.139, -0.988 ], "y_axis": [ 0.994, -0.085, -0.062 ], "z_axis": [ -0.076, -0.987, 0.144 ], "quaternion": [ -0.497, -0.466, -0.459, 0.571 ] } }, { "index": 24, "index_chain": 24, "chain_name": "A", "nt_resnum": 24, "nt_name": "A", "nt_code": "A", "nt_id": "///A/24", "linked_nts": [ "///A/23", "///A/25" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate", "alpha": 57.022, "beta": -139.233, "gamma": 166.828, "delta": 83.405, "epsilon": -123.923, "zeta": -93.685, "epsilon_zeta": -30.239, "bb_type": "--", "chi": -158.983, "glyco_bond": "anti", "C5prime_xyz": [ -1.005, 8.432, 0.258 ], "P_xyz": [ 0.798, 8.882, -1.696 ], "form": "A", "ssZp": 3.917, "Dp": 4.876, "splay_angle": 19.805, "splay_distance": 3.122, "splay_ratio": 0.172, "d22": null, "d64": null, "eta": 126.173, "theta": -164.605, "eta_prime": 164.992, "theta_prime": -168.162, "eta_base": -115.057, "theta_base": -163.733, "v0": 7.550, "v1": -30.168, "v2": 39.028, "v3": -35.087, "v4": 17.831, "amplitude": 39.339, "phase_angle": 7.212, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.052, "frame": { "rmsd": 0.027, "origin": [ 9.333, 37.878, 5.667 ], "x_axis": [ 0.707, 0.015, -0.708 ], "y_axis": [ 0.707, -0.062, 0.705 ], "z_axis": [ -0.033, -0.998, -0.054 ], "quaternion": [ 0.631, 0.675, 0.267, -0.274 ] } }, { "index": 25, "index_chain": 25, "chain_name": "A", "nt_resnum": 25, "nt_name": "A", "nt_code": "A", "nt_id": "///A/25", "linked_nts": [ "///A/24", "///A/26" ], "nt_type": "RNA", "dbn": ".", "summary": "u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate", "alpha": -69.452, "beta": 131.942, "gamma": 78.394, "delta": 76.116, "epsilon": 136.643, "zeta": 43.437, "epsilon_zeta": 93.206, "bb_type": "--", "chi": -162.750, "glyco_bond": "anti", "C5prime_xyz": [ -1.711, 8.670, 1.065 ], "P_xyz": [ 0.645, 9.062, -0.017 ], "form": ".", "ssZp": 3.906, "Dp": 4.115, "splay_angle": 47.692, "splay_distance": 7.391, "splay_ratio": 0.408, "d22": null, "d64": null, "eta": 152.984, "theta": -64.591, "eta_prime": -170.975, "theta_prime": -100.614, "eta_base": -144.646, "theta_base": -41.093, "v0": 10.979, "v1": -33.548, "v2": 41.726, "v3": -37.353, "v4": 17.130, "amplitude": 41.852, "phase_angle": 4.433, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1L", "suiteness": 0.492, "filter_rmsd": 0.095, "frame": { "rmsd": 0.083, "origin": [ 7.908, 35.127, 5.283 ], "x_axis": [ 0.880, -0.054, -0.472 ], "y_axis": [ 0.456, -0.183, 0.871 ], "z_axis": [ -0.134, -0.982, -0.136 ], "quaternion": [ 0.625, 0.741, 0.136, -0.204 ] } }, { "index": 26, "index_chain": 26, "chain_name": "A", "nt_resnum": 26, "nt_name": "G", "nt_code": "G", "nt_id": "///A/26", "linked_nts": [ "///A/25", "///A/27" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-donor,phosphate", "alpha": 71.556, "beta": -172.121, "gamma": -178.052, "delta": 103.707, "epsilon": -148.795, "zeta": -72.732, "epsilon_zeta": -76.063, "bb_type": "BI", "chi": -168.752, "glyco_bond": "anti", "C5prime_xyz": [ -0.317, 7.982, 1.299 ], "P_xyz": [ 1.547, 9.469, 0.070 ], "form": "A", "ssZp": 4.710, "Dp": 4.650, "splay_angle": 23.085, "splay_distance": 3.541, "splay_ratio": 0.202, "d22": null, "d64": null, "eta": 127.645, "theta": -152.855, "eta_prime": 171.249, "theta_prime": -147.152, "eta_base": -80.270, "theta_base": -115.114, "v0": 25.371, "v1": -38.161, "v2": 35.564, "v3": -20.952, "v4": -2.347, "amplitude": 38.443, "phase_angle": 337.684, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.058, "frame": { "rmsd": 0.058, "origin": [ 14.118, 31.543, 7.075 ], "x_axis": [ 0.400, -0.186, 0.897 ], "y_axis": [ -0.916, -0.078, 0.393 ], "z_axis": [ -0.003, -0.979, -0.202 ], "quaternion": [ 0.529, 0.648, -0.425, 0.345 ] } }, { "index": 27, "index_chain": 27, "chain_name": "A", "nt_resnum": 27, "nt_name": "G", "nt_code": "G", "nt_id": "///A/27", "linked_nts": [ "///A/26", "///A/28" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -63.344, "beta": 166.539, "gamma": 62.422, "delta": 95.341, "epsilon": -152.558, "zeta": -63.785, "epsilon_zeta": -88.774, "bb_type": "BI", "chi": -162.443, "glyco_bond": "anti", "C5prime_xyz": [ -1.704, 8.673, 0.840 ], "P_xyz": [ 0.933, 8.893, 1.125 ], "form": "A", "ssZp": 4.210, "Dp": 4.450, "splay_angle": 20.299, "splay_distance": 3.517, "splay_ratio": 0.183, "d22": null, "d64": null, "eta": 171.032, "theta": -123.848, "eta_prime": -160.750, "theta_prime": -130.795, "eta_base": -110.212, "theta_base": -103.009, "v0": 11.715, "v1": -27.349, "v2": 30.985, "v3": -24.451, "v4": 8.483, "amplitude": 31.049, "phase_angle": 356.322, "puckering": "C2'-exo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.043, "filter_rmsd": 0.034, "frame": { "rmsd": 0.034, "origin": [ 15.798, 28.438, 7.360 ], "x_axis": [ -0.203, -0.238, 0.950 ], "y_axis": [ -0.977, -0.019, -0.213 ], "z_axis": [ 0.069, -0.971, -0.229 ], "quaternion": [ -0.371, -0.511, 0.594, -0.498 ] } }, { "index": 28, "index_chain": 28, "chain_name": "A", "nt_resnum": 28, "nt_name": "A", "nt_code": "A", "nt_id": "///A/28", "linked_nts": [ "///A/27", "///A/29" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -73.061, "beta": 170.324, "gamma": 57.063, "delta": 74.764, "epsilon": 178.555, "zeta": -87.890, "epsilon_zeta": -93.555, "bb_type": "BI", "chi": -157.640, "glyco_bond": "anti", "C5prime_xyz": [ -2.126, 8.914, 0.313 ], "P_xyz": [ 0.236, 10.079, 0.399 ], "form": "A", "ssZp": 4.172, "Dp": 4.345, "splay_angle": 19.886, "splay_distance": 3.327, "splay_ratio": 0.179, "d22": null, "d64": null, "eta": 160.024, "theta": -150.794, "eta_prime": -177.581, "theta_prime": -153.271, "eta_base": -124.582, "theta_base": -129.310, "v0": -0.078, "v1": -23.240, "v2": 35.690, "v3": -37.532, "v4": 24.103, "amplitude": 37.816, "phase_angle": 19.303, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.469, "filter_rmsd": 0.062, "frame": { "rmsd": 0.043, "origin": [ 16.967, 25.289, 8.403 ], "x_axis": [ -0.730, -0.240, 0.640 ], "y_axis": [ -0.665, 0.036, -0.746 ], "z_axis": [ 0.156, -0.970, -0.186 ], "quaternion": [ -0.173, -0.324, 0.699, -0.614 ] } }, { "index": 29, "index_chain": 29, "chain_name": "A", "nt_resnum": 29, "nt_name": "A", "nt_code": "A", "nt_id": "///A/29", "linked_nts": [ "///A/28", "///A/30" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop", "alpha": 163.682, "beta": -135.623, "gamma": 158.822, "delta": 83.392, "epsilon": -175.772, "zeta": -74.380, "epsilon_zeta": -101.393, "bb_type": "BI", "chi": -169.851, "glyco_bond": "anti", "C5prime_xyz": [ -2.168, 8.614, 1.100 ], "P_xyz": [ -0.206, 9.742, -0.200 ], "form": ".", "ssZp": 4.318, "Dp": 4.430, "splay_angle": 33.662, "splay_distance": 5.266, "splay_ratio": 0.296, "d22": null, "d64": null, "eta": 159.281, "theta": -119.280, "eta_prime": -176.551, "theta_prime": -125.501, "eta_base": -135.072, "theta_base": -72.114, "v0": -0.033, "v1": -23.224, "v2": 35.126, "v3": -36.121, "v4": 23.378, "amplitude": 37.055, "phase_angle": 18.565, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.193, "filter_rmsd": 0.048, "frame": { "rmsd": 0.029, "origin": [ 17.939, 22.336, 9.585 ], "x_axis": [ -0.931, -0.269, 0.246 ], "y_axis": [ -0.249, -0.022, -0.968 ], "z_axis": [ 0.266, -0.963, -0.046 ], "quaternion": [ 0.007, -0.185, 0.699, -0.691 ] } }, { "index": 30, "index_chain": 30, "chain_name": "A", "nt_resnum": 30, "nt_name": "G", "nt_code": "G", "nt_id": "///A/30", "linked_nts": [ "///A/29", "///A/31" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate", "alpha": 161.672, "beta": -111.919, "gamma": 155.924, "delta": 81.690, "epsilon": 179.830, "zeta": 53.926, "epsilon_zeta": 125.904, "bb_type": "--", "chi": -165.137, "glyco_bond": "anti", "C5prime_xyz": [ -2.686, 8.846, 0.038 ], "P_xyz": [ -0.096, 9.461, -0.108 ], "form": ".", "ssZp": 1.721, "Dp": 3.715, "splay_angle": 39.290, "splay_distance": 6.307, "splay_ratio": 0.336, "d22": null, "d64": null, "eta": 173.334, "theta": -51.410, "eta_prime": -143.768, "theta_prime": -92.244, "eta_base": -66.054, "theta_base": -47.949, "v0": 0.064, "v1": -22.734, "v2": 33.607, "v3": -35.071, "v4": 22.676, "amplitude": 35.474, "phase_angle": 18.669, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "1c", "suiteness": 0.019, "filter_rmsd": 0.058, "frame": { "rmsd": 0.058, "origin": [ 14.351, 18.541, 8.910 ], "x_axis": [ -0.662, -0.026, -0.749 ], "y_axis": [ 0.748, 0.054, -0.662 ], "z_axis": [ 0.058, -0.998, -0.016 ], "quaternion": [ 0.307, 0.274, 0.658, -0.631 ] } }, { "index": 31, "index_chain": 31, "chain_name": "A", "nt_resnum": 31, "nt_name": "C", "nt_code": "C", "nt_id": "///A/31", "linked_nts": [ "///A/30", "///A/32" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate", "alpha": -173.744, "beta": 134.757, "gamma": 84.849, "delta": 68.381, "epsilon": 70.834, "zeta": -57.435, "epsilon_zeta": -231.731, "bb_type": "--", "chi": -148.237, "glyco_bond": "anti", "C5prime_xyz": [ -1.522, 8.907, -0.479 ], "P_xyz": [ 0.452, 9.039, -2.207 ], "form": ".", "ssZp": 2.658, "Dp": 3.382, "splay_angle": 61.478, "splay_distance": 10.572, "splay_ratio": 0.512, "d22": null, "d64": null, "eta": 127.318, "theta": 102.815, "eta_prime": 168.810, "theta_prime": 75.162, "eta_base": -122.051, "theta_base": 77.572, "v0": 0.615, "v1": -24.130, "v2": 36.371, "v3": -37.964, "v4": 24.013, "amplitude": 38.330, "phase_angle": 18.398, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.061, "frame": { "rmsd": 0.020, "origin": [ 16.343, 14.893, 4.166 ], "x_axis": [ 0.291, 0.693, -0.660 ], "y_axis": [ 0.887, 0.062, 0.457 ], "z_axis": [ 0.357, -0.718, -0.597 ], "quaternion": [ 0.435, 0.676, 0.585, -0.112 ] } }, { "index": 32, "index_chain": 32, "chain_name": "A", "nt_resnum": 32, "nt_name": "A", "nt_code": "A", "nt_id": "///A/32", "linked_nts": [ "///A/31", "///A/33" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate", "alpha": 127.730, "beta": -168.177, "gamma": -168.980, "delta": 75.242, "epsilon": 143.849, "zeta": 40.472, "epsilon_zeta": 103.378, "bb_type": "--", "chi": 159.967, "glyco_bond": "anti", "C5prime_xyz": [ -2.597, 7.793, 2.776 ], "P_xyz": [ -1.356, 10.073, 3.286 ], "form": ".", "ssZp": 2.541, "Dp": 3.625, "splay_angle": 29.215, "splay_distance": 5.328, "splay_ratio": 0.278, "d22": null, "d64": null, "eta": 177.262, "theta": -110.510, "eta_prime": 154.791, "theta_prime": -112.773, "eta_base": 171.780, "theta_base": -40.532, "v0": 0.178, "v1": -22.969, "v2": 34.450, "v3": -35.798, "v4": 23.190, "amplitude": 36.366, "phase_angle": 18.677, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.072, "frame": { "rmsd": 0.054, "origin": [ 15.368, 14.668, 14.690 ], "x_axis": [ -0.514, 0.323, -0.795 ], "y_axis": [ 0.826, -0.062, -0.560 ], "z_axis": [ -0.230, -0.944, -0.235 ], "quaternion": [ 0.217, 0.442, 0.649, -0.579 ] } }, { "index": 33, "index_chain": 33, "chain_name": "A", "nt_resnum": 33, "nt_name": "G", "nt_code": "G", "nt_id": "///A/33", "linked_nts": [ "///A/32", "///A/34" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate", "alpha": 66.606, "beta": -167.393, "gamma": -178.166, "delta": 79.850, "epsilon": -146.909, "zeta": -66.832, "epsilon_zeta": -80.077, "bb_type": "BI", "chi": -162.915, "glyco_bond": "anti", "C5prime_xyz": [ -1.775, 8.802, 0.876 ], "P_xyz": [ -0.484, 10.716, -0.393 ], "form": "A", "ssZp": 4.236, "Dp": 4.469, "splay_angle": 25.622, "splay_distance": 4.248, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": 118.019, "theta": -168.448, "eta_prime": 159.066, "theta_prime": -161.233, "eta_base": -98.813, "theta_base": -124.529, "v0": 0.784, "v1": -24.866, "v2": 38.185, "v3": -38.999, "v4": 23.970, "amplitude": 40.064, "phase_angle": 17.617, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.049, "frame": { "rmsd": 0.049, "origin": [ 13.857, 12.570, 10.032 ], "x_axis": [ 0.572, -0.009, -0.820 ], "y_axis": [ 0.785, -0.283, 0.551 ], "z_axis": [ -0.237, -0.959, -0.155 ], "quaternion": [ 0.533, 0.709, 0.274, -0.373 ] } }, { "index": 34, "index_chain": 34, "chain_name": "A", "nt_resnum": 34, "nt_name": "C", "nt_code": "C", "nt_id": "///A/34", "linked_nts": [ "///A/33", "///A/35" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -66.891, "beta": 175.808, "gamma": 57.963, "delta": 87.865, "epsilon": -143.309, "zeta": -74.228, "epsilon_zeta": -69.080, "bb_type": "BI", "chi": -161.820, "glyco_bond": "anti", "C5prime_xyz": [ -1.957, 8.912, 0.512 ], "P_xyz": [ 0.359, 9.679, 1.497 ], "form": ".", "ssZp": 3.612, "Dp": 4.309, "splay_angle": 18.071, "splay_distance": 3.049, "splay_ratio": 0.157, "d22": 4.436, "d64": 3.849, "eta": 175.840, "theta": -137.755, "eta_prime": -167.861, "theta_prime": -138.984, "eta_base": -123.529, "theta_base": -108.830, "v0": 1.106, "v1": -22.963, "v2": 33.980, "v3": -34.476, "v4": 21.475, "amplitude": 35.524, "phase_angle": 16.954, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.844, "filter_rmsd": 0.064, "frame": { "rmsd": 0.010, "origin": [ 13.016, 9.204, 7.581 ], "x_axis": [ 0.953, 0.128, -0.274 ], "y_axis": [ 0.290, -0.130, 0.948 ], "z_axis": [ 0.085, -0.983, -0.161 ], "quaternion": [ 0.645, 0.749, 0.139, -0.063 ] } }, { "index": 35, "index_chain": 35, "chain_name": "A", "nt_resnum": 35, "nt_name": "C", "nt_code": "C", "nt_id": "///A/35", "linked_nts": [ "///A/34", "///A/36" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -72.716, "beta": 173.747, "gamma": 45.714, "delta": 69.889, "epsilon": 142.977, "zeta": 41.255, "epsilon_zeta": 101.722, "bb_type": "--", "chi": -142.508, "glyco_bond": "anti", "C5prime_xyz": [ -1.645, 8.884, -0.573 ], "P_xyz": [ 0.831, 9.735, -0.486 ], "form": ".", "ssZp": 3.524, "Dp": 4.049, "splay_angle": 25.381, "splay_distance": 4.436, "splay_ratio": 0.224, "d22": null, "d64": null, "eta": 156.853, "theta": -76.738, "eta_prime": 175.839, "theta_prime": -109.072, "eta_base": -139.323, "theta_base": -77.708, "v0": 1.791, "v1": -26.221, "v2": 37.931, "v3": -39.016, "v4": 23.974, "amplitude": 39.597, "phase_angle": 16.680, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.580, "filter_rmsd": 0.058, "frame": { "rmsd": 0.016, "origin": [ 13.404, 6.484, 6.260 ], "x_axis": [ 0.928, 0.127, 0.351 ], "y_axis": [ -0.300, -0.305, 0.904 ], "z_axis": [ 0.222, -0.944, -0.245 ], "quaternion": [ 0.587, 0.787, -0.055, 0.182 ] } }, { "index": 36, "index_chain": 36, "chain_name": "A", "nt_resnum": 36, "nt_name": "A", "nt_code": "A", "nt_id": "///A/36", "linked_nts": [ "///A/35", "///A/37" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate,splayed-apart", "alpha": 85.906, "beta": 162.180, "gamma": 165.336, "delta": 83.431, "epsilon": -71.198, "zeta": 92.381, "epsilon_zeta": 196.421, "bb_type": "--", "chi": -160.034, "glyco_bond": "anti", "C5prime_xyz": [ -0.720, 8.540, 0.519 ], "P_xyz": [ -0.573, 10.212, -1.570 ], "form": ".", "ssZp": 4.045, "Dp": 4.776, "splay_angle": 86.534, "splay_distance": 13.208, "splay_ratio": 0.686, "d22": null, "d64": null, "eta": 117.837, "theta": 90.057, "eta_prime": 144.470, "theta_prime": 95.058, "eta_base": -160.835, "theta_base": 105.698, "v0": 5.995, "v1": -27.320, "v2": 35.599, "v3": -32.933, "v4": 17.681, "amplitude": 36.040, "phase_angle": 8.972, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "trig", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.068, "frame": { "rmsd": 0.056, "origin": [ 17.058, 4.169, 7.243 ], "x_axis": [ 0.308, 0.358, 0.882 ], "y_axis": [ -0.746, -0.484, 0.457 ], "z_axis": [ 0.590, -0.798, 0.118 ], "quaternion": [ 0.485, 0.647, -0.150, 0.569 ] } }, { "index": 37, "index_chain": 37, "chain_name": "A", "nt_resnum": 37, "nt_name": "A", "nt_code": "A", "nt_id": "///A/37", "linked_nts": [ "///A/36", "///A/38" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,non-pair-contact,internal-loop,cap-acceptor,splayed-apart", "alpha": 67.787, "beta": -102.587, "gamma": -167.043, "delta": 68.744, "epsilon": 170.710, "zeta": 56.197, "epsilon_zeta": 114.513, "bb_type": "--", "chi": 162.677, "glyco_bond": "anti", "C5prime_xyz": [ -1.413, 7.790, 3.171 ], "P_xyz": [ -0.354, 9.713, 1.728 ], "form": ".", "ssZp": 5.008, "Dp": 4.188, "splay_angle": 48.301, "splay_distance": 7.823, "splay_ratio": 0.430, "d22": null, "d64": null, "eta": -144.847, "theta": -98.686, "eta_prime": -144.864, "theta_prime": -93.664, "eta_base": -137.788, "theta_base": -32.440, "v0": -0.235, "v1": -22.878, "v2": 35.786, "v3": -37.547, "v4": 23.822, "amplitude": 37.934, "phase_angle": 19.373, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33t", "cluster": "5n", "suiteness": 0.010, "filter_rmsd": 0.111, "frame": { "rmsd": 0.100, "origin": [ 12.651, -6.963, 1.664 ], "x_axis": [ 0.892, -0.439, 0.105 ], "y_axis": [ 0.135, 0.482, 0.865 ], "z_axis": [ -0.431, -0.758, 0.490 ], "quaternion": [ 0.846, 0.480, -0.159, -0.170 ] } }, { "index": 38, "index_chain": 38, "chain_name": "A", "nt_resnum": 38, "nt_name": "G", "nt_code": "G", "nt_id": "///A/38", "linked_nts": [ "///A/37", "///A/39" ], "nt_type": "RNA", "dbn": ".", "summary": "anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-donor,phosphate", "alpha": -122.757, "beta": 143.578, "gamma": 68.586, "delta": 73.002, "epsilon": -161.021, "zeta": -63.176, "epsilon_zeta": -97.845, "bb_type": "BI", "chi": -154.030, "glyco_bond": "anti", "C5prime_xyz": [ -2.773, 9.044, -0.217 ], "P_xyz": [ -0.529, 10.386, -0.626 ], "form": ".", "ssZp": 3.680, "Dp": 4.368, "splay_angle": 27.351, "splay_distance": 4.372, "splay_ratio": 0.236, "d22": null, "d64": null, "eta": 125.738, "theta": -150.050, "eta_prime": -179.253, "theta_prime": -151.138, "eta_base": -78.165, "theta_base": -88.439, "v0": 1.723, "v1": -26.920, "v2": 38.224, "v3": -38.507, "v4": 24.351, "amplitude": 39.808, "phase_angle": 16.216, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "!!", "suiteness": 0.000, "filter_rmsd": 0.032, "frame": { "rmsd": 0.032, "origin": [ 17.993, -7.394, 7.363 ], "x_axis": [ 0.091, 0.524, 0.847 ], "y_axis": [ -0.995, 0.024, 0.092 ], "z_axis": [ 0.028, -0.851, 0.524 ], "quaternion": [ 0.640, 0.368, -0.320, 0.594 ] } }, { "index": 39, "index_chain": 39, "chain_name": "A", "nt_resnum": 39, "nt_name": "G", "nt_code": "G", "nt_id": "///A/39", "linked_nts": [ "///A/38", "///A/40" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop", "alpha": -72.102, "beta": 170.895, "gamma": 57.423, "delta": 87.398, "epsilon": -156.691, "zeta": -66.636, "epsilon_zeta": -90.056, "bb_type": "BI", "chi": -150.425, "glyco_bond": "anti", "C5prime_xyz": [ -1.404, 8.635, -0.149 ], "P_xyz": [ 1.172, 9.138, 0.085 ], "form": "A", "ssZp": 3.642, "Dp": 4.561, "splay_angle": 21.342, "splay_distance": 3.463, "splay_ratio": 0.186, "d22": null, "d64": null, "eta": 164.384, "theta": -141.156, "eta_prime": -173.971, "theta_prime": -142.950, "eta_base": -93.801, "theta_base": -111.881, "v0": 6.366, "v1": -29.329, "v2": 39.341, "v3": -37.272, "v4": 19.538, "amplitude": 39.935, "phase_angle": 9.893, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.674, "filter_rmsd": 0.046, "frame": { "rmsd": 0.046, "origin": [ 17.065, -8.926, 11.351 ], "x_axis": [ -0.787, 0.345, 0.512 ], "y_axis": [ -0.617, -0.453, -0.644 ], "z_axis": [ 0.010, -0.822, 0.569 ], "quaternion": [ 0.287, 0.156, -0.437, 0.838 ] } }, { "index": 40, "index_chain": 40, "chain_name": "A", "nt_resnum": 40, "nt_name": "C", "nt_code": "C", "nt_id": "///A/40", "linked_nts": [ "///A/39", "///A/41" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -70.553, "beta": 170.959, "gamma": 57.270, "delta": 81.640, "epsilon": -140.749, "zeta": -72.943, "epsilon_zeta": -67.807, "bb_type": "BI", "chi": -158.180, "glyco_bond": "anti", "C5prime_xyz": [ -1.528, 8.893, 0.141 ], "P_xyz": [ 1.022, 9.394, 0.592 ], "form": ".", "ssZp": 3.757, "Dp": 4.673, "splay_angle": 25.274, "splay_distance": 4.113, "splay_ratio": 0.219, "d22": null, "d64": null, "eta": 168.925, "theta": -138.580, "eta_prime": -175.462, "theta_prime": -137.384, "eta_base": -129.307, "theta_base": -106.667, "v0": 5.152, "v1": -28.980, "v2": 40.006, "v3": -38.931, "v4": 21.492, "amplitude": 40.908, "phase_angle": 12.053, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.852, "filter_rmsd": 0.065, "frame": { "rmsd": 0.021, "origin": [ 16.802, -10.968, 14.135 ], "x_axis": [ -0.985, 0.162, -0.063 ], "y_axis": [ -0.040, -0.567, -0.823 ], "z_axis": [ -0.169, -0.807, 0.565 ], "quaternion": [ 0.057, -0.066, -0.462, 0.883 ] } }, { "index": 41, "index_chain": 41, "chain_name": "A", "nt_resnum": 41, "nt_name": "G", "nt_code": "G", "nt_id": "///A/41", "linked_nts": [ "///A/40", "///A/42" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -72.220, "beta": 175.144, "gamma": 52.571, "delta": 89.719, "epsilon": -153.551, "zeta": -62.961, "epsilon_zeta": -90.591, "bb_type": "BI", "chi": -157.526, "glyco_bond": "anti", "C5prime_xyz": [ -1.750, 8.757, 0.457 ], "P_xyz": [ 0.746, 9.337, 0.984 ], "form": ".", "ssZp": 4.215, "Dp": 4.568, "splay_angle": 26.670, "splay_distance": 4.554, "splay_ratio": 0.238, "d22": null, "d64": null, "eta": 159.983, "theta": -130.395, "eta_prime": 175.949, "theta_prime": -132.207, "eta_base": -138.462, "theta_base": -103.894, "v0": 6.076, "v1": -27.679, "v2": 35.804, "v3": -33.664, "v4": 17.995, "amplitude": 36.273, "phase_angle": 9.229, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.761, "filter_rmsd": 0.038, "frame": { "rmsd": 0.038, "origin": [ 15.020, -13.769, 16.564 ], "x_axis": [ -0.718, 0.125, -0.685 ], "y_axis": [ 0.560, -0.481, -0.675 ], "z_axis": [ -0.413, -0.868, 0.276 ], "quaternion": [ -0.138, -0.349, -0.490, 0.787 ] } }, { "index": 42, "index_chain": 42, "chain_name": "A", "nt_resnum": 42, "nt_name": "C", "nt_code": "C", "nt_id": "///A/42", "linked_nts": [ "///A/41", "///A/43" ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack", "alpha": -69.316, "beta": 171.000, "gamma": 57.243, "delta": 80.890, "epsilon": -160.976, "zeta": -75.221, "epsilon_zeta": -85.754, "bb_type": "BI", "chi": -172.312, "glyco_bond": "anti", "C5prime_xyz": [ -2.340, 8.813, 1.153 ], "P_xyz": [ -0.075, 9.986, 1.792 ], "form": "A", "ssZp": 4.353, "Dp": 4.507, "splay_angle": 18.050, "splay_distance": 2.956, "splay_ratio": 0.163, "d22": 4.591, "d64": 4.335, "eta": 163.702, "theta": -156.890, "eta_prime": -174.867, "theta_prime": -155.768, "eta_base": -123.785, "theta_base": -121.984, "v0": 1.656, "v1": -26.832, "v2": 39.225, "v3": -39.113, "v4": 24.181, "amplitude": 40.822, "phase_angle": 16.083, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.774, "filter_rmsd": 0.058, "frame": { "rmsd": 0.016, "origin": [ 11.227, -16.238, 17.074 ], "x_axis": [ -0.195, -0.008, -0.981 ], "y_axis": [ 0.924, -0.337, -0.181 ], "z_axis": [ -0.329, -0.942, 0.073 ], "quaternion": [ -0.368, -0.517, -0.443, 0.633 ] } }, { "index": 43, "index_chain": 43, "chain_name": "A", "nt_resnum": 43, "nt_name": "C", "nt_code": "C", "nt_id": "///A/43", "linked_nts": [ "///A/42", null ], "nt_type": "RNA", "dbn": ")", "summary": "anti,~C3'-endo,non-stack,canonical,helix-end,stem-end,coaxial-stack", "alpha": -72.037, "beta": -179.662, "gamma": 51.979, "delta": 80.041, "epsilon": null, "zeta": null, "epsilon_zeta": null, "bb_type": "--", "chi": -152.317, "glyco_bond": "anti", "C5prime_xyz": [ -1.521, 8.868, 0.095 ], "P_xyz": [ 1.057, 9.397, 0.420 ], "form": "-", "ssZp": null, "Dp": null, "splay_angle": null, "splay_distance": null, "splay_ratio": null, "d22": null, "d64": null, "eta": null, "theta": null, "eta_prime": null, "theta_prime": null, "eta_base": null, "theta_base": null, "v0": 3.895, "v1": -26.960, "v2": 37.835, "v3": -37.586, "v4": 21.000, "amplitude": 38.893, "phase_angle": 13.396, "puckering": "C3'-endo", "sugar_class": "~C3'-endo", "bin": "33p", "cluster": "1a", "suiteness": 0.859, "filter_rmsd": 0.060, "frame": { "rmsd": 0.011, "origin": [ 8.772, -17.868, 16.842 ], "x_axis": [ 0.387, -0.297, -0.873 ], "y_axis": [ 0.776, -0.406, 0.482 ], "z_axis": [ -0.498, -0.864, 0.074 ], "quaternion": [ 0.514, 0.655, 0.183, -0.523 ] } } ], "num_hbonds": 87, "hbonds": [ { "index": 1, "atom1_serNum": 8, "atom2_serNum": 39, "donAcc_type": "acceptable", "distance": 2.751, "atom1_id": "///A/1/O2'", "atom2_id": "///A/2/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 2, "atom1_serNum": 15, "atom2_serNum": 1381, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/1/O6", "atom2_id": "///A/43/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 3, "atom1_serNum": 16, "atom2_serNum": 1379, "donAcc_type": "standard", "distance": 2.866, "atom1_id": "///A/1/N1", "atom2_id": "///A/43/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 4, "atom1_serNum": 18, "atom2_serNum": 1378, "donAcc_type": "standard", "distance": 2.736, "atom1_id": "///A/1/N2", "atom2_id": "///A/43/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 5, "atom1_serNum": 50, "atom2_serNum": 1350, "donAcc_type": "standard", "distance": 2.799, "atom1_id": "///A/2/O6", "atom2_id": "///A/42/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 6, "atom1_serNum": 51, "atom2_serNum": 1348, "donAcc_type": "standard", "distance": 2.850, "atom1_id": "///A/2/N1", "atom2_id": "///A/42/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 7, "atom1_serNum": 53, "atom2_serNum": 1347, "donAcc_type": "standard", "distance": 2.723, "atom1_id": "///A/2/N2", "atom2_id": "///A/42/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 8, "atom1_serNum": 81, "atom2_serNum": 1319, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/3/O2", "atom2_id": "///A/41/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 9, "atom1_serNum": 82, "atom2_serNum": 1317, "donAcc_type": "standard", "distance": 2.831, "atom1_id": "///A/3/N3", "atom2_id": "///A/41/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 10, "atom1_serNum": 84, "atom2_serNum": 1316, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/3/N4", "atom2_id": "///A/41/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 11, "atom1_serNum": 115, "atom2_serNum": 1285, "donAcc_type": "standard", "distance": 2.770, "atom1_id": "///A/4/O6", "atom2_id": "///A/40/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 12, "atom1_serNum": 116, "atom2_serNum": 1283, "donAcc_type": "standard", "distance": 2.833, "atom1_id": "///A/4/N1", "atom2_id": "///A/40/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 13, "atom1_serNum": 118, "atom2_serNum": 1282, "donAcc_type": "standard", "distance": 2.785, "atom1_id": "///A/4/N2", "atom2_id": "///A/40/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 14, "atom1_serNum": 142, "atom2_serNum": 168, "donAcc_type": "acceptable", "distance": 2.835, "atom1_id": "///A/5/O2'", "atom2_id": "///A/6/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 15, "atom1_serNum": 146, "atom2_serNum": 1252, "donAcc_type": "standard", "distance": 2.821, "atom1_id": "///A/5/O2", "atom2_id": "///A/39/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 16, "atom1_serNum": 147, "atom2_serNum": 1251, "donAcc_type": "standard", "distance": 3.004, "atom1_id": "///A/5/N3", "atom2_id": "///A/39/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 17, "atom1_serNum": 172, "atom2_serNum": 198, "donAcc_type": "acceptable", "distance": 2.826, "atom1_id": "///A/6/O2'", "atom2_id": "///A/7/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 18, "atom1_serNum": 172, "atom2_serNum": 228, "donAcc_type": "acceptable", "distance": 3.433, "atom1_id": "///A/6/O2'", "atom2_id": "///A/8/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 19, "atom1_serNum": 176, "atom2_serNum": 1254, "donAcc_type": "standard", "distance": 2.727, "atom1_id": "///A/6/O2", "atom2_id": "///A/39/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 20, "atom1_serNum": 177, "atom2_serNum": 1217, "donAcc_type": "standard", "distance": 2.776, "atom1_id": "///A/6/N3", "atom2_id": "///A/38/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 21, "atom1_serNum": 202, "atom2_serNum": 206, "donAcc_type": "acceptable", "distance": 2.892, "atom1_id": "///A/7/O2'", "atom2_id": "///A/7/O2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 22, "atom1_serNum": 202, "atom2_serNum": 224, "donAcc_type": "acceptable", "distance": 2.397, "atom1_id": "///A/7/O2'", "atom2_id": "///A/8/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 23, "atom1_serNum": 232, "atom2_serNum": 256, "donAcc_type": "acceptable", "distance": 2.409, "atom1_id": "///A/8/O2'", "atom2_id": "///A/9/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 24, "atom1_serNum": 232, "atom2_serNum": 1218, "donAcc_type": "acceptable", "distance": 2.855, "atom1_id": "///A/8/O2'", "atom2_id": "///A/38/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 25, "atom1_serNum": 239, "atom2_serNum": 1152, "donAcc_type": "standard", "distance": 2.881, "atom1_id": "///A/8/N6", "atom2_id": "///A/36/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 26, "atom1_serNum": 256, "atom2_serNum": 1220, "donAcc_type": "standard", "distance": 2.718, "atom1_id": "///A/9/OP1", "atom2_id": "///A/38/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 27, "atom1_serNum": 265, "atom2_serNum": 287, "donAcc_type": "acceptable", "distance": 2.450, "atom1_id": "///A/9/O2'", "atom2_id": "///A/10/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 28, "atom1_serNum": 272, "atom2_serNum": 334, "donAcc_type": "questionable", "distance": 3.208, "atom1_id": "///A/9/N4", "atom2_id": "///A/11/N6", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 29, "atom1_serNum": 272, "atom2_serNum": 1144, "donAcc_type": "acceptable", "distance": 2.959, "atom1_id": "///A/9/N4", "atom2_id": "///A/36/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 30, "atom1_serNum": 272, "atom2_serNum": 1154, "donAcc_type": "standard", "distance": 3.088, "atom1_id": "///A/9/N4", "atom2_id": "///A/36/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 31, "atom1_serNum": 327, "atom2_serNum": 352, "donAcc_type": "acceptable", "distance": 2.430, "atom1_id": "///A/11/O2'", "atom2_id": "///A/12/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 32, "atom1_serNum": 327, "atom2_serNum": 353, "donAcc_type": "acceptable", "distance": 3.060, "atom1_id": "///A/11/O2'", "atom2_id": "///A/12/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 33, "atom1_serNum": 334, "atom2_serNum": 1154, "donAcc_type": "standard", "distance": 2.790, "atom1_id": "///A/11/N6", "atom2_id": "///A/36/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 34, "atom1_serNum": 337, "atom2_serNum": 356, "donAcc_type": "questionable", "distance": 3.158, "atom1_id": "///A/11/N3", "atom2_id": "///A/12/O4'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 35, "atom1_serNum": 360, "atom2_serNum": 390, "donAcc_type": "acceptable", "distance": 2.971, "atom1_id": "///A/12/O2'", "atom2_id": "///A/13/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 36, "atom1_serNum": 367, "atom2_serNum": 1120, "donAcc_type": "standard", "distance": 2.802, "atom1_id": "///A/12/O6", "atom2_id": "///A/35/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 37, "atom1_serNum": 368, "atom2_serNum": 1118, "donAcc_type": "standard", "distance": 2.855, "atom1_id": "///A/12/N1", "atom2_id": "///A/35/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 38, "atom1_serNum": 370, "atom2_serNum": 1117, "donAcc_type": "standard", "distance": 2.756, "atom1_id": "///A/12/N2", "atom2_id": "///A/35/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 39, "atom1_serNum": 401, "atom2_serNum": 1089, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///A/13/O6", "atom2_id": "///A/34/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 40, "atom1_serNum": 402, "atom2_serNum": 1087, "donAcc_type": "standard", "distance": 2.862, "atom1_id": "///A/13/N1", "atom2_id": "///A/34/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 41, "atom1_serNum": 404, "atom2_serNum": 1086, "donAcc_type": "standard", "distance": 2.760, "atom1_id": "///A/13/N2", "atom2_id": "///A/34/O2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 42, "atom1_serNum": 428, "atom2_serNum": 449, "donAcc_type": "acceptable", "distance": 2.425, "atom1_id": "///A/14/O2'", "atom2_id": "///A/15/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 43, "atom1_serNum": 432, "atom2_serNum": 1056, "donAcc_type": "standard", "distance": 2.703, "atom1_id": "///A/14/O2", "atom2_id": "///A/33/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 44, "atom1_serNum": 433, "atom2_serNum": 1055, "donAcc_type": "standard", "distance": 2.825, "atom1_id": "///A/14/N3", "atom2_id": "///A/33/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 45, "atom1_serNum": 454, "atom2_serNum": 1058, "donAcc_type": "standard", "distance": 3.462, "atom1_id": "///A/15/O4'", "atom2_id": "///A/33/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 46, "atom1_serNum": 458, "atom2_serNum": 482, "donAcc_type": "acceptable", "distance": 2.896, "atom1_id": "///A/15/O2'", "atom2_id": "///A/16/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 47, "atom1_serNum": 458, "atom2_serNum": 485, "donAcc_type": "acceptable", "distance": 2.973, "atom1_id": "///A/15/O2'", "atom2_id": "///A/16/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 48, "atom1_serNum": 458, "atom2_serNum": 1022, "donAcc_type": "acceptable", "distance": 2.831, "atom1_id": "///A/15/O2'", "atom2_id": "///A/32/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 49, "atom1_serNum": 462, "atom2_serNum": 1022, "donAcc_type": "standard", "distance": 2.754, "atom1_id": "///A/15/O2", "atom2_id": "///A/32/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 50, "atom1_serNum": 465, "atom2_serNum": 989, "donAcc_type": "standard", "distance": 2.829, "atom1_id": "///A/15/N4", "atom2_id": "///A/31/N3", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 51, "atom1_serNum": 481, "atom2_serNum": 924, "donAcc_type": "standard", "distance": 3.639, "atom1_id": "///A/16/OP2", "atom2_id": "///A/29/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 52, "atom1_serNum": 481, "atom2_serNum": 958, "donAcc_type": "standard", "distance": 2.659, "atom1_id": "///A/16/OP2", "atom2_id": "///A/30/N1", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 53, "atom1_serNum": 481, "atom2_serNum": 960, "donAcc_type": "standard", "distance": 2.691, "atom1_id": "///A/16/OP2", "atom2_id": "///A/30/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 54, "atom1_serNum": 489, "atom2_serNum": 513, "donAcc_type": "acceptable", "distance": 2.430, "atom1_id": "///A/16/O2'", "atom2_id": "///A/17/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 55, "atom1_serNum": 522, "atom2_serNum": 552, "donAcc_type": "acceptable", "distance": 2.613, "atom1_id": "///A/17/O2'", "atom2_id": "///A/18/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 56, "atom1_serNum": 526, "atom2_serNum": 960, "donAcc_type": "standard", "distance": 3.893, "atom1_id": "///A/17/N7", "atom2_id": "///A/30/N2", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 57, "atom1_serNum": 529, "atom2_serNum": 950, "donAcc_type": "acceptable", "distance": 2.495, "atom1_id": "///A/17/O6", "atom2_id": "///A/30/O2'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 58, "atom1_serNum": 530, "atom2_serNum": 975, "donAcc_type": "standard", "distance": 2.895, "atom1_id": "///A/17/N1", "atom2_id": "///A/31/OP1", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 59, "atom1_serNum": 556, "atom2_serNum": 583, "donAcc_type": "acceptable", "distance": 2.657, "atom1_id": "///A/18/O2'", "atom2_id": "///A/19/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 60, "atom1_serNum": 563, "atom2_serNum": 924, "donAcc_type": "standard", "distance": 2.964, "atom1_id": "///A/18/O6", "atom2_id": "///A/29/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 61, "atom1_serNum": 564, "atom2_serNum": 925, "donAcc_type": "standard", "distance": 2.784, "atom1_id": "///A/18/N1", "atom2_id": "///A/29/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 62, "atom1_serNum": 566, "atom2_serNum": 950, "donAcc_type": "acceptable", "distance": 2.842, "atom1_id": "///A/18/N2", "atom2_id": "///A/30/O2'", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 63, "atom1_serNum": 595, "atom2_serNum": 892, "donAcc_type": "standard", "distance": 2.937, "atom1_id": "///A/19/N3", "atom2_id": "///A/28/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 64, "atom1_serNum": 597, "atom2_serNum": 891, "donAcc_type": "standard", "distance": 2.816, "atom1_id": "///A/19/O4", "atom2_id": "///A/28/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 65, "atom1_serNum": 624, "atom2_serNum": 860, "donAcc_type": "standard", "distance": 2.752, "atom1_id": "///A/20/O2", "atom2_id": "///A/27/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 66, "atom1_serNum": 625, "atom2_serNum": 858, "donAcc_type": "standard", "distance": 2.835, "atom1_id": "///A/20/N3", "atom2_id": "///A/27/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 67, "atom1_serNum": 627, "atom2_serNum": 857, "donAcc_type": "standard", "distance": 2.822, "atom1_id": "///A/20/N4", "atom2_id": "///A/27/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 68, "atom1_serNum": 655, "atom2_serNum": 826, "donAcc_type": "standard", "distance": 2.751, "atom1_id": "///A/21/O2", "atom2_id": "///A/26/N2", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 69, "atom1_serNum": 656, "atom2_serNum": 824, "donAcc_type": "standard", "distance": 2.847, "atom1_id": "///A/21/N3", "atom2_id": "///A/26/N1", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 70, "atom1_serNum": 658, "atom2_serNum": 823, "donAcc_type": "standard", "distance": 2.783, "atom1_id": "///A/21/N4", "atom2_id": "///A/26/O6", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 71, "atom1_serNum": 682, "atom2_serNum": 754, "donAcc_type": "acceptable", "distance": 3.263, "atom1_id": "///A/22/O2'", "atom2_id": "///A/24/N7", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 72, "atom1_serNum": 682, "atom2_serNum": 757, "donAcc_type": "acceptable", "distance": 2.897, "atom1_id": "///A/22/O2'", "atom2_id": "///A/24/N6", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 73, "atom1_serNum": 690, "atom2_serNum": 775, "donAcc_type": "standard", "distance": 2.717, "atom1_id": "///A/22/N1", "atom2_id": "///A/25/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 74, "atom1_serNum": 692, "atom2_serNum": 775, "donAcc_type": "standard", "distance": 2.689, "atom1_id": "///A/22/N2", "atom2_id": "///A/25/OP2", "atom_pair": "N:O", "residue_pair": "nt:nt" }, { "index": 75, "atom1_serNum": 692, "atom2_serNum": 787, "donAcc_type": "standard", "distance": 2.660, "atom1_id": "///A/22/N2", "atom2_id": "///A/25/N7", "atom_pair": "N:N", "residue_pair": "nt:nt" }, { "index": 76, "atom1_serNum": 716, "atom2_serNum": 741, "donAcc_type": "acceptable", "distance": 2.427, "atom1_id": "///A/23/O2'", "atom2_id": "///A/24/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 77, "atom1_serNum": 716, "atom2_serNum": 743, "donAcc_type": "acceptable", "distance": 3.110, "atom1_id": "///A/23/O2'", "atom2_id": "///A/24/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 78, "atom1_serNum": 783, "atom2_serNum": 807, "donAcc_type": "acceptable", "distance": 2.441, "atom1_id": "///A/25/O2'", "atom2_id": "///A/26/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 79, "atom1_serNum": 884, "atom2_serNum": 910, "donAcc_type": "acceptable", "distance": 2.798, "atom1_id": "///A/28/O2'", "atom2_id": "///A/29/O5'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 80, "atom1_serNum": 884, "atom2_serNum": 913, "donAcc_type": "acceptable", "distance": 2.946, "atom1_id": "///A/28/O2'", "atom2_id": "///A/29/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 81, "atom1_serNum": 942, "atom2_serNum": 991, "donAcc_type": "standard", "distance": 2.700, "atom1_id": "///A/30/OP2", "atom2_id": "///A/31/N4", "atom_pair": "O:N", "residue_pair": "nt:nt" }, { "index": 82, "atom1_serNum": 950, "atom2_serNum": 975, "donAcc_type": "acceptable", "distance": 3.085, "atom1_id": "///A/30/O2'", "atom2_id": "///A/31/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 83, "atom1_serNum": 984, "atom2_serNum": 1007, "donAcc_type": "acceptable", "distance": 2.401, "atom1_id": "///A/31/O2'", "atom2_id": "///A/32/OP2", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 84, "atom1_serNum": 1015, "atom2_serNum": 1039, "donAcc_type": "acceptable", "distance": 2.410, "atom1_id": "///A/32/O2'", "atom2_id": "///A/33/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 85, "atom1_serNum": 1113, "atom2_serNum": 1135, "donAcc_type": "acceptable", "distance": 2.426, "atom1_id": "///A/35/O2'", "atom2_id": "///A/36/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 86, "atom1_serNum": 1144, "atom2_serNum": 1173, "donAcc_type": "acceptable", "distance": 2.646, "atom1_id": "///A/36/O2'", "atom2_id": "///A/37/O4'", "atom_pair": "O:O", "residue_pair": "nt:nt" }, { "index": 87, "atom1_serNum": 1177, "atom2_serNum": 1201, "donAcc_type": "acceptable", "distance": 2.511, "atom1_id": "///A/37/O2'", "atom2_id": "///A/38/OP1", "atom_pair": "O:O", "residue_pair": "nt:nt" } ], "refCoords": { "purine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -0.5000 0.4000", " 3 N -2.2500 -0.5000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 -0.5000 0.4000", " 7 C 1.2500 -0.5000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -0.5000 0.4000", " 11 C -2.2500 -0.5000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "pyrimidine": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 1.0000 0.4000", " 3 N -2.2500 1.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 1.2500 5.0000 0.4000", " 6 C 1.2500 1.0000 0.4000", " 7 C 1.2500 1.0000 -0.4000", " 8 C 1.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 1.0000 0.4000", " 11 C -2.2500 1.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ], "wc_pair": [ " 12 ATOMS, 12 BONDS", " 1 N -2.2500 5.0000 0.4000", " 2 N -2.2500 -5.0000 0.4000", " 3 N -2.2500 -5.0000 -0.4000", " 4 N -2.2500 5.0000 -0.4000", " 5 C 2.2500 5.0000 0.4000", " 6 C 2.2500 -5.0000 0.4000", " 7 C 2.2500 -5.0000 -0.4000", " 8 C 2.2500 5.0000 -0.4000", " 9 C -2.2500 5.0000 0.4000", " 10 C -2.2500 -5.0000 0.4000", " 11 C -2.2500 -5.0000 -0.4000", " 12 C -2.2500 5.0000 -0.4000", " 1 1 2", " 2 2 3", " 3 3 4", " 4 4 1", " 5 5 6", " 6 6 7", " 7 7 8", " 8 5 8", " 9 9 5", " 10 10 6", " 11 11 7", " 12 12 8" ] }, "metadata": { "license": "http://innovation.columbia.edu/technologies/CU20391", "url": "http://x3dna.org/", "url_alt": "http://home.x3dna.org/", "forum": "http://forum.x3dna.org/", "citation": "Lu et al. (2015). 'DSSR: an integrated software tool for dissecting the spatial structure of RNA.' Nucleic Acids Res., 43(21):e142 [doi:10.1093/nar/gkv716].", "str_id": "1cq5", "num_naChains": 1, "naChains": "A=43", "num_atoms": 1395, "num_waters": 0, "num_notes": 52, "notes": [ { "Aminors": "A-minor interactions (including types I and II)" }, { "Cstem_index": "stem index of the 'Canonical' helix in k-turn" }, { "Cstem_pair": "Cstem bp delineating the k-turn internal loop" }, { "Dp": "perpendicular distance of the 3' P atom to the glycosidic bond" }, { "GA_pair": "sheared G-A pair in k-turn" }, { "HtypePknot": "H-type pseudoknot" }, { "Kturn": "kink-turn (k-turn)" }, { "LW": "Leontis-Westhof" }, { "NCstem_index": "stem index of the 'Non-Canonical' helix in k-turn" }, { "NCstem_pair": "NCstem bp delineating the k-turn internal loop" }, { "Uturn": "U-turn of the UNR- or GNRA-type" }, { "aa": "amino acid" }, { "atom_pair": "symbols of the two atoms involved in an H-bond" }, { "auxfiles": "auxiliary files" }, { "glyco_bond": "conformation of base related to sugar (syn or anti)" }, { "bb_type": "backbone conformation, BI or BII" }, { "bending_angle": "angle between two helical axes" }, { "bp": "base pair" }, { "bseq": "base sequence in one-letter code" }, { "bulge": "bulge loop" }, { "coaxStacks": "coaxial stacking of stems within a helix" }, { "dbn": "dot bracket notation" }, { "desc": "description" }, { "donAcc_type": "donor/acceptor type of the atom pair in an H-bond" }, { "epsilon_zeta": "difference between epsilon and zeta torsion angles" }, { "hairpin": "hairpin loop" }, { "hbond": "hydrogen bond (H-bond)" }, { "helix": "defined by base-stacking interactions, regardless of bp type and backbone connectivity" }, { "id": "identifier" }, { "iloop": "internal loop" }, { "index": "serial number" }, { "isoCanonPairs": "isolated canonical pairs" }, { "junction": "(multi-branched) junction loop" }, { "kissingLoop": "kissing loop" }, { "multiplet": "3+ bases in a coplanar geometry" }, { "na": "nucleic acid" }, { "nonPair": "two nts not forming a pair, but with H-bonding/stacking interactions" }, { "nonStack": "nucleotide not involved in stacking interactions" }, { "nt": "nucleotide" }, { "num": "number" }, { "oArea": "overlap areas between two bases, including exocyclic atoms" }, { "oArea_ring": "overlap areas between two bases, including only ring atoms" }, { "phosContacts": "H-bonding and atom-capping interactions involving a phosphate" }, { "residue_pair": "types of the two residues involved in an H-bond" }, { "rmsd": "root-mean-squares deviation" }, { "serNum": "serial number" }, { "ssSegments": "single-stranded segments not involved in loops" }, { "ssZp": "Z-coordinate of the 3' phosphorus atom with reference to the 5' base plane" }, { "sstr": "secondary structure in dbn" }, { "stem": "helix consisting of only canonical pairs, with a continuous backbone" }, { "str_id": "structure identifier, derived from inpfile with extension removed" }, { "vert_dist": "vertical distance from an atom to a base plane" } ], "num_auxfiles": 13, "auxfiles": [ { "index": 1, "name": "dssr-pairs.pdb", "desc": "an ensemble of base pairs" }, { "index": 2, "name": "dssr-multiplets.pdb", "desc": "an ensemble of multiplets" }, { "index": 3, "name": "dssr-stems.pdb", "desc": "an ensemble of stems" }, { "index": 4, "name": "dssr-helices.pdb", "desc": "an ensemble of helices (coaxial stacking)" }, { "index": 5, "name": "dssr-hairpins.pdb", "desc": "an ensemble of hairpin loops" }, { "index": 6, "name": "dssr-iloops.pdb", "desc": "an ensemble of internal loops" }, { "index": 7, "name": "dssr-2ndstrs.bpseq", "desc": "secondary structure in bpseq format" }, { "index": 8, "name": "dssr-2ndstrs.ct", "desc": "secondary structure in connectivity table format" }, { "index": 9, "name": "dssr-2ndstrs.dbn", "desc": "secondary structure in dot-bracket notation" }, { "index": 10, "name": "dssr-torsions.txt", "desc": "backbone torsion angles and suite names" }, { "index": 11, "name": "dssr-splays.pdb", "desc": "an ensemble of splayed-apart units" }, { "index": 12, "name": "dssr-stacks.pdb", "desc": "an ensemble of base stacks" }, { "index": 13, "name": "dssr-atom2bases.pdb", "desc": "an ensemble of atom-base stacking interactions" } ], "time_used": "999" } }